INSTITUTO NACIONAL DE PESQUISAS D A AMAZÔNIA - INPA ... · iii FICHA CATALOGRÁFICA SINOPSE O...
Transcript of INSTITUTO NACIONAL DE PESQUISAS D A AMAZÔNIA - INPA ... · iii FICHA CATALOGRÁFICA SINOPSE O...
INSTITUTO NACIONAL DE PESQUISAS DA AMAZÔNIA - INPA PROGRAMA DE PÓS-GRADUAÇÃO EM GENÉTICA, CONSERVAÇÃO E
BIOLOGIA EVOLUTIVA - GCBEv
Marcos Prado Lima
Manaus - AM Maio de 2016
EFEITOS DAS MUDANÇAS CLIMÁTICAS SOBRE A EXPRESSÃO GÊNICA E
A FISIOLOGIA DO TAMBAQUI (Colossoma macropomum, Cuvier, 1818)
i
MARCOS PRADO LIMA
Orientador: Adalberto Luis Val
Tese apresentada ao Programa de
Pós-Graduação em Genética,
Conservação e Biologia Evolutiva do
Instituto Nacional de Pesquisas da
Amazônia, como requisito para a
obtenção do título de Doutor em Genética,
Conservação e Biologia Evolutiva.
Manaus - AM Maio de 2016
EFEITOS DAS MUDANÇAS CLIMÁTICAS SOBRE A EXPRESSÃO GÊNICA E
A FISIOLOGIA DO TAMBAQUI (Colossoma macropomum, Cuvier, 1818)
ii
iii
FICHA CATALOGRÁFICA
SINOPSE O tambaqui, Colossoma macropomum, foi utilizado para investigar o efeito
das mudanças climáticas durante 150 dias de exposição aos cenários climáticos
B1, A1B e A2 previstos pelo IPCC para o ano 2100. Foram avaliados o perfil
transcricional, a ocorrência de danos ao DNA dos eritrócitos, diversos
parâmetros hematológicos e aspectos de regulação iônica. Os resultados
indicaram que as mudanças climáticas provocarão alterações na expressão de
diversos genes, assim como desequilíbrio em processos metabólicos vitais que
alteram a homeostase celular do tambaqui e podem colocar em risco a
sobrevivência da espécie.
Palavras-chave: Amazônia, aquecimento global, expressão diferencial, ensaio
L732e Prado-Lima, Marcos Efeitos das mudanças climáticas sobre a expressão gênica e a
fisiologia do tambaqui (Colossoma macropomum, Cuvier, 1818) / Marcos Prado Lima --- Manaus: [s.n.], 2016.
xvii, 152 f.: il., color. Tese (Doutorado) --- INPA, Manaus, 2016. Orientador: Adalberto Luis Val. Área de concentração : Genética, Conservação e Biologia Evolutiva.
1. Amazônia 2.Adaptação 3. Expressão diferencial. I.Título
CDD 591.15
iv
Dedico à minha esposa
Gilcideya Silva Prado e à minha
filha, Maria Clara Prado. Por tudo
que representam na minha vida e
pelo incondicional amor, apoio e
incentivo na busca do meu objetivo.
v
A realização deste projeto foi possível devido
Ao Programa de Pós-graduação em Genética, Conservação e Biologia
Evolutiva do INPA.
Ao Laboratório de Ecofisiologia e Evolução Molecular (LEEM) do INPA, ligado
a Coordenação de Biodiversidade, onde este trabalho foi desenvolvido com
financiamento proporcionado pelo Conselho Nacional de Desenvolvimento Científico
e Tecnológico (CNPq - Proc. Nº 573976/2008-2) e pela Fundação de Amparo à
Pesquisa do Estado do Amazonas (FAPEAM - Proc. No 3159/08), por meio do INCT-
ADAPTA (Centro de Adaptações da Biota Aquática da Amazônia).
À Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)
pela concessão da bolsa de estudos durante a realização deste trabalho.
À Universidade Federal do Oeste do Pará (UFOPA) pela liberação das
atividades como docente da instituição para cursar o doutorado.
vi
AGRADECIMENTOS
A Deus por ter me dado forças para superar os incontáveis obstáculos
enfrentados nessa longa caminhada. À Nossa Senhora Aparecida pelo amparