Cindy Goes Dodo - Unicamprepositorio.unicamp.br/bitstream/REPOSIP/304942/1/Dodo_CindyGoe… ·...
Transcript of Cindy Goes Dodo - Unicamprepositorio.unicamp.br/bitstream/REPOSIP/304942/1/Dodo_CindyGoe… ·...
UNIVERSIDADE ESTADUAL DE CAMPINAS
FACULDADE DE ODONTOLOGIA DE PIRACICABA
Cindy Goes Dodo
O efeito de partículas de titânio na osseointegração
The effect of titanium particles on the osseointegration
Piracicaba
2016
CINDY GOES DODO
O efeito de partículas de titânio na osseointegração.
The effect of titanium particles on the osseointegration.
Orientador: Altair Antoninha Del Bel Cury
Piracicaba
2016
ESTE EXEMPLAR CORRESPONDE À VERSÃO FINAL DA TESE DEFENDIDA PELA ALUNA CINDY GOES DODO, E ORIENTADA PELA PROFA. DRA. ALTAIR ANTONINHA DEL BEL CURY
Thesis presented to the Piracicaba
Dental School of the University of Campinas
in partial fulfillment of the requirements for the
degree of Doctor in Dental Clinic, in Dental
Prosthesis area
Tese apresentada à Faculdade de
Odontologia de Piracicaba da Universidade
Estadual de Campinas como parte dos
requisitos exigidos para a obtenção do título de
Doutora em Clínica Odontológica, área de
concentração em Prótese Dental
DEDICATÓRIA
Dedico esta tese à minha família, por todo amor, apoio e incentivo
para a conclusão deste trabalho.
Agradecimento Especial
À minha orientadora, Profa. Dra. Altair Antoninha Del Bel Cury pela
confiança, dedicação e paciência durante minha formação. Sou extremamente grata
por acreditar na minha capacidade, por me estimular e por tentar incansavelmente
extrair todo meu potencial. Certamente levarei seu exemplo profissional e humano
para toda a minha vida.
Agradecimentos
A Deus, a quem sou grata por esta jornada, onde tenho a oportunidade de
evoluir e aprender.
A Universidade Estadual de Campinas por meio do seu magnífico Reitor,
Prof. Dr. José Tadeu.
A Faculdade de Odontologia de Piracicaba da Universidade Estadual de
Campinas, na pessoa de seu Diretor, Prof. Dr. Guilherme Elias Pessanha Henriques.
A Coordenadora dos Cursos de Pós-Graduação da Faculdade de
Odontologia de Piracicaba, Profa. Dra. Cínthia Pereira Machado Tabchoury.
A Coordenadora do Programa de Pós-Graduação em Clínica Odontológica
da Faculdade de Odontologia de Piracicaba da Universidade Estadual de Campinas,
Prof. Dra. Karina Gonzales Silvério Ruiz.
A Fundação de Amparo à Pesquisa do Estado de São Paulo, FAPESP, pelas
bolsas de estudo de Mestrado (2011/16318-8), Doutorado Direto (2013/19791-8) e
Estágio Pesquisa no Exterior (BEPE, 2014/10085-6) na Universidade de Rochester,
NY, Estados Unidos da América.
A Universidade de Rochester, por meio do magnífico Reitor Dr. Joel Seligman e ao Diretor da Faculdade de Medicina e Odontologia Dr. Mark B. Taubman pela
oportunidade do estágio.
Ao Prof. Dr. Luiz Meirelles e sua família pela amizade, convivência e
confiança. Agradeço ao Professor pelas inúmeras oportunidades de aprendizado
durante meu estágio no Eastman Institute for Oral Health sob sua orientação. Seu
desempenho como professor e pesquisador é inspirador.
Aos professores Profa. Dra. Jacqueline Abranches e Prof. Dr. José Lemos por me receberem em seu laboratório para o desenvolvimento de parte deste trabalho.
Aos docentes da área de Prótese Dentária da Faculdade de Odontologia de
Piracicaba, Prof. Dr. Guilherme Elias Pessanha Henriques, Prof. Dr. Marcelo Ferraz Mesquita, Prof. Dr. Mauro Antônio de Arruda Nóbilo, Prof. Dr. Rafael Leonardo Xediek Consani e Prof. Valentim Adelino Ricardo Barão por
contribuírem com minha formação pessoal e profissional ao longo da pós-graduação.
Aos Professores da Área de Prótese Parcial Removível, Profa. Dra. Célia Rizatti Barbosa, Prof. Dra. Renata Cunha Matheus Rodrigues Garcia, e Prof. Dr. Wander José da Silva pelo conhecimento compartilhado, boa convivência, carinho e
atenção.
A todos os docentes do Programa de Pós-Graduação em Clínica Odontológica
da Faculdade de Odontologia de Piracicaba, Universidade Estadual de Campinas, que
de alguma forma contribuíram para meu aprendizado e crescimento profissional.
A Sra. Eliete Lima secretária da Área de Prótese pelo carinho, atenção e
disponibilidade.
A Sra. Gislaine Piton, técnica do Laboratório de Prótese Parcial Removível,
por cuidar com tanto carinho e dedicação do nosso laboratório e alunos.
A Área de Periodontia pela oportunidade de utilizar o laboratório de Biologia
Molecular para o desenvolvimento deste trabalho, em especial à Profa. Dra. Karina Gonzalez.
Aos Professores Prof. Dr. Marcelo Mesquita, Prof. Dr. Valentim Barão, Profa. Dra. Fernanda Faot, pela solicitude e bons conselhos.
Aos técnicos Sr. Adriano Martins, Sra. Eliene Navares, Sra. Mariana Lazarin, pela disponibilidade e aprendizado.
A todos amigos e colegas de pós-graduação pela convivência agradável,
aprendi e me diverti muito com todos vocês. Em especial agradeço aos amigos Plinio Mendes Senna, Antonio Pedro Ricomini, Bruno Salles Sotto-Maior, Marcele Pimentel Jardim, Indira Cavalcanti, Germana de Villa Camargos, Priscilla Cardoso Lazari, Isabella Marques, Claudia Brilhante, Paula Bavia, Lis Meirelles, Ana Paula Martins, Marco Aurélio de Carvalho, Giselle Ribeiro, Camila Heitor, Larissa Vila Nova, Guilherme Henrique Oliveira, Thais Veja Gonçalves, Bruna
Alfenas, Dimorvan Bordin e Edmara Tatiely Pedroso Bergamo que colaboraram
em muitos sentidos para o desenvolvimento deste trabalho, seja compartilhando
conhecimento, corrigindo um documento, me aconselhando ou simplesmente me
ouvindo.
As minhas queridas amigas Thatiana de Vicente Leite, Caroline Hanada Odo, Pamela Saporski, Polliane Sciliano, Izabella Patta Pereira, Mabelle Monteiro, Sthefanie Furlan, Ana Carolina Horita, Larissa Resende, Carolina Ventura Beatriz Porto, e Núbia Pini, por me apoiarem e me darem forças para
sempre seguir em frente.
A toda a minha Família por me apoiar incondicionalmente em todas as minhas
decisões, por ser minha base e minha estrutura. Este trabalho não teria se
concretizado sem a ajuda de cada um de vocês.
Resumo Tratamentos de superfície em implantes dentais de titânio têm sido desenvolvidos para aumentar a rugosidade de superfície e consequentemente melhorar a osseointegração. Apesar do sucesso clínico dos implantes dentais, em muitos casos pode ocorrer perda óssea marginal e o mecanismo relacionado a este processo não está claro na literatura. Alguns estudos descrevem que, durante a inserção do implante no osso, os picos criados para produzir superfícies rugosas, podem se quebrar em micro e/ou nanopartículas de titânio, que são liberadas no tecido peri-implantar e podem levar a perda óssea. O sistema imune reage na presença dessas partículas, sendo os macrófagos a primeira linhagem celular a entrar em contato com essas partículas. Um processo inflamatório exacerbado pode ser gerado, levando a produção de citocinas pro-inflamatórias ligadas ao processo osteolítico. Portanto, para avaliar a resposta inflamatória de macrófagos, um estudo in vitro (Estudo 1) foi desenvolvido cultivando células THP-1 na presença de micro e nanopartículas de titânio em associação com Lipopolissacárido de Porphyromonas gingivalis (LPS PG), patógeno comum da microbiota oral, durante 12 h, 24, 48h. Foram avaliadas as citocinas pró-inflamatórias TNF-α, IL1-β, IL-6 que estão relacionadas com o processo osteolítico, quanto a expressão gênica pelo método ΔΔCq e Elisa. Os dados foram analisados usando análise de variância com dois fatores e teste de Tukey (p <0,05). De acordo com os resultados a presença de micro e nanopartículas titânio a expressão gênica e a produção de citocinas pró-inflamatórias aumentou em comparação ao controle, e a associação de partículas de titânio e LPS PG não aumentou a expressão gênica e a produção de citocinas comparado com os grupos tratados somente com partículas de titânio. Também para avaliar a reação óssea na presença de partículas de titânio um estudo in vivo (estudo 2) foi realizado com 14 coelhos New Zealand. Implantes com superfície lisa foram inseridos na tíbia com 3 mg de micropartículas de titânio e no fêmur com 1 mg de micropartículas dos animais, em ambas as pernas. Os dados foram analisados por regressão de modelo misto (p <0,05). Após 7 e 28 dias uma diminuição no contato osso/implante no grupo com partículas em relação ao controle foi observado pelas análises histológica e histomorfométrica. Além disso, 6 animais receberam 12 implantes na tíbia para avaliar a expressão gênica de fatores pró-osteogênicos e foi observado que após 7 dias houve diminuição desses fatores para os grupos com partículas comparado ao controle. Pode-se concluir que partículas de titânio afetam os estágios iniciais da osseointegração. Palavras-Chave: Implante dentário, Citocinas, Reabsorção Óssea, Osteólise.
Abstract Dental implant surface treatments are being developed in order to increase roughness and consequently improve chemotaxis to optimize osseointegration. Despite the clinical success of dental implants, it is known that in many cases, marginal bone loss occurs in the peri-implant area and the mechanism related to this process is not clear in the literature. Some studies described that during implant insertion the peaks created to produce rougher surfaces, are prone to break and micro and nanoparticles of titanium are released in the peri-implant tissue culminating in an osteolytic process. The immune system reacts against the shed particles and the macrophages are the first cell linage interacting with titanium particles stimulating an inflammatory process that can overproduce cytokines, leading to bone resorption. In order to evaluate inflammatory response by macrophages, an in vitro study (Study 1) was developed culturing THP-1 cell linage in the presence of micro and nanoparticles of titanium in association with Lipopolysaccharide from Porphyromonas gengivalis (LPS PG) for 12h, 24 and 48h and pro-inflammatory cytokines related to the osteolytic process TNF-α, IL1-β, IL-6 were evaluated. Gene expression was analyzed using ΔΔCq method and Elisa comparing to the standard curve, the data were analyzed using ANOVA two-way and Tukey’s test (p<0.05). As results it was observed that in the presence of micro and nanoparticles of titanium gene expression and protein production were increased compared to control, and the association of titanium particles and LPS PG did not increase gene expression and protein production compared to groups treated with titanium particles. Also to assess bone reaction in the presence of titanium microparticles an animal study (Study 2) was performed with 14 New Zealand White Rabbits, implants with turned surface were placed in tibia with 3mg of microparticles of titanium and femur using 1mg of microparticles of titanium in both legs of the animals. Data were analyzed using regression mixed model (p<0.05). After 7 and 28 days bone contact decreases in test group compared to control by histological and histomorphometric analysis. Moreover, 6 animals received 12 implants in tibia to evaluate the main osteogenic genes and after 7 days a decrease in the expression was observed. Conclusively the presence of titanium particles affects early stages of osseointegration.
Keywords: Dental Implants, Cytokines, Osteolysis, Bone resorption
SUMÁRIO
1 INTRODUÇÃO ....................................................................................................... 16
2 ARTIGOS ............................................................................................................... 21
2.1 PRO-INFLAMMATORY ANALYSIS OF HUMAN MACROPHAGE IN CONTACT WITH TITANIUM
MICRO/NANOPARTICLES AND PORPHYROMONAS GINGIVALIS .................................................. 212.2 ARTIGO: TITANIUM PARTICLES AFFECT EARLY STAGES OF OSSEOINTEGRATION ............... 41
3 DISCUSSÃO .......................................................................................................... 57
4 CONCLUSÃO ........................................................................................................ 61
REFERÊNCIAS ......................................................................................................... 62
16
1 INTRODUÇÃO
O titânio e suas ligas tem sido utilizados como implantes, na área
ortopédica e odontológica, devido ao benefício de suas propriedades químicas e
mecânicas (Albrektsson and Sennerby, 1990a). Uma camada estável de óxidos se
forma quando o titânio é exposto ao oxigênio e essa camada hidrofílica confere
biocompatibilidade a superfície (Neoh et al., 2012). A osseointegração é o contato
direto entre osso vital e a superfície de um implante de titânio submetido à carga
funcional. Esse conceito de união direta entre osso vital e a superfície do implante, em
nível de microscopia óptica, confere o sucesso do uso de implantes de titânio para o
suporte de próteses dentais e ortopédicas (Albrektsson, 1983; Albrektsson and
Sennerby, 1990b).
Mesmo após a consolidação do uso clínico dos implantes, as pesquisas se
concentraram na melhoria dos já expressivos índices de sucesso (Albrektsson et al.,
1986a; Wennerberg and Albrektsson, 2009). Portanto, modificações na superfície dos
implantes tiveram como objetivo aumentar a previsibilidade clínica para melhorar o
prognóstico do tratamento e, diminuir o tempo de cicatrização para a instalação de
próteses (Borsari et al., 2005; Terheyden et al., 2012). Para os implantes
odontológicos, as modificações também objetivaram diminuir o fenômeno de
reabsorção óssea cervical ao redor dos implantes osseointegrados conhecido como
saucerização óssea, onde uma perda inicial de 1,5mm no primeiro ano e de até 2mm
em 5 anos é considerado dentro da normalidade, (Albrektsson et al., 1986b;
Albrektsson et al., 2012).
Geralmente as modificações são caracterizadas pelo aumento da
rugosidade de superfície, para melhorar a resposta celular, e consequentemente o
processo de osseointegração (Borsari et al., 2005; Wennerberg and Albrektsson,
2009). Existem vários métodos de modificação de superfície de implantes, mas
comumente são divididos em dois grandes grupos, os métodos de adição,
17
normalmente obtidos através de spray de plasma com partículas de titânio ou
hidroxiapatita, e os métodos de subtração, normalmente obtidas por laser ou ataque
ácido, a combinação dos dois métodos também é utilizada. A superfície rugosa
representa uma modificação micro ou nano morfológica estrutural que aumenta a área
de contato entre o osso vital e o implante, o que aumenta a estabilidade primária dos
implantes e a resistência ao torque de remoção, favorecendo a deposição óssea
quando comparada à superfície lisa (Carr et al., 1997; Sutter et al., 1988).
Entretanto, ao longo do tempo percebeu-se que durante o uso de implantes
ortopédicos, a texturização criada para aumentar a rugosidade de superfície pode ser
desgastada em micropartículas e nanopartículas de titânio (Zhang et al., 2011) que
são liberados na área periimplantar levando a uma reação inflamatória exacerbada
(Goodman et al., 2014; Wei et al., 2009). Essa reação pode ser ainda intensificada
caso haja presença de endotoxinas bacterianas provenientes do implante ou em sítio
cirúrgico contaminados (Bi et al., 2001; Meyer et al., 2006; Ragab et al., 1999).
O processo inflamatório relacionado à presença de partículas de titânio
liberadas durante o uso das próteses ortopédicas, exacerba a produção das citocinas
pró-inflamatórias, Interleucina 6 (IL-6), Fator de Necrose Tumoral Alpha (TNF-α),
Interleucina 1 Beta (IL1-β) que estão ligadas ao início do processo osteolítico (Shin et
al., 2012). Estas citocinas são produzidas por macrófagos após a fagocitose, que são
as primeiras células a interagir com as partículas liberadas, e essa produção
exacerbada de citocinas culmina em perda óssea ao redor do implante, e consequente
falha da prótese ortopédica (Obando-Pereda et al., 2014; Shin et al., 2012).
Na odontologia, os implantes dentários podem liberar micropartículas e
nanopartículas de titânio no tecido periimplantar durante a inserção no sítio ósseo
(Senna et al., 2015). Essas partículas são provenientes da quebra dos picos, criados
para o aumento da rugosidade de superfície, durante a inserção do implante. Outra
característica da liberação de partículas dos implantes dentários que difere dos
implantes ortopédicos, é o acúmulo na região cervical próximo as três primeiras roscas
do implante devido ao autorrosqueamento dos implantes (Mints et al., 2014; Senna et
18
al., 2015). Análises histológicas da região periimplantar também mostraram a
presença das partículas após 6 meses da colocação do implante (Flatebo et al., 2011;
Olmedo et al., 2008).
Apesar da evidência de partículas de titânio no tecido periimplantar de
implantes dentários, o mecanismo e a influência dessas partículas de titânio na região
periimplantar oral ainda não foram avaliados. Devido as diferenças biológicas e
mecânicas dos implantes ortopédicos para os implantes dentais, muito ainda deve ser
investigado para saber qual o efeito da presença de partículas de titânio na região
periimplantar oral.
A região periimplantar oral possui uma microbiota natural, portanto a
presença de endotoxinas irá ocorrer mesmo que não haja presença de contaminação
do implante ou do sítio cirúrgico e como descrito no quarto parágrafo essa associação,
pode exacerbar a reação inflamatória (Bi et al., 2001; Meyer et al., 2006; Ragab et al.,
1999). Sabe-se que a microbiota periimplantar é semelhante a microbiota periodontal
pré-existente (Rutar et al., 2001), uma bactéria altamente patogênica e pouco virulenta
que é determinante para doenças periodontais a Porphyromonas gingivalis, pode ser
encontrada em regiões periimplantares (Lee et al., 1999; Leonhardt et al., 2003;
Mombelli et al., 1995; Rutar et al., 2001). Portanto é essencial a avaliação da
associação de micropartículas e nanopartículas de titânio a endotoxinas bacterianas
da cavidade oral, que podem levar a falha do tratamento (Lang et al., 2011).
O processo de saucerização óssea também é uma característica específica
dos implantes orais que é multifatorial e as causas e o mecanismos de reabsorção
continuam em discussão. A literatura descreve como causas traumas cirúrgicos,
sobrecarga oclusal, periimplantite, micro espaços entre implante e osso, adaptação
do epitélio juncional após a perda do espaço biológico e o módulo de crista do
implante(Albrektsson et al., 2012; Cochran et al., 2009) , a presença das partículas de
titânio poderia contribuir para a perda óssea neste processo sendo um fator somatória
as causas já descritas.
19
No intuito de investigar a existência e o mecanismo e de um processo
osteolítico na presença das partículas de titânio na região cervical do implante dental,
pode-se também analisar os fatores relacionados ao processo osteogênico. Se
observarmos um gene como RUNX-2 (runt-related transcription factor 2) um precursor
osteoblástico em que sua expressão está diretamente ligada a expressão dos genes
relacionados a formação da matriz óssea como Ocitocina (OCN), Osteopontina
(OPN), Colágeno tipo 1 (ColA1), Sialoproteína óssea (BSP), Fosfatase alcalina (ALP),
deduziremos que existe uma expressão gênica que poderá levar a formação óssea
(Kirkham et al., 2007). A Osteopontina além de ser um gene da matriz óssea, sua
expressão pode estar relacionada com a atividade osteoclástica. Outros genes como
Osterix (OSX) ligado a ossificação, Proteína morfogenética 2 (BMP-2) que é um fator
de crescimento ósseo e o paratormônio (PTH) que está associado a liberação de íon
cálcio do osso, são importantes marcadores da atividade óssea (Granchi et al., 2010;
Gyurko et al., 2005).
Sendo assim, a avaliação da associação de micropartículas e
nanopartículas de titânio, liberados a partir de implantes dentários, com endotoxinas
presentes na área periimplantar da cavidade oral como LPS de Porphyromonas
gingivalis (Lang et al., 2011) sobre a produção de citocinas pró-inflamatórias
relacionadas com a o processo de osteólise, se faz necessária. Assim como, é
importante avaliar a influência de partículas de titânio no processo de reabsorção
óssea na região cervical de implantes dentários, uma vez que a presença de partículas
de titânio pode contribuir para o processo de saucerização óssea culminando na falha
do selamento da região periimplantar.
Portanto um estudo in vitro (Artigo 1) foi proposto para avaliar o
comportamento dos macrófagos humanos na presença de micropartículas e
nanopartículas de titânio associada com LPS de Porphyromonas Gingivalis, sobre a
expressão gênica e produção de citocinas pró-inflamatórias relacionadas a osteólise
e um estudo in vivo (Estudo 2) foi proposto para avaliar a reação do osso peri-
20
implantar e a expressão de genes relacionados a osteogênese nos estágios iniciais
da osseointegração, na presença de micropartículas de titânio.
21
2 ARTIGOS
2.1 Pro-inflammatory analysis of human macrophage in contact with titanium micro/nanoparticles and Porphyromonas gingivalis
Cindy Goes Dodo
Luiz Meirelles
Alejandro Ayres-Reyes
Karina Gonzalez Silvério Ruiz
Jacqueline Abranches
Altair Antoninha Del Bel Cury*
* Corresponding author:
Altair Antoninha Del Bel Cury
Department of Prosthodontics and Periodontology, Piracicaba Dental
School, University of Campinas.
Avenida Limeira, 901. Piracicaba, São Paulo, Brazil. 13414-903.
Phone: +55 19 21065294; Fax +55 19 2106-5211;
E-mail: [email protected]
22
Abstract Titanium dental implant insertion can release titanium particles in the
periimplant region that can overstimulate inflammation leading to osteolysis, the
association with bacterium and can exacerbate inflammatory reaction. A high invasive
bacterium as Porphytomonas gingivalis, is present in the periimplant area and the
association of this bacterium and titanium particles remains unkown. This study
evaluated the behavior of human macrophages in contact with micro and nanoparticles
of titanium associated with Lipopolysaccharide (LPS) PG. THP-1 cell were
differentiated to macrophages and were treated for 12h, 24h, and 48h following 6
groups: Control(C), LPS PG (L); Microparticles (M); Nanoparticles (N); LPS PG and
microparticles (LM); LPS PG and nanoparticles (LN). The pro-inflammatory cytokines
TNF-α, IL1-β, IL-6 were analyzed regarding cell viability, morphology, mRNA
expression (RT-PCR) and protein production (Elisa). For statistics Anova two-way
followed by Tukey’s test was used (p<0.05). After treatment cells presented similar
viability and morphology demostranting that the presence of treatments were not
causing cell death. Gene expression was higher for TNF-α and IL1-β after 12h and IL-
6 after 24h, results. Cytokine production regarding time was an ascending curve for
TNF-α with the peak at 48h and IL1-β and IL-6 had a straight line between time besides
IL-6 at 48h for N group. Conclusively, these results suggest that macrophages are
more affected by nanoparticles and LPS PG did not increase the pro-inflammatory
reaction.
Keywords: Osteolysis, Dental implant, Cytokines, Bone resorption, Titanium
23
Introduction Titanium implants are the most used for dental rehabilitation and the surfaces
properties have been modified to enhance cellular response, usually by increasing the
surface roughness [1, 2]. The modifications in the surfaces are an attempt to increase
the primary stability and improve the process of osseointegration [1, 3]. Previous
studies from our group demonstrated that during insertion into bone the peaks created
to increase roughness are prone to break, culminating in the release of titanium
microparticles and nanoparticles, especially in the cortical region near the neck of the
implant [4, 5]. Also, histological analyses showed that titanium particles can be trapped
in peri-implant tissue even after 6 months of implant placement [6, 7].
Whereas the presence of titanium particles shed from rough titanium surfaces
during dental implant insertion in the cortical region was proved, the consequences
related to the presence of this shed particles in the dental peri-implant tissue were
poorly investigated. Despite, orthopedic studies, showed that the presence of titanium
particles from wear of limb prosthesis could overexpress pro-inflammatory cytokines
as IL-6, TNF-α, IL1-β, that are related to the osteolysis process, culminating in bone
loss around the implant and prosthesis failure [8, 9]. Furthermore, the orthopedic
studies showed that the presence of bacterium endotoxins in the implant could
intensify the inflammatory reaction, increasing bone loss [10-12].
In the peri-implant region there is a natural microbiota usually similar to the oral
cavity before implant installation [13]. Porphyromonas gingivalis is a key pathogen for
periodontal diseases [14] and is a bacterium reported to be presented in the dental
peri-implant region after dental implant installation [13, 15-17]. Thus, it is important to
assess the influence of microparticles and nanoparticles of titanium released from
dental implants surfaces during insertion, associated with endotoxins from bacteria
present in the peri-implant area. Hence, an in vitro study was proposed to evaluate the
pro-inflammatory reaction of macrophages, the first cell linage interacting with a foreign
body, in the presence of microparticles and nanoparticles of titanium associated with
24
Lipopolysaccharide from Porphyromonas gingivalis [18], regarding gene expression
and protein production of pro-inflammatory cytokines related to osteolysis process.
2- Materials and Methods 2.1 Titanium particles
Microparticles of titanium powder CAS 7740-32-6 (<20 micron, 93%, Alfa
Aesar, Ward Hill, MA, USA) and Nanoparticles Titanium (IV) oxide CAS 13463-67-7
(21 nm, Sigma Aldrich, St Louis, MO, USA) were used in this study. The particles were
weighted and separated in 15 mL tubes (Fischer Scientific, Waltham, Massachusetts,
USA) containing 25 mg each. A cleaning procedure was necessary to certificate that
the particles were not contaminated with amounts of endotoxin (10-20 units/ml) as
reported previously [10, 12, 19]. The particles were cleaned using nitric acid 25% for 2
h followed by 3 washes in Phosphate-buffered saline (PBS) (Invitrogen, Waltham,
Massachusetts, USA) for 5 minutes each time and placed in 95% ethanol with 0.1N of
NAOH for 24h, followed by 3 washes in PBS [10, 20]. After the cleaning procedure the
presence of endotoxins was measured using Limulus Amebocyte Lysate Chromogenic
Endotoxin Quantification Kit (Thermo Fisher Scientific, Grand Island, NY, USA)
following the manufacture protocol. The detection measured was <0.01endotoxin
units/mL, confirming the effectiveness of the cleaning procedure [19]. The particles
were kept in PBS 25 mg/mL at 4°C [21, 22] and the solution was agitated for 20 min
prior each usage [23].
2.2 Cell Culture The human monocyte THP-1 cells (5x105 cells/well) were placed in a 6 well
plate with RPMI-1640 medium, supplemented with 10% fetal bovine serum and 1%
antibiotics penicillin-streptomycin (Invitrogen, Carlsbad, CA, USA) in a incubator under
5% atmosphere CO2/95% air at 37 °C. The cells were differentiated to macrophages
using 125ng/well for 48h of phorbol 12 – myristate 13- acetate (PMA) (Sigma Aldrich,
St. Louis, MO, USA) [24]. The wells were washed 3 times with PBS and treated
25
following 6 experimental groups: no treatment, Control(C); 1 μg/mL
Lipopolysaccharide from Porphyromonas gingivalis (L) [8, 25]; 50 ng/mL of Titanium
microparticles (M) –; 50ng/mL Titanium nanoparticles (N); 1 μg/mL of
Lipopolysaccharide from Porphyromonas gingivalis plus 50 ng/mL microparticles (LM);
1 μg/mL of Lipopolysaccharide from Porphyromonas gingivalis plus 50 ng/mL of
titanium nanoparticles (LN). The treatments were diluted in RPMI-1640 medium and 5
mL was placed in each well of a 6 well/plate [20, 26].
2.3 Cell viability in the presence of titanium particles The cell viability analyses were performed to evaluate whether the
treatments proposed were leading to cell death. After treatments for 12h, 24h and 48h
the viability was verified in a spectrophotometer (Multiskan Spectrum Microplate
Spectrophotometer, Thermo Fisher Scientific Inc., MA, USA) at 490 nm using CellTiter
96® Aqueous One Solution Cell Proliferation Assay with tetrazolium compound [3-(4,5-
dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium,
inner salt; MTS (Promega, WI, USA) following the manufacturer instructions [3]. Also
the cells were treated following the experimental groups on polysine-coated glass
cover slips (ThemoScientific Waltham, Massachusetts, USA) and prepared for
spectrometry electron microscopy (SEM) analysis with 5% Karnovisk overnight, and
dehydrated in successive concentrations of ethanol (50%, 70%, 95% and twice at
100%) with 15 minutes incubation time between each step. The samples were then
critical point-dried using a critical point dryer (Critical Point Dryer, Seevac Inc, Florida,
USA). Each specimen was mounted on a SEM stub and sputter-coated with a
conductive layer of AuPd. The samples were imaged using a JEOL JSM 5600 PV SEM
(Akishima, Tokyo, Japan).
2.4 Gene expression analysis After the incubation period following the experimental groups, the cells were
harvested after 12 h, 24 h, and 48 h. Also a baseline group (0 h) was prepared for gene
26
expression data analysis. Total RNA was extracted using TRIzol Reagent (Invitrogen,
Carlsbad, CA, USA) according to the recommended protocol and the quantity and the
quality of RNA obtained were analyzed using Nanodrop (ND-1000 Spectrophotometer
Wilmington, DE, USA) and an agarose 0.8% gel electrophoresis (40 min, 80 mA). Total
RNA extracted was cleaned using DNA-free™ DNA Removal Kit (Ambion, Life
Technologies, Carlsbad, California, USA) and purified using RNeasy Mini Kit (Qiagen,
Valencia, CA, USA). The purified RNA (0.5μg of RNA per reaction) was converted to
cDNA in a reverse transcriptase reaction using a PrimeScrip RT reagent kit (Qiagen,
Valencia, CA, USA). RT-PCR (100ng of cDNA per reaction) was carried out using the
PerfeCta SYBR Green FastMix Kit (Quanta Biosciences,Gaithersburg, Maryland,
USA) and StepOnePlus real-time PCR system(Life Technologies) following 40 cycles
of 95oC for 10s, and 60oC for 30s and 95oC for 10s. The comparative quantification
algorithm (ΔΔCt) method was used and the expression level of the internal control
gene, Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used to normalize
the data. Experiments were performed in triplicate. The gene specific primers used in
this study are described in Table 1 [20].
Table 1. Gene sequence for Real time-PCR
Gene Seq 5’to 3 GAPDH F: CGAGATCCCTCCAAAATCAA R:TTCACACCCATGACGAACAT IL-1β F:GGACAAGCTGAGGAAGATGC R:TCGTTATCCCATGTGTCGAA TNF-α F: AGCCCATGTTGTAGCAAACC R:TGAGGTACAGGCCCTCTGAT IL-6 F: CACAGACAGCCACTCACCTC R:TTTTCTGCCAGTGCCTCTTT
2.5 Quantification of cytokine production The cell-free supernatant was collected from three independent experiments
and the extracellular levels of cytokines TNF- α, IL -1β and IL- 6 was measured using
the Single-Analyte ELISArray Kits (Qiagen, Valencia, CA, USA), following the
manufacture protocol. The absorbance was on a spectrophotometer (Multiskan
27
Spectrum Microplate Spectrophotometer, Thermo Fisher Scientific Inc., MA, USA), and
concentrations ere calculated according to the standard curve of each cytokine.
2.6 Statistical Analyses The results were analyzed by analysis of variance followed by Tukey’s test
within the level of significance at 5%. The data analysis software used in this study
was SAS 7.0 (SAS, Cary, North Carolina, USA)
3. Results 3.1 Cells viability and expression of inflammatory cytokines
We observed that the treatments proposed did not affect cell viability. The
results showed similar results among groups after cell viability analysis p<0.05 (Fig1)
and similar morphology after SEM analysis (Fig. 2).
Figure 1. Cell viability absorbance percentage compared to control after 12h, 24h and 48h (p>0.05). THP-1 cells
were treated with 1 μg/mL of LPS from P. gengivalis (LPS), Titanium microparticles 50 ng/mL (M), Titanium Nanoparticles 50
ng/mL (N), LPS P. gingivalis 1 μg/mL with 50 ng/mL of titanium microparticles (LM) and LPS P. gengivalis 1 μg/mL with 50 ng/mL
of titanium nanoparticles (LN).
28
Figure 2. SEM of THP-1 cells that were after treated 12h, 24h and 48h with 1 μg/mL of LPS from P. gengivalis
(LPS), Titanium microparticles 50 ng/mL (M), Titanium Nanoparticles 50 ng/mL (N), LPS P. gingivalis 1 μg/mL with 50 ng/mL of
titanium microparticles (LM) and LPS P. gengivalis 1 μg/mL with 50 ng/mL of titanium nanoparticles (LN).
Our findings, related to gene expression, revealed that the peak of expression
for TNF-α and IL-1β occurred after 12 h hours and for IL-6 was after 24 h (Fig. 3).
When analyzing each gene by time, TNF- α at 12 h had the highest fold increased for
N and LN groups (8,39 fold and 6,60 fold), at 24 h N, M, LM and LN groups had similar
expression, and at 48 h the highest fold increased was once more for N and LN (3,32
fold 2,86). Regarding IL1-β, the highest fold increased was at 12 h for N group 11,65
fold, at 24 h for N and LN (5,09 fold and 5,99 fold) and at 48 h for N group 3,14 fold.
IL-6 presented at 12 h the highest fold increased for N group 39,56 fold, 24 h for N and
LN groups (78,09 fold and 64,78 fold) and at 48 h for N and LN groups (7,44 fold and
7,31 fold).
Generally, after the treatments, THP-1 cells had the higher expression of pro-
inflammatory cytokines in the presence of titanium nanoparticles. Another general
expression behavior was the lower fold increased in presence of LPS PG, an example
was the LN group that the genes IL-6 at 12h and IL1- β at 12h and 48h IL-B the fold
increased was lower than the N group in the same time points. Regarding the groups
treated with titanium microparticles and interestingly late expression of TNF-α was
observed when cells were exposed to microparticles in comparison to nanoparticles.
29
The group LM that was associated with LPS PG had the same behavior as the group
treated with titanium microparticles, besides the gene TNF-α at 12h, the group LM
presented a significant gene expression.
30
N
31
Figure 3. Gene expression analyses of pro-inflammatory cytokines related to osteolysis.Fold increased of TNF-
α,IL1-β and IL-6 was compared to the housekeeping gene (GAPDH) and control of each group (ΔΔCt). THP-1 cells were treated
with 1 μg/mL of LPS from P. gengivalis (LPS), Titanium microparticles 50 ng/mL (M), Titanium Nanoparticles 50 ng/mL (N), LPS
P. gingivalis 1 μg/mL with 50 ng/mL of titanium microparticles (LM) and LPS P. gengivalis 1 μg/mL with 50 ng/mL of titanium
nanoparticles (LN). * Significant differences from all groups from the same cytokine (p<0.05) and **Significant differences from all
groups from the same cytokine (p<0.05). Data expressed as the mean ± SD of experiments made in quadruplicate.
3.2 Cytokine Production The cytokine production generally was an ascending curve for TNF- α and the
peak occurred after 48 h. For IL-1 β and IL-6 the production was almost a straight line,
with the exception for the production of IL-6 for N group that had higher production at
48h.
The average high expression of cytokine was to IL1-β followed by TNF-α and
IL1-6 (Fig 4). The results showed that TNF-α production was more pronounced at 48h
for N group (2019.1 pg/ml) followed by the groups statically equivalent M at 24h (605
pg/ml), 48h (983 pg/ml) and group LN 48 h (958 pg/ml). The results showed that IL1-β
presented the highest protein production but the production of all groups was
statistically equivalent. For IL-6 the highest protein production was also for the group
treated with nanoparticles at 48h (1301,82pg/ml). Overall, the groups treated with
titanium micro and nanoparticles presented the highest protein production. The groups
treated with titanium particles in association with LPS PG presented similar or less pro-
inflammatory production than the groups treated just with titanium particles.
32
Figure 4. Pro-inflammatory cytokines expression of THP-1 cells treated after 12h, 24 h and 48 h with 1 μg/mL of
LPS from P. gengivalis (LPS), Titanium microparticles 50 ng/mL (M), Titanium Nanoparticles 50 ng/m (N), LPS P. gingivalis 1
μg/mL with 50 ng/mL of titanium microparticles (LM) and LPS P. gengivalis 1 μg/mL with 50 ng/mL of titanium nanoparticles (LN).
* Significant differences from all groups from the same cytokine (p<0.05) and **Significant differences from all groups from the
same cytokine (p<0.01). Data expressed as the mean ± SD of experiments made in triplicate.
33
Discussion The presence of titanium particles in the dental peri-implant region can
be an obstacle to bone regeneration that can lead to marginal bone loss. The
orthopedic literature showed the influence of titanium wear particles in the osteolytic
process that cause implant failure and can be exacerbated in the presence of bacteria.
In this study we aimed to analyze the behavior of human macrophages in the presence
of titanium particles shed during insertion of dental implants into bone associated with
a common pathogen in the periimplant region, P. gingivalis [13, 17].
The cells viability results demonstrated that the treatments were not causing cell
death and the SEM results showed similar morphology among groups. Although it was
demonstrated similar cell viability between groups and cell morphology titanium
particles and LPS from P. gingivalis could affect pro-inflammatory cytokines genes
expression and protein production [3, 27]. Gene expression results showed that TNF-
α and IL1-β had the highest fold increased after 12h and IL-6 after 24h, following
previous results that showed the inflammation process related to the presence of
titanium particles in orthopedics [8, 28]. The groups with nanoparticles of titanium
presented the highest fold increased for all genes showing a possible relation with the
particle size [3]. Titanium microparticles affect gene expression although was less than
titanium nanoparticles, this study used the same concentration of particles as
nanoparticles were smaller, to achieve the same weight more particles were needed
the result could be related to a dose-dependency not only about particle size [23, 29].
Protein production was higher for IL1-β in all time points and groups analyzed,
this cytokine have a higher production compared to TNF-α and IL-6 [8]. However, the
analysis of the protein production behavior is more significant than the values of
production [9, 30]. IL-1β is the cytokine expressed to start the osteolytic process and
plays an important role to TNF-α expression that modulates RANK-L production,
leading to bone resorption. Therefore we could observed that the production of TNF-α
was an ascending curve regarding time and probably if this study analyzed in a later
time point the curve would still ascending [31]. After the production of IL1-β and TNF-
34
α, IL-6 is produced and this cytokine is related to the recruitment and activation of
osteoclasts, which resorb bone [9, 32]. For IL-6 the production pattern was a straight
line besides the group treated with titanium nanoparticles that showed higher
production of cytokines after 48h, suggesting that nanoparticles could lead to more
bone resorption [32, 33].
We could observe that mRNA and cytokine expression did not present a parallel
behavior. For example, TNF-α was expressed at 12h for N, LM, and LN groups and
the protein production did not occur at 12h or even after 24h. Another finding was IL-6
that had the highest fold increased and IL1- β produced more proteins. Others studies
in the orthopedic literature described similar results as ours [8, 12, 19, 34], but the
reason regarding this findings are unknown. A possibly explanation is that this
discrepancy in mRNA expression and protein production can be related to a post-
transcriptional processing or autocrine mechanisms to prevent an over-inflammatory
reaction that can be harmful for the system[8].
Moreover others studies showed that titanium particles contribute to
inflammatory response without the presence of a pathogen, but the presence of a
endotoxins can exacerbate inflammatory reaction [12]. In this study the association of
titanium particles with a pathogen from the oral cavity, LPS from P. gingivalis was
analyzed and did not increase gene expression or protein production of pro-
inflammatory cytokines when associated with titanium micro and nanoparticles. LPS
from P. gingivalis is reported not to be as others Gram-negative bacterium, when
inducing pro-inflammatory cytokines in several types of cells including
monocyte/macrophage cell type [24, 35, 36]. This is characteristic of P. gingivalis that
helps the bacteria to invasion, without alarming the host immune system [37]. Another
explanation regarding the lower expression and production of the pro- inflammatory
cytokines in the presence of LPS PG could be related to the concentration used in this
study. Previous studies using the same commercially LPS had similar results with
concentrations around 1 μl/ml [38-40], and only higher concentrations around 10 μl/ml
35
[41] showed more effect in cytokine production but for human periodontal ligament
stem cells, this commercial LPS PG seems to have less potency than a LPS PG
extracted after culturing PG. This could be related to the cell linage of Porphyromonas
gingivalis [42] or to the procedure used to extract LPS [43], a comparative evaluation
is needed to prove the differences between LPS.
In our results we could observe that the presence of titanium particles can affect
THP-1 cells regarding gene expression and protein production of pro-inflammatory
cytokines related to the osteolytic process and groups treated with titanium
nanoparticles had more effect increasing gene expression and protein production.
Moreover, investigations must be done regarding the effect of titanium particles in the
process of marginal bone break down in dental implants in the early stages of
osseointegration. Titanium micro and nanoparticles could have a potential contribution
in the bone resorption process leading marginal bone loss.
Conclusion The presence of titanium particles stimulates the expression and production of
pro-inflammatory cytokines TNF- α, IL -1β and IL- 6 that are related to the osteolysis
process. Nanoparticles of titanium affect more the pro-inflammatory reaction. The
association with LPS from P. gingivalis did not increased gene expression of pro-
inflammatory genes and produced less pro-inflammatory cytokine compared to the
groups treated with microparticles and nanoparticles of titanium.
Acknowledgments
The authors declare no potential conflicts of interest with respect to the
authorship and/or publication of this study.
We gratefully acknowledge Dr. Jose Lemos for the support during the
development of this study. We also thank Dr. Irlan Almeida, Dr. Jessica K. Kajfasz, Dr.
Plinio Senna and James H. Miller for the critical advices. We acknowledge the São
Paulo Research Foundation for granting scholarships FAPESP# 2013/19791-8 and
36
FAPESP#2014/10085-6 for the author Dr. Cindy Dodo during the development of this
study.
Refences [1]BorsariV,GiavaresiG,FiniM,TorricelliP,SalitoA,ChiesaR,etal.Physical
characterization of different-roughness titanium surfaces, with and without
hydroxyapatite coating, and their effect on human osteoblast-like cells. Journal of
biomedicalmaterialsresearchPartB,Appliedbiomaterials.2005;75:359-68.
[2]WennerbergA,AlbrektssonT.Effectsoftitaniumsurfacetopographyon
bone integration: a systematic review. Clinical oral implants research. 2009;20 Suppl
4:172-84.
[3]ZhangY,YuW,JiangX,LvK,SunS,ZhangF.Analysisofthecytotoxicityof
differentiallysizedtitaniumdioxidenanoparticlesinmurineMC3T3-E1preosteoblasts.
JournalofmaterialsscienceMaterialsinmedicine.2011;22:1933-45.
[4]SennaP,AntoninhaDelBelCuryA,KatesS,MeirellesL.SurfaceDamageon
DentalImplantswithReleaseofLooseParticlesafterInsertionintoBone.Clinicalimplant
dentistryandrelatedresearch.2015;17:681-92.
[5]MintsD,EliasC,FunkenbuschP,MeirellesL.Integrityofimplantsurface
modificationsafterinsertion.TheInternationaljournaloforal&maxillofacialimplants.
2014;29:97-104.
[6] FlateboRS,Hol PJ, LeknesKN,Kosler J, Lie SA, GjerdetNR.Mapping of
titanium particles in peri-implant oral mucosa by laser ablation inductively coupled
plasmamassspectrometryandhigh-resolutionopticaldarkfieldmicroscopy.Journalof
oralpathology&medicine :officialpublicationof theInternationalAssociationofOral
PathologistsandtheAmericanAcademyofOralPathology.2011;40:412-20.
[7]OlmedoDG,TasatDR,EvelsonP,GuglielmottiMB,CabriniRL.Biological
responseoftissueswithmacrophagicactivitytotitaniumdioxide.Journalofbiomedical
materialsresearchPartA.2008;84:1087-93.
37
[8]Obando-PeredaGA,FischerL,Stach-MachadoDR.Titaniumandzirconia
particle-induced pro-inflammatory gene expression in cultured macrophages and
osteolysis,inflammatoryhyperalgesiaandedemainvivo.Lifesciences.2014;97:96-106.
[9] Souza PP, Lerner UH. The role of cytokines in inflammatory bone loss.
ImmunolInvest.2013;42:555-622.
[10]RagabAA,VanDeMotterR,LavishSA,GoldbergVM,NinomiyaJT,Carlin
CR,etal.Measurementandremovalofadherentendotoxinfromtitaniumparticlesand
implantsurfaces.Journaloforthopaedicresearch:officialpublicationoftheOrthopaedic
ResearchSociety.1999;17:803-9.
[11]MeyerU,BuhnerM,BuchterA,Kruse-LoslerB,StammT,WiesmannHP.
Fastelementmappingoftitaniumweararoundimplantsofdifferentsurfacestructures.
Clinicaloralimplantsresearch.2006;17:206-11.
[12]BiY,VanDeMotterRR,RagabAA,GoldbergVM,AndersonJM,Greenfield
EM.Titaniumparticlesstimulateboneresorptionbyinducingdifferentiationofmurine
osteoclasts.TheJournalofboneandjointsurgeryAmericanvolume.2001;83-A:501-8.
[13] Rutar A, Lang NP, Buser D, Burgin W, Mombelli A. Retrospective
assessmentofclinicalandmicrobiologicalfactorsaffectingperiimplanttissueconditions.
Clinicaloralimplantsresearch.2001;12:189-95.
[14]O'Brien-SimpsonNM,BurgessK, BrammarGC,Darby IB,ReynoldsEC.
Developmentandevaluationofasaliva-basedchair-sidediagnosticforthedetectionof
Porphyromonasgingivalis.Journaloforalmicrobiology.2015;7:29129.
[15] Leonhardt A, Bergstrom C, Lekholm U. Microbiologic diagnostics at
titaniumimplants.Clinicalimplantdentistryandrelatedresearch.2003;5:226-32.
[16] Lee KH, Maiden MF, Tanner AC, Weber HP. Microbiota of successful
osseointegrateddentalimplants.Journalofperiodontology.1999;70:131-8.
[17]MombelliA,MarxerM,GaberthuelT,GrunderU,LangNP.Themicrobiota
ofosseointegratedimplantsinpatientswithahistoryofperiodontaldisease.Journalof
clinicalperiodontology.1995;22:124-30.
38
[18]LangNP,BerglundhT,WorkingGroup4ofSeventhEuropeanWorkshop
on P. Periimplant diseases: where are we now?--Consensus of the Seventh European
WorkshoponPeriodontology.Journalofclinicalperiodontology.2011;38Suppl11:178-
81.
[19]SchwabLP,XingZ,HastyKA,SmithRA.Titaniumparticlesandsurface-
bound LPS activate different pathways in IC-21 macrophages. Journal of biomedical
materialsresearchPartB,Appliedbiomaterials.2006;79:66-73.
[20]JinS,ParkJY,HongJM,KimTH,ShinHI,ParkEK,etal.Inhibitoryeffectof
(-)-epigallocatechingallateon titaniumparticle-inducedTNF-alphareleaseand invivo
osteolysis.Experimental&molecularmedicine.2011;43:411-8.
[21]HanSG,NewsomeB,HennigB.Titaniumdioxidenanoparticlesincrease
inflammatoryresponsesinvascularendothelialcells.Toxicology.2013;306:1-8.
[22]Montiel-DavalosA,Ventura-GallegosJL,Alfaro-MorenoE,Soria-CastroE,
Garcia-LatorreE,Cabanas-MorenoJG,etal.TiO(2)nanoparticlesinducedysfunctionand
activationofhumanendothelialcells.Chemicalresearchintoxicology.2012;25:920-30.
[23]ZhangY,YuS,XiaoJ,HouC,LiZ,ZhangZ,etal.Wearparticlespromote
endotoxin tolerance in macrophages by inducing interleukin-1 receptor-associated
kinase-Mexpression.JournalofbiomedicalmaterialsresearchPartA.2013;101:733-9.
[24]DiyaZ,LiliC, ShenglaiL,ZhiyuanG, JieY.Lipopolysaccharide (LPS)of
Porphyromonas gingivalis induces IL-1beta, TNF-alpha and IL-6 production by THP-1
cellsinawaydifferentfromthatofEscherichiacoliLPS.Innateimmunity.2008;14:99-
107.
[25]ChenLL,Yan J.Porphyromonasgingivalis lipopolysaccharideactivated
bone resorption of osteoclasts by inducing IL-1, TNF, and PGE. Acta Pharmacol Sin.
2001;22:614-8.
[26]ShinDK,KimMH,LeeSH,KimTH,KimSY.Inhibitoryeffectsofluteolinon
titaniumparticle-inducedosteolysisinamousemodel.Actabiomaterialia.2012;8:3524-
31.
39
[27] Irshad M, Scheres N, Crielaard W, Loos BG, Wismeijer D, Laine ML.
Influenceoftitaniumoninvitrofibroblast-Porphyromonasgingivalisinteractioninperi-
implantitis.Journalofclinicalperiodontology.2013;40:841-9.
[28]CachinhoSC,PuF,Hunt JA.Cytokinesecretion fromhumanperipheral
bloodmononuclear cells cultured in vitro withmetal particles. Journal of biomedical
materialsresearchPartA.2013;101:1201-9.
[29]GoodmanSB,KonttinenYT,TakagiM.Jointreplacementsurgeryandthe
innateimmunesystem.Journaloflong-termeffectsofmedicalimplants.2014;24:253-7.
[30] Amarasekara DS, Yu J, Rho J. Bone Loss Triggered by the Cytokine
NetworkinInflammatoryAutoimmuneDiseases.JImmunolRes.2015;2015:832127.
[31]Wei S, KitauraH, ZhouP, Ross FP, TeitelbaumSL. IL-1mediatesTNF-
inducedosteoclastogenesis.TheJournalofclinicalinvestigation.2005;115:282-90.
[32] Darowish M, Rahman R, Li P, Bukata SV, Gelinas J, Huang W, et al.
Reduction of particle-induced osteolysis by interleukin-6 involves anti-inflammatory
effectandinhibitionofearlyosteoclastprecursordifferentiation.Bone.2009;45:661-8.
[33] Schwarz EM, Benz EB, Lu AP, Goater JJ, Mollano AV, Rosier RN, et al.
Quantitativesmall-animalsurrogatetoevaluatedrugefficacyinpreventingweardebris-
induced osteolysis. Journal of orthopaedic research : official publication of the
OrthopaedicResearchSociety.2000;18:849-55.
[34]TrindadeMC,LindM,SunD,SchurmanDJ,GoodmanSB,SmithRL.Invitro
reaction to orthopaedic biomaterials by macrophages and lymphocytes isolated from
patientsundergoingrevisionsurgery.Biomaterials.2001;22:253-9.
[35] Lu J, Yang Z, Jiang J,Wang Z, Zhu P. Regulative effect of P38MAPK on
release of TNFalpha andNO fromalveolarmacrophages under endotoxin stimulation.
Chinese journal of traumatology = Zhonghua chuang shang za zhi / Chinese Medical
Association.2001;4:75-7.
[36]OgawaT,UchidaH.DifferentialinductionofIL-1betaandIL-6production
by the nontoxic lipid A from Porphyromonas gingivalis in comparisonwith synthetic
40
EscherichiacolilipidAinhumanperipheralbloodmononuclearcells.FEMSimmunology
andmedicalmicrobiology.1996;14:1-13.
[37] Holt SC, Kesavalu L, Walker S, Genco CA. Virulence factors of
Porphyromonasgingivalis.Periodontology2000.1999;20:168-238.
[38] Andrukhov O, Ertlschweiger S, Moritz A, Bantleon HP, Rausch-Fan X.
DifferenteffectsofP.gingivalisLPSandE.coliLPSontheexpressionofinterleukin-6in
humangingivalfibroblasts.ActaOdontolScand.2014;72:337-45.
[39] Barksby HE, Nile CJ, Jaedicke KM, Taylor JJ, Preshaw PM. Differential
expression of immunoregulatory genes in monocytes in response to Porphyromonas
gingivalisandEscherichiacolilipopolysaccharide.ClinExpImmunol.2009;156:479-87.
[40]NebelD,ArvidssonJ,LillqvistJ,HolmA,NilssonBO.Differentialeffectsof
LPS fromEscherichiacoli andPorphyromonasgingivalison IL-6production inhuman
periodontalligamentcells.ActaOdontolScand.2013;71:892-8.
[41] Kato H, Taguchi Y, Tominaga K, UmedaM, Tanaka A. Porphyromonas
gingivalis LPS inhibits osteoblastic differentiation and promotes pro-inflammatory
cytokine production in human periodontal ligament stem cells. Arch Oral Biol.
2014;59:167-75.
[42]DiazL,HoareA,SotoC,BuguenoI,SilvaN,DutzanN,etal.Changes in
lipopolysaccharide profile of Porphyromonas gingivalis clinical isolates correlatewith
changesincolonymorphologyandpolymyxinBresistance.Anaerobe.2015;33:25-32.
[43]HirschfeldM,MaY,WeisJH,VogelSN,WeisJJ.Cuttingedge:repurification
of lipopolysaccharide eliminates signaling through both human and murine toll-like
receptor2.JImmunol.2000;165:618-22.
41
2.2 Artigo: Titanium Particles Affect Early Stages of Osseointegration
Cindy Goes Dodo
Altair Antoninha Del Bel Cury
Stephen L. Kates
Gustavo Mendonça
Luiz Meirelles*
*Corresponding author:
Luiz Meirelles
Director Professional Products and Standards
American Dental Association
211 East Chicago Ave.
Chicago, IL 60611-2678
Jounal of Dental Research
42
Abstract
Titanium particles shed from the implant surface during implant placement are strongly
associated with osteolysis. This study investigated the early bone response at the
implant-bone interface in the presence of titanium microparticles. New Zealand White
rabbits (UCAR #2014-031) (n=20) received 68 titanium Grade IV implants, with turned
surface (3.75x7 mm), placed bilaterally in the tibia and femur. Test group was treated
with 3 mg (tibia) and 1 mg (femur) of titanium microparticles with mean diameter of
3μm (93% ≤ 20μm) free of endotoxin. Control group was treated with saline. After 1
and 3 days the cells attached to the implant were analyzed regarding gene expression
(6 animals, 12 implants placed in tibia) of osteogenic markers. After 1 and 4 weeks the
animals were euthanized for histological and histomorphometrical analysis (14
animals, 56 implants placed in tibia and femur). Multiple regression mixed model was
used for statistical analysis. After 1 week, test group demonstrated areas of bone
resorption associated with titanium particles (2-30 μm) and absence of new bone
formation (NBF) while control group did not present any signs of bone resorption or
new bone formation. After 4 weeks, the remodeling process was observed for both
groups, but test group presented titanium particles trapped in the new bone formation.
Histomorphometrical analysis demonstrated bone-implant contact (BIC) values
reduced in test compared to control sites (p˂0.0001). The impaired healing persisted
at 4 weeks. Osteogenic expression demonstrated an upregulation of OCN (1.4-fold)
and OPN (1.0-fold) at 3 days and after 7 days, a downregultaion of COL1A1 (18.4-
fold), BSP (4.8-fold), OCN (38.9-fold), PTH (1.6-fold) was detected for test compared
to control implants. Conclusively, early stages of osseointegration were affected by
titanium particles added to cortical and trabecular bone.
43
Introduction
The success of dental implants treatment is highly dependent on the integration
between dental implant and the surrounded tissue (5, 50). Successfully
osseointegrated dental implants can present a crestal bone breakdown ranging from
1.5 mm to 2 mm that commonly occurs in the early stages of osseointegration (51, 52).
Implants that present more bone loss in the initial stages of the healing process are
more affected for late bone loss overtime and prone to an uncertain prognostic (31,
53). The integrity of periimplant bone tissue is the key to establish a long-term success
of dental implants and, continuous bone breakdown represents a threat to implant
longevity. The etiologies behind initial bone break down must be deeply investigating
and controlled for long-term success of dental implant treatment (54).
In order to enhance the healing process and improve the prognostic of dental
implant treatment, modifications on the titanium surfaces were made, usually by
increasing surface roughness. However, during implant insertion the peaks created to
increase roughness are prone to break culminating in the released of titanium particles
in the periimplant region (23, 24, 55). Orthopedics studies demonstrated that osteolysis
could be stimulated by titanium particles from wear debris (20, 56). Titanium particles
stimulate macrophages that overexpress cytokines that leads to osteolysis (57).
Following that thought of reasoning, titanium particles shed from rough surfaces during
dental implant insertion into bone could contribute to the early marginal bone loss
around dental implants in the cortical region.
Moreover, the evaluation of the main genes related to bone formation and bone
remodeling process is another reliable way to access the early bone response and
understand the mechanisms related to bone loss. The gene Runx2 has been reported
as a percursor to osteoblast-related genes responsable for bone matrix formation as
ocitocalcin (OCN), osteopontin (OPN), collagen 1 (ColA1), bone sialoprotein (BSP),
alkaline phosphatese (ALP) (Kirkham 2007). Osteopontin can be also related to
osteoclastic activity. Osterix (OSX) is a gene especific to osteoblast ossification, bone
44
morphogenetic protein 2 (BMP2) a growth factor related to bone fomation and
parathyroid hormone (PTH) that is associated to an increase in the concentration of
ionic calcium (Ca2+) uptaked from bone (Gyurko 2005; Granchi 2010).
Therefore, this animal study was proposed to investigate the early bone
response at the dental implant-bone interface on surgical sites in the presence of
titanium microparticles.
1. Materials and Methods 1.1 Titanium particles
Microparticles of pure titanium (<20micron, 93%, Alfa Aesar, Ward Hill, MA,
USA) was used in this experiment. The particles were weight and separated in 15 ml
tubes (Fischer Scientific, Waltham, Massachusetts, EUA) containing 25mg each.
Commercially available titanium particles can present an amount of endotoxin (10-20
units/ml), therefore a cleaning procedure was necessary (Schawab 2005, Ragab 1999;
Bi 2001).
1.1.1 Cleaning procedure of titanium particles The titanium particles were cleaned using nitric acid 25% for 2 h followed by 3
washes in Phosphate-buffered saline (PBS) (Invitrogen, Waltham, Massachusetts,
USA) for 5 minutes each time and placed in 95% ethanol with 0.1N of NAOH for 24h,
followed by 3 washes in PBS (Ragab et al 1999; Jin et al 2011). After the cleaning
procedure, the presence of endotoxins was measured using LAL Chromogenic
Endotoxin Quantitation Kit (Thermo Fisher Scientific, Grand Island, NY, USA) following
the manufacture protocol. The detection measured was <0.01endotoxin units/ml,
confirming the effectiveness of the cleaning procedure (Schwab et al 2005). The
titanium particles were kept in PBS 25mg/ml at 4°C (Han et al., 2013; Montiel et al.,
2012) and the solution was agitated for 20 min prior each usage (Zhang et al., 2012).
45
1.2. Histological and Histomorphometric analysis New Zealand white rabbits (UCAR #2014-031) were used for histological and
histomorphometric evaluation (n=14 animals). Before the surgery the animals were
knocked down under general anesthesia with 0.3mg/ml intramuscular fentanyl and
10mg/ml fluanisone followed by 2.5 mg intraperitoneal diazepam. The legs were
shaved and disinfected with chlorhexidine before injection of 1 ml of lidocaine into each
insertion site. The skin and fascia layers were opened and bone drilling was performed
with profuse irrigation with saline solution.
Before the insertion of the implant with turned surface (n=56 implants), test
group received titanium microparticles that were previously diluted in 100μl of saline,
and applied homogeneously with a pipette in the implant surface. For test group, the
implants (n=28 implants) were placed in tibia (n= 14 implants) received 3 mg of titanium
microparticles and in femur (n=14 implants) only 1 mg. For control group (n=28
implants) 100μl of saline was placed in the implant for both tibia and femur
implantation. The implants were inserted with a rotation of 25 rpm and the fascia layers
were closed with absorbable suture while skin layer with polypropylene. After 1 and 4 weeks after surgery the animals were euthanized. General
anesthesia was induced by Ketamine 44mg/kg and Xylazine5mg /kg SQ with 100m/kg
sodium phenobarbital via ear vein. The implants and surrounding bone were removed
and fixed with 4% neutral buffered formaldehyde, dehydrated in graded series of
ethanol and the specimens were embedded in light curing resin (Technovit 7200 VLC,
Kültzer & Co, Germany). The slides were prepared following the Donath’s technique
(Donath K. et al, 1982). Examinations were performed with a Nikon 80i microscope
(Nikon Instruments, Melville, NY, USA) equipped with an image software analysis
(NIS-Elements BR 3.2, Nikon, USA) using 1X to 100X objectives for descriptive
evaluation and morphometric measurements. The qualitative analysis aimed at
describing the early bone formation events at the control and test implants. The
histomorphometrical evaluations comprised measurements of the degree of bone
46
implant contact limited by the first and third coronal thread at a distance of
approximately 600μm from the thread valleys.
2.3 Osteogenic genes analysis
For that analysis, the surgerys were perfomed in the tibia of 6 New Zealand
White rabbits. Test group received 3mg of titanium particles diluted in 100 μl of saline,
and the control group received 100μl of saline. The animals were euthanized after 3
and 7 days. After euthanesia the implants were remove with contratoque and the
adherent cells (Fig 14) were collected for gene analyses.
The RNA was extracted using TRIzol Reagent (Invitrogen, Carlsbad, CA, USA)
following the manufacture protocol. The RNA was analyzed using Nanodrop (ND-1000
Spectrophotometer Wilmington, DE, USA) and electrophoresis agar gel 0.8%. Total
RNA extracted was cleaned using DNA-free™ DNA Removal Kit (Ambion, Life
Technologies, Carlsbad, California, USA) and purified using RNeasy Mini Kit (Qiagen,
Valencia, CA, USA). The purified RNA was converted to cDNA in a reverse
transcriptase reaction using a PrimeScrip RT reagent kit (Qiagen, Valencia, CA, USA).
The Real Time Reverse Transcriptase-PCR (RT-PCR) was performed using the
PerfeCta SYBR Green FastMix Kit (Quanta Biosciences, Gaithersburg, Maryland,
USA) and StepOnePlus real-time PCR system (Life Technologies) following 40 cycles
of 95oC for 10s, and 60oC for 30s and 95oC for 10s. The comparative quantification
algorithm (ΔΔCt) method was used to data analysis using relative expression level of
the osteogenic genes compared to the housekeeping gene Glyceraldehyde 3-
phosphate dehydrogenase (GAPDH), the reactions were run in triplicate.
Results Histological evaluation
47
The implant site in the femur consisted mainly of trabecular bone, whereas a
cortical layer of 1.5 mm in height characterized tibia sites. The original trabecular bone
in the femur were in contact with the top 4th to 5th threads, and the cortical layer in the
tibia was in contact to the 2nd to 3rd top threads. The apical part of test and control
implants in the tibia (approximately 2.5mm) was inside the bone marrow cavity.
Figure 1. A. In control group after 1 week it is possible to observe absence of
resorption and new bone formation. B. After 1 week in test group areas of bone resorption (
A B
C D
48
red circle) is observed near to titanium particles. C. After 4 weeks in control group many areas
of new bone formation can be observed near areas of bone resorption, but usually the
resorption areas are associated to new bone formation( red square). D. After 4 weeks in
experimental group many areas of new bone formation can be observed and it is possible to
see titanium particles traped into bone (red arrow).
1 week Histological evaluation demonstrated that after 1 week, in control group, (Fig 1)
remodeling process did not start. A normal healing process for one-week period was
observed (9) with no signs of bone resorption and few areas of new bone formation.
The areas between threads showed gaps of 150-200µm, these areas where filled with
blood cells and small pieces of drilled bone.
Experimental group, presented areas of resorption in the first three threads (Fig
2) not presenting new bone formation. Also, was possible to observe presence of
titanium particles (2-30 µm) between bone/implant at the cortical level within the
threads interface.
4 weeks After 4 weeks, control group showed areas of resorption associated to new bone
formation (Fig. 3) characterizing the remodeling process, a normal finding for this
period of healing (Lang et al 2011; Terheyden et al 2011).
The experimental group presented extensive scalloped areas indicative of bone
resorption and presence of titanium particles (15-30 µm) surrounded by new bone
formation (Fig 4). The particles were at least 200 µm of distance from the titanium
surface suggesting that they were released from the implant (Franchi et al., 2007).
49
2.4 Histomorphometric evaluation
The bone-to-implant contact (BIC) in the first three treads (Fig. 5) was measured
using a microscope (80i; Nikon Instruments, USA) equipped with an image software
analysis (NIS-Elements BR 3.2, Nikon, USA).
The BIC results showed that bone contact decrease in test compared to control
group after 1 and 4 weeks (Chart 1). A reduction of 23,4% (femur) and 43,4% (tibia)
of BIC values was observed for test compared to control groups after 1 week. After 4
weeks, a reduction of 20.2% (femur) and 21.08% (tibia) of BIC values was observed
for test compared to control groups.
Chart 1. Bone to implant contact analyzed after 1 and 4 weeks for Tibia and
femur.
4. Scanning electron microscope(SEM) and EDAX ( Energy Dispersive
X-RAY Spectroscopy) The slides used for histological analyses were sputtered coated (Denton
Vaccum, Moorestown, New Jersey, USA) with 60 angstroms of gold, this process
makes the surface electrically conductive, allowing them to be imaged with a SEM
50
(Zeiss Auriga SEM/FIB with EDAX, Dublin, California, USA). The images samples
were analyzes on SEM with a Backscatterd probe, that shows small changes in sample
chemistry. The SEM used for this study also included an EDAX detector for Energy
Dispersive X-RAY Spectroscopy, this tool allowed to make chemical maps of the
sample comproving the presence of titanium particles (Fig. 5 and 6).
Figure 2. For experimental group after 1 week. In A the histological image
in the region were titanium particles were observed. The presence of titanium particles (red arrows) was confirmed using a EDX mapping. The red line represents the interface between bone and titanium implant.
51
Figure 3. For experimental group after 4 weeks, the presence of titanium
(red arrow) observed in the histological (A) analysis was confirmed using a SEM/EDX graphic. The green arrow represents the peak of titanium.
5. Osteogenic analysis
The results (Fig 7) showed that after 3 days the presence of titanium particles
was stimulating gene expression of osteogenic genes, compared to control (Piolette et
al 2004). The fold increase in OPN (1.1 fold), as a pre-osteoclast gene and PTH (1.3
fold), a marker of ion calcium and the increase of RUNX2 (0.7 fold) and OSX (0.5 fold)
osteoblast markers, strongly suggest bone formation (Haynes 2004).
At 7 days (Fig.8) a downsregulation in RUNX2(-1.2 fold) and OSX (-2.0 fold)
indicated a decrease in osteoblastic activity and the upregulation of OPN (1.0 fold) and
PTH (1.4 fold) showed a maintenance of osteoclast activity, indicating bone loss
(Gyurko 2005; Granchi 2010). BMP-2 (1.1 fold) was upregulated indicating that even
!
A
52
with the evidence of osteoclast activity, the osteoblast possibly were differentiating and
starting the cells recruitment for bone formation.
Fig. 4. Osteogenic gene expression, showing fold differences at 3 days and 7
days compared to control.
Statistical Analysis The multiple regression mixed models were used to study the effect of group on
the outcomes, adjusting for endpoint and site. The calculated effect sizes were
adjusted for multiple comparisons using Dunnett–Hsu’s correction. All analyses were
performed using SAS, release 9.2 (SAS Institute Inc., Cary, NC, USA). The values that
p<0.05 were considered significant.
Discussion Overall marginal bone loss (MBL) is higher during the first year and
limited thereafter. MBL during the first year ranging from 1.5 mm to 2 mm is considered
53
a normal finding (58). The marginal bone breakdown, even as a normal finding, it is
critical for implant prognosis and is related to later bone loss (53). Titanium particles
are shed from rough treated surfaces during implant placement into bone and the
particles can be trapped in the cortical region, possibly contributing to the initial bone
breakdown (23, 24, 55, 59). This study was developed to analyze the influence of
titanium particles, shed from rough treated titanium surfaces in the cortical region
during implant insertion, in the initial marginal bone loss in dental implants.
Histological evaluation demonstrated that after 1week test group had more sites
of resorption in the first three threads than control group. Also was possible to observe
titanium particles near the implant surface in the entire implant for test group, mainly
in the cortical region (19, 23, 55). The presence of titanium particles near the resorption
sites indicated that osteolysis was related to titanium particles (Kaar et al 2001). Areas
of new bone formation were rarely in control and test and it was a normal finding for a
1week of evaluation (Terheyden et al 2012). After 4 weeks of healing, many areas of
new bone formation and areas of resorption could be observed in test and control
group, these findings were expected for this period of healing, related to the remodeling
process (9). Test group presented titanium particles around 20 µm surrounded by new
bone formation, the particles were at least 200 µm of distance from the surface,
suggesting that larger particles of titanium and/or agglomerates of particles were
trapped in the bone matrix (59).
The bone/implant contact (BIC) results showed that bone contact decrease in
test compared to control group after 1 and 4 weeks for tibia and femur. A reduction of
23,4% (femur) and 43,4% (tibia) of BIC values was observed for test compared to
control groups, as a result of enhanced bone resorption triggered by Ti particle after 1
week. After 4 weeks, a reduction of 20.2% (femur) and 21.08% (tibia) of BIC values
were observed for test compared to control groups. In tibia was used 3 mg of titanium
particles, and for femur was used 1mg. The sites that received more titanium particles
presented more bone resorption suggesting a possible dose-dependent reaction
(Goodman et al., 2014; Shin et al., 2012). The dose-dependency behavior, in this
54
study, cannot be confirmed because tibia has more cortical bone and femur more
trabecular structures.
The histological analyses and mRNA expression of osteogenic genes can be
correlated. At 3 days the upregulation of RUNX2 and OSX with the upregulation of
PTH and OSX for test group is confirmed in the histological after 7 days, results
showing presence of bone resorption in the firt three treads for test group and new
bone formation in the endosteum. At 7 days an downregulation of the genes
responsible for matrix production (BSP, COL1A1, OCN, ALP) and for ossification
(RUNX-2, OSX) and an upregulation of genes related to the liberation of the ion Ca
(PTH and OPN) suggest bone resorption. The upregulation of BMP-2 at 7 days in test
group indicated the begining of osteoblast recruitment that can start the process of
bone formation, that was possible to observe in the histological images after 4 weeks
bone formation on test group.
These results indicate that titanium particles can affect early stages of
osseintegration and have influence the initial marginal bone breakdown. The marginal
bone breakdown is critical in the maintenance of the dental implant treatment.
Controlling and managing the factors involved in the beginning of this osteolytic
process is crucial for the long-term survival of dental implants.
Conclusion Early stages of osseointegration were affected by the presence of titanium
particles in the cortical and trabecular bone. Based on the results of this animal study,
a new etiology for early bone loss around dental implants is presented.
Acknowledgments The authors declare no potential conflicts of interest with respect to the
authorship and/or publication of this article. We acknowledge the São Paulo Research
Foundation for granting scholarships FAPESP# 2013/19791-8 and
55
FAPESP#2014/10085-6 for the author Dr. Cindy Dodo during the development of this
study.
References Albrektsson T, Buser D, Sennerby L (2012). Crestal bone loss and oral
implants. Clinical implant dentistry and related research 14(6):783-791. Balshi TJ, Wolfinger GJ, Stein BE, Balshi SF (2015). A Long-term
Retrospective Analysis of Survival Rates of Implants in the Mandible. The International journal of oral & maxillofacial implants 30(6):1348-1354.
Cochran DL, Nummikoski PV, Schoolfield JD, Jones AA, Oates TW (2009).
A prospective multicenter 5-year radiographic evaluation of crestal bone levels over time in 596 dental implants placed in 192 patients. Journal of periodontology 80(5):725-733.
Flatebo RS, Hol PJ, Leknes KN, Kosler J, Lie SA, Gjerdet NR (2011).
Mapping of titanium particles in peri-implant oral mucosa by laser ablation inductively coupled plasma mass spectrometry and high-resolution optical darkfield microscopy. J Oral Pathol Med 40(5):412-420.
Franchi M, Orsini E, Martini D, Ottani V, Fini M, Giavaresi G et al. (2007).
Destination of titanium particles detached from titanium plasma sprayed implants. Micron 38(6):618-625.
Fransson C, Lekholm U, Jemt T, Berglundh T (2005). Prevalence of
subjects with progressive bone loss at implants. Clinical oral implants research 16(4):440-446.
Galindo-Moreno P, Leon-Cano A, Ortega-Oller I, Monje A, F OV, Catena A
(2014). Marginal bone loss as success criterion in implant dentistry: beyond 2 mm. Clinical oral implants research.
56
Kaar SG, Ragab AA, Kaye SJ, Kilic BA, Jinno T, Goldberg VM et al. (2001). Rapid repair of titanium particle-induced osteolysis is dramatically reduced in aged mice. Journal of orthopaedic research : official publication of the Orthopaedic Research Society 19(2):171-178.
Meyer U, Buhner M, Buchter A, Kruse-Losler B, Stamm T, Wiesmann HP
(2006). Fast element mapping of titanium wear around implants of different surface structures. Clinical oral implants research 17(2):206-211.
Mints D, Elias C, Funkenbusch P, Meirelles L (2014). Integrity of implant
surface modifications after insertion. Int J Oral Maxillofac Implants 29(1):97-104. Oh TJ, Yoon J, Misch CE, Wang HL (2002). The causes of early implant
bone loss: myth or science? Journal of periodontology 73(3):322-333. Papaspyridakos P, Chen CJ, Singh M, Weber HP, Gallucci GO (2012).
Success criteria in implant dentistry: a systematic review. Journal of dental research 91(3):242-248.
Schwarz EM, Benz EB, Lu AP, Goater JJ, Mollano AV, Rosier RN et al.
(2000). Quantitative small-animal surrogate to evaluate drug efficacy in preventing wear debris-induced osteolysis. Journal of orthopaedic research : official publication of the Orthopaedic Research Society 18(6):849-855.
Senna P, Antoninha Del Bel Cury A, Kates S, Meirelles L (2013). Surface
Damage on Dental Implants with Release of Loose Particles after Insertion into Bone. Clinical implant dentistry and related research.
Shin DK, Kim MH, Lee SH, Kim TH, Kim SY (2012). Inhibitory effects of
luteolin on titanium particle-induced osteolysis in a mouse model. Acta biomaterialia 8(9):3524-3531.
Terheyden H, Lang NP, Bierbaum S, Stadlinger B (2012). Osseointegration-
-communication of cells. Clinical oral implants research 23(10):1127-1135. Vandeweghe S, Cosyn J, Thevissen E, Van den Berghe L, De Bruyn H
(2012). A 1-year prospective study on Co-Axis implants immediately loaded with a full ceramic crown. Clinical implant dentistry and related research 14 Suppl 1(e126-138.
57
3 DISCUSSÃO
A literatura ortopédica demonstrou a influência das partículas de titânio
provenientes do desgaste de implantes ortopédicos no processo osteolítico, que leva
a falha da prótese e que pode ser exacerbada na presença de endotoxinas
bacterianas. A presença de partículas de titânio na região peri-implantar dental pode
ser um obstáculo para a regeneração óssea, levando a perda de óssea marginal. Este
trabalho teve como objetivo analisar o comportamento dos macrófagos humanos na
presença de partículas de titânio liberados durante a inserção de implantes dentários,
associado a um patógeno da região periimplantar P. Gingivalis, e analisar a influência
das partículas de titânio na perda óssea marginal inicial em implantes dentários.
Após o contato com partículas de titânio e Lipopolissacarídeos de
Porphyromonas gingivalis os macrófagos foram avaliados quanto a viabilidade celular.
Apesar de demonstrar viabilidade celular semelhantes entre os grupos, a expressão
gênica e a produção de citocinas poderia estar alterada, portanto comportamento
celular foi avaliado (Irshad et al., 2013; Zhang et al., 2011). Os resultados da
expressão gênica mostraram que TNF-α e IL1-β tiveram a expressão mais elevada
após 12h e IL-6 após 24 horas, seguindo o padrão esperado do processo de
inflamação relacionada a presença de partículas de titânio (Cachinho et al., 2013;
Obando-Pereda et al., 2014). Os grupos com nanopartículas de titânio apresentaram
a expressão mais elevada para todos os genes, o que nos leva a concluir que quanto
menor o tamanho da partícula, maior é a reação de inflamatória (Zhang et al., 2011).
Micropartículas de titânio também afetaram a expressão dos genes pró-inflamatórios,
confirmando a influência de micro e nanopartículas de titânio na expressão de
citocinas pró-inflamatórias relacionadas com o processo osteolítico (Goodman et al.,
2014; Zhang et al., 2013).
Para as análises de produção de citocinas pró-inflamatórias pelos macrófagos,
IL1-β teve maior produção em todos grupos analisados. IL1-β é a citocina produzida
58
para iniciar o processo osteolítico e desempenha um papel importante na expressão
de TNF-α, que modula a produção de RANK-L (Receptor activator of nuclear factor
kappa-B ligand), conduzindo a reabsorção óssea (Wei et al., 2009), estes resultados
sugerem que, se a análise fosse feita em tempos maiores que 48h a produção de
TNF-α poderia estar aumentada. Os grupos tratados com nanopartículas de titânio
apresentaram maior produção de citocinas após 48h.
Pode-se observar que a expressão gênica e produção de citocinas não
apresentaram um comportamento paralelo. Por exemplo, o TNF-α foi expresso após
12h para os grupos N, LM, e LN e a produção de proteína não ocorreu após 12h ou
24h. Outro fator discrepante foi a expressão gênica de IL-6, que foi maior do que as
outras citocinas, entretanto IL1-β foi a citocina mais produzida. Outros estudos na
literatura ortopédica descreveram resultados semelhantes ao nosso (Bi et al., 2001;
Obando-Pereda et al., 2014; Schwab et al., 2006; Trindade et al., 2001), mas o motivo
da falta de sincronia entre expressão e produção das citocinas ainda é desconhecida.
Uma possível explicação seria o processo pós-transcricional ou mecanismos
autócrinos que previnem uma reação inflamatória excessiva que pode ser prejudicial
ao organismo (Obando-Pereda et al., 2014).
Além disso estudos da literatura ortopédica mostraram que as partículas de
titânio contribuem para o aumento da resposta inflamatória, e a presença de
endotoxinas pode exacerbar ainda mais reação inflamatória (Bi et al., 2001). Neste
estudo, a associação de partículas de titânio com um patógeno comum da cavidade
oral, LPS de P. gingivalis foi analisado, e não houve aumento da expressão ou da
produção de citocinas pró-inflamatórias quando associado com micro e nanopartículas
de titânio. LPS de P. gingivalis é relatado por ser menos potente comparado a outras
bactérias Gram-negativa quanto a indução de citocinas pró-inflamatórias em vários
tipos de células, incluindo monócitos / macrófagos (Diya et al., 2008; Lu et al., 2001;
Ogawa and Uchida, 1996; Trindade et al., 2001). Esta é uma característica que faz
com que esta bactéria seja altamente invasiva sem alarmar o sistema imune do
hospedeiro (Holt et al., 1999).
59
Com relação a avaliação histológica do estudo in vivo, notamos que o grupo
com partículas de titânio após 1 semana teve mais sítios de reabsorção nas três
primeiras roscas que o grupo controle. Também foi possível observar partículas de
titânio perto da superfície do implante, em todo o corpo do implante para o grupo com
partículas, mas principalmente na região cortical (Meyer et al., 2006; Mints et al., 2014;
Senna et al., 2015). A presença de partículas de titânio próximo as áreas de
reabsorção óssea é um forte indicativo da influência destas partículas no processo
osteolítico (Kaar et al., 2001). Áreas de neoformação óssea foram raras tanto no
controle como no teste, e trata-se de um achado previsto para 1 semana após a
implantação cirúrgica (Terheyden et al., 2012). Após 4 semanas de cicatrização,
muitas áreas de neoformação óssea e áreas de reabsorção puderam ser observadas,
no grupo teste e controle, este resultado era esperado para este período de avaliação,
pois trata-se do processo de remodelação óssea (Terheyden et al., 2012). O grupo
teste apresentou partículas de titânio com cerca de 20μm presos nas regiões de
neoformação óssea, e estas partículas estavam a 200μm de distância da superfície
do implante, o que sugere que as partículas maiores de titânio e/ou aglomerados de
partículas ficaram presos na matriz óssea após a fagocitose por osteoclastos (Franchi
et al., 2007a).
Para o contato osso/implante (BIC) os resultados mostraram diminuição de BIC
do teste comparada ao controle após 1 e 4 semanas para a tíbia e o fêmur. Observou-
se uma redução de 23,4% (fêmur) e 43,4% (tíbia) de valores BIC para teste em
comparação com controle, como resultado de uma maior reabsorção óssea
desencadeada pela presença de partículas de titânio após 1 semana. Após 4
semanas, observou-se uma redução de 20,2% (fêmur) e 21,08% (tíbia) de valores BIC
para teste em comparação ao controle. Observa-se que ao longe do tempo a perda
óssea diminuiu, sugerindo uma retomada da formação óssea, em outras palavras as
partículas de titânio estariam afetando mais os estágios iniciais da osseointegração
com uma retomada da formação óssea (Galindo-Moreno et al., 2014). Na tíbia, foram
usados 3 mg de partículas de titânio, e no fêmur foi usado 1 mg. Os sítios que
60
receberam mais partículas de titânio apresentaram maior reabsorção óssea,
sugerindo uma possível dose-dependência (Goodman et al., 2014; Shin et al., 2012).
O comportamento de dose-dependência neste estudo não pode ser confirmado, pois
a tíbia possui mais osso cortical e o fêmur estruturas mais trabeculares, o que poderia
influenciar na velocidade de migração das células de defesa.
A avaliação dos principais genes relacionados com a formação e remodelação
óssea é uma maneira de compreender os mecanismos relacionados com a perda
óssea. O gene Runt-related transcription factor 2 (RUNX2) está relacionado com a
presença de osteoblastos e é precursor de genes relacionados com a formação de
matriz óssea como ocitocina (OCN), osteopontina (OPN), colágeno 1 (ColA1),
sialoproteina óssea (BSP), fosfatase alcalina (ALP) (Kirkham GR, 2007). OCN pode
também estar relacionado com a atividade dos osteoclastos. Osterix (OSX) é um gene
específico para a ossificação dos osteoblastos e a proteína morfogenética óssea tipo
2 (BMP-2) um fator de crescimento relacionado com formação óssea. O
paratohormônio (PTH) está associado a um aumento na concentração de cálcio iónico
(Ca2 +) removido do osso (Granchi et al., 2010; Gyurko et al., 2005).
A análise histológica e a expressão de genes osteogênicos do estudo in vivo
podem ser correlacionadas. Após 3 dias de avaliação houve um aumento da
expressão de RUNX2, OSX e PTH para o grupo de teste que é confirmado na análise
histológica após 7 dias, os resultados mostram presença de reabsorção óssea nas
três primeiras roscas para grupo de teste e neoformação óssea na região do endósteo.
Após 7 dias uma diminuição da expressão dos genes responsáveis pela produção de
matriz óssea foi observada BSP, COL1A1, OCN, ALP e dos genes relacionados a
calcificação óssea RUNX-2, OSX e um aumento na expressão dos genes
relacionados com a liberação de cálcio PTH e OPN o que sugere reabsorção óssea.
O aumento na expressão de BMP-2 após 7 dias para o teste pode indicar o início do
recrutamento de osteoblastos para o início do processo de formação do óssea, que
foi possível observar nas imagens histológicas após 4 semanas a formação de osso
no grupo de teste.
61
Nos nossos resultados pudemos observar que a presença de partículas de
titânio pode afetar as células THP-1 com relação a expressão gênica e produção de
citocinas pró-inflamatórias relacionadas ao processo osteolítico e que a presença de
endotoxinas provenientes de P. Gingivalis não aumentou a produção dessas citocinas.
E com o estudo in vivo foi confirmamos que as partículas de titânio podem afetar os
estágios iniciais de ossseointegração. A reabsorção óssea marginal é um ponto crítico
para a manutenção do tratamento de implantes dentários. O manejo e controle dos
fatores envolvidos no início deste processo osteolíico é essencial para o bom
prognóstico de implantes dentários
4 CONCLUSÃO
A presença de micro e nanopartículas de titânio estimula a expressão e
produção de citocinas pró-inflamatórias relacionadas ao processo osteolítico, e as
partículas de menor tamanho exercem maior influência nesta reação. A associação
de partículas de titânio com lipopolissacharideos de P.gingivalis não aumentou a
expressão gênica das citocinas pró- inflamatórias e diminuiu a produção em
comparação com os grupos tratados somente com partículas de titânio. O estágio
iniciail da osseointegração é afetado pela presença de partículas de titânio no osso
cortical e trabecular. Com base nos resultados deste estudo, apresentamos uma nova
etiologia para perda óssea marginal nos estágios inciais da osseointegração.
62
Referências 1. AlbrektssonT,SennerbyL.[Directboneanchorageoforalimplants:clinicalandexperimentalconsiderationsoftheconceptofosseointegration].Parodontologie.1990;1(4):307-20.2. NeohKG,HuX,ZhengD,KangET.Balancingosteoblastfunctionsandbacterialadhesiononfunctionalizedtitaniumsurfaces.Biomaterials.2012;33(10):2813-22.3. AlbrektssonT,SennerbyL.Directboneanchorageoforalimplants:clinicalandexperimentalconsiderationsoftheconceptofosseointegration.TheInternationaljournalofprosthodontics.1990;3(1):30-41.4. AlbrektssonT.Directboneanchorageofdentalimplants.TheJournalofprostheticdentistry.1983;50(2):255-61.5. AlbrektssonT,BuserD,SennerbyL.Crestalbonelossandoralimplants.ClinImplantDentRelatRes.2012;14(6):783-91.6. WennerbergA,AlbrektssonT.Effectsoftitaniumsurfacetopographyonboneintegration:asystematicreview.Clinicaloralimplantsresearch.2009;20Suppl4:172-84.7. AlbrektssonT,JanssonT,LekholmU.Osseointegrateddentalimplants.DentalclinicsofNorthAmerica.1986;30(1):151-74.8. BorsariV,GiavaresiG,FiniM,TorricelliP,SalitoA,ChiesaR,etal.Physicalcharacterizationofdifferent-roughnesstitaniumsurfaces,withandwithouthydroxyapatitecoating,andtheireffectonhumanosteoblast-likecells.JournalofbiomedicalmaterialsresearchPartB,Appliedbiomaterials.2005;75(2):359-68.9. TerheydenH,LangNP,BierbaumS,StadlingerB.Osseointegration--communicationofcells.Clinicaloralimplantsresearch.2012;23(10):1127-35.10. AlbrektssonT,ZarbG,WorthingtonP,ErikssonAR.Thelong-termefficacyofcurrentlyuseddentalimplants:areviewandproposedcriteriaofsuccess.TheInternationaljournaloforal&maxillofacialimplants.1986;1(1):11-25.11. SykarasN,IacopinoAM,MarkerVA,TriplettRG,WoodyRD.Implantmaterials,designs,andsurfacetopographies:theireffectonosseointegration.Aliteraturereview.TheInternationaljournaloforal&maxillofacialimplants.2000;15(5):675-90.12. SutterF,SchroederA,BuserDA.ThenewconceptofITIhollow-cylinderandhollow-screwimplants:Part1.Engineeringanddesign.TheInternationaljournaloforal&maxillofacialimplants.1988;3(3):161-72.13. CarrAB,BealsDW,LarsenPE.Reverse-torquefailureofscrew-shapedimplantsinbaboonsafter6monthsofhealing.TheInternationaljournaloforal&maxillofacialimplants.1997;12(5):598-603.14. ZhangY,YuW,JiangX,LvK,SunS,ZhangF.AnalysisofthecytotoxicityofdifferentiallysizedtitaniumdioxidenanoparticlesinmurineMC3T3-E1preosteoblasts.JournalofmaterialsscienceMaterialsinmedicine.2011;22(8):1933-45.15. GoodmanSB,KonttinenYT,TakagiM.Jointreplacementsurgeryandtheinnateimmunesystem.Journaloflong-termeffectsofmedicalimplants.2014;24(4):253-7.
63
16. WeiD,ZhouY,YangC.Structure,cellresponseandbiomimeticapatiteinductionofgradientTiO2-based/nano-scalehydrophilicamorphoustitaniumoxidecontainingCacompositecoatingsbeforeandaftercrystallization.ColloidsandsurfacesB,Biointerfaces.2009;74(1):230-7.17. BiY,VanDeMotterRR,RagabAA,GoldbergVM,AndersonJM,GreenfieldEM.Titaniumparticlesstimulateboneresorptionbyinducingdifferentiationofmurineosteoclasts.TheJournalofboneandjointsurgeryAmericanvolume.2001;83-A(4):501-8.18. RagabAA,VanDeMotterR,LavishSA,GoldbergVM,NinomiyaJT,CarlinCR,etal.Measurementandremovalofadherentendotoxinfromtitaniumparticlesandimplantsurfaces.Journaloforthopaedicresearch:officialpublicationoftheOrthopaedicResearchSociety.1999;17(6):803-9.19. MeyerU,BuhnerM,BuchterA,Kruse-LoslerB,StammT,WiesmannHP.Fastelementmappingoftitaniumweararoundimplantsofdifferentsurfacestructures.Clinicaloralimplantsresearch.2006;17(2):206-11.20. ShinDK,KimMH,LeeSH,KimTH,KimSY.Inhibitoryeffectsofluteolinontitaniumparticle-inducedosteolysisinamousemodel.Actabiomaterialia.2012;8(9):3524-31.21. Obando-PeredaGA,FischerL,Stach-MachadoDR.Titaniumandzirconiaparticle-inducedpro-inflammatorygeneexpressioninculturedmacrophagesandosteolysis,inflammatoryhyperalgesiaandedemainvivo.Lifesciences.2014;97(2):96-106.22. SennaP,AntoninhaDelBelCuryA,KatesS,MeirellesL.SurfaceDamageonDentalImplantswithReleaseofLooseParticlesafterInsertionintoBone.Clinicalimplantdentistryandrelatedresearch.2015;17(4):681-92.23. MintsD,EliasC,FunkenbuschP,MeirellesL.Integrityofimplantsurfacemodificationsafterinsertion.TheInternationaljournaloforal&maxillofacialimplants.2014;29(1):97-104.24. FlateboRS,HolPJ,LeknesKN,KoslerJ,LieSA,GjerdetNR.Mappingoftitaniumparticlesinperi-implantoralmucosabylaserablationinductivelycoupledplasmamassspectrometryandhigh-resolutionopticaldarkfieldmicroscopy.Journaloforalpathology&medicine:officialpublicationoftheInternationalAssociationofOralPathologistsandtheAmericanAcademyofOralPathology.2011;40(5):412-20.25. OlmedoDG,TasatDR,EvelsonP,GuglielmottiMB,CabriniRL.Biologicalresponseoftissueswithmacrophagicactivitytotitaniumdioxide.JournalofbiomedicalmaterialsresearchPartA.2008;84(4):1087-93.26. RutarA,LangNP,BuserD,BurginW,MombelliA.Retrospectiveassessmentofclinicalandmicrobiologicalfactorsaffectingperiimplanttissueconditions.Clinicaloralimplantsresearch.2001;12(3):189-95.27. LeonhardtA,BergstromC,LekholmU.Microbiologicdiagnosticsattitaniumimplants.Clinicalimplantdentistryandrelatedresearch.2003;5(4):226-32.28. LeeKH,MaidenMF,TannerAC,WeberHP.Microbiotaofsuccessfulosseointegrateddentalimplants.Journalofperiodontology.1999;70(2):131-8.
64
29. MombelliA,MarxerM,GaberthuelT,GrunderU,LangNP.Themicrobiotaofosseointegratedimplantsinpatientswithahistoryofperiodontaldisease.Journalofclinicalperiodontology.1995;22(2):124-30.30. LangNP,BerglundhT,WorkingGroup4ofSeventhEuropeanWorkshoponP.Periimplantdiseases:wherearewenow?--ConsensusoftheSeventhEuropeanWorkshoponPeriodontology.Journalofclinicalperiodontology.2011;38Suppl11:178-81.31. CochranDL,NummikoskiPV,SchoolfieldJD,JonesAA,OatesTW.Aprospectivemulticenter5-yearradiographicevaluationofcrestalbonelevelsovertimein596dentalimplantsplacedin192patients.Journalofperiodontology.2009;80(5):725-33.32. KirkhamGRCS.Genesandproteinsinvolvedintheregulationofosteogenesis.AshammakhiNRR,ChielliniE,editors.,editor:Springer;2007.33. GyurkoR,ShojiH,BattaglinoRA,BoustanyG,GibsonFC,3rd,GencoCA,etal.InduciblenitricoxidesynthasemediatesbonedevelopmentandP.gingivalis-inducedalveolarboneloss.Bone.2005;36(3):472-9.34. GranchiD,OchoaG,LeonardiE,DevescoviV,BaglioSR,OsabaL,etal.Geneexpressionpatternsrelatedtoosteogenicdifferentiationofbonemarrow-derivedmesenchymalstemcellsduringexvivoexpansion.TissueengineeringPartC,Methods.2010;16(3):511-24.35. OlmedoDG,TasatDR,EvelsonP,GuglielmottiMB,CabriniRL.Biologicalresponseoftissueswithmacrophagicactivitytotitaniumdioxide.JBiomedMaterResA.2008Mar15;84(4):1087-93.PubMedPMID:17685404.36. O'Brien-SimpsonNM,BurgessK,BrammarGC,DarbyIB,ReynoldsEC.Developmentandevaluationofasaliva-basedchair-sidediagnosticforthedetectionofPorphyromonasgingivalis.Journaloforalmicrobiology.2015;7:29129.37. SchwabLP,XingZ,HastyKA,SmithRA.Titaniumparticlesandsurface-boundLPSactivatedifferentpathwaysinIC-21macrophages.JournalofbiomedicalmaterialsresearchPartB,Appliedbiomaterials.2006;79(1):66-73.38. JinS,ParkJY,HongJM,KimTH,ShinHI,ParkEK,etal.Inhibitoryeffectof(-)-epigallocatechingallateontitaniumparticle-inducedTNF-alphareleaseandinvivoosteolysis.Experimental&molecularmedicine.2011;43(7):411-8.39. HanSG,NewsomeB,HennigB.Titaniumdioxidenanoparticlesincreaseinflammatoryresponsesinvascularendothelialcells.Toxicology.2013;306:1-8.40. Montiel-DavalosA,Ventura-GallegosJL,Alfaro-MorenoE,Soria-CastroE,Garcia-LatorreE,Cabanas-MorenoJG,etal.TiO(2)nanoparticlesinducedysfunctionandactivationofhumanendothelialcells.Chemicalresearchintoxicology.2012;25(4):920-30.41. ZhangY,YuS,XiaoJ,HouC,LiZ,ZhangZ,etal.Wearparticlespromoteendotoxintoleranceinmacrophagesbyinducinginterleukin-1receptor-associatedkinase-Mexpression.JournalofbiomedicalmaterialsresearchPartA.2013;101(3):733-9.42. DiyaZ,LiliC,ShenglaiL,ZhiyuanG,JieY.Lipopolysaccharide(LPS)ofPorphyromonasgingivalisinducesIL-1beta,TNF-alphaandIL-6productionbyTHP-1
65
cellsinawaydifferentfromthatofEscherichiacoliLPS.Innateimmunity.2008;14(2):99-107.43. IrshadM,ScheresN,CrielaardW,LoosBG,WismeijerD,LaineML.Influenceoftitaniumoninvitrofibroblast-Porphyromonasgingivalisinteractioninperi-implantitis.Journalofclinicalperiodontology.2013;40(9):841-9.44. CachinhoSC,PuF,HuntJA.Cytokinesecretionfromhumanperipheralbloodmononuclearcellsculturedinvitrowithmetalparticles.JournalofbiomedicalmaterialsresearchPartA.2013;101(4):1201-9.45. WeiS,KitauraH,ZhouP,RossFP,TeitelbaumSL.IL-1mediatesTNF-inducedosteoclastogenesis.TheJournalofclinicalinvestigation.2005;115(2):282-90.46. TrindadeMC,LindM,SunD,SchurmanDJ,GoodmanSB,SmithRL.Invitroreactiontoorthopaedicbiomaterialsbymacrophagesandlymphocytesisolatedfrompatientsundergoingrevisionsurgery.Biomaterials.2001;22(3):253-9.47. LuJ,YangZ,JiangJ,WangZ,ZhuP.RegulativeeffectofP38MAPKonreleaseofTNFalphaandNOfromalveolarmacrophagesunderendotoxinstimulation.Chinesejournaloftraumatology=Zhonghuachuangshangzazhi/ChineseMedicalAssociation.2001;4(2):75-7.48. OgawaT,UchidaH.DifferentialinductionofIL-1betaandIL-6productionbythenontoxiclipidAfromPorphyromonasgingivalisincomparisonwithsyntheticEscherichiacolilipidAinhumanperipheralbloodmononuclearcells.FEMSimmunologyandmedicalmicrobiology.1996;14(1):1-13.49. HoltSC,KesavaluL,WalkerS,GencoCA.VirulencefactorsofPorphyromonasgingivalis.Periodontology2000.1999;20:168-238.50. BalshiTJ,WolfingerGJ,SteinBE,BalshiSF.ALong-termRetrospectiveAnalysisofSurvivalRatesofImplantsintheMandible.TheInternationaljournaloforal&maxillofacialimplants.2015;30(6):1348-54.51. VandewegheS,CosynJ,ThevissenE,VandenBergheL,DeBruynH.A1-yearprospectivestudyonCo-Axisimplantsimmediatelyloadedwithafullceramiccrown.Clinicalimplantdentistryandrelatedresearch.2012;14Suppl1:e126-38.52. OhTJ,YoonJ,MischCE,WangHL.Thecausesofearlyimplantboneloss:mythorscience?Journalofperiodontology.2002;73(3):322-33.53. Galindo-MorenoP,Leon-CanoA,Ortega-OllerI,MonjeA,FOV,CatenaA.Marginalbonelossassuccesscriterioninimplantdentistry:beyond2mm.Clinicaloralimplantsresearch.2014.54. FranssonC,LekholmU,JemtT,BerglundhT.Prevalenceofsubjectswithprogressivebonelossatimplants.Clinicaloralimplantsresearch.2005;16(4):440-6.55. SennaP,AntoninhaDelBelCuryA,KatesS,MeirellesL.SurfaceDamageonDentalImplantswithReleaseofLooseParticlesafterInsertionintoBone.Clinicalimplantdentistryandrelatedresearch.2013.56. KaarSG,RagabAA,KayeSJ,KilicBA,JinnoT,GoldbergVM,etal.Rapidrepairoftitaniumparticle-inducedosteolysisisdramaticallyreducedinagedmice.Journalof
66
orthopaedicresearch:officialpublicationoftheOrthopaedicResearchSociety.2001;19(2):171-8.57. SchwarzEM,BenzEB,LuAP,GoaterJJ,MollanoAV,RosierRN,etal.Quantitativesmall-animalsurrogatetoevaluatedrugefficacyinpreventingweardebris-inducedosteolysis.Journaloforthopaedicresearch:officialpublicationoftheOrthopaedicResearchSociety.2000;18(6):849-55.58. PapaspyridakosP,ChenCJ,SinghM,WeberHP,GallucciGO.Successcriteriainimplantdentistry:asystematicreview.Journalofdentalresearch.2012;91(3):242-8.59. FranchiM,OrsiniE,MartiniD,OttaniV,FiniM,GiavaresiG,etal.Destinationoftitaniumparticlesdetachedfromtitaniumplasmasprayedimplants.Micron.2007;38(6):618-25.60. FranchiM,BacchelliB,GiavaresiG,DePasqualeV,MartiniD,FiniM,etal.Influenceofdifferentimplantsurfacesonperi-implantosteogenesis:histomorphometricanalysisinsheep.Journalofperiodontology.2007;78(5):879-88.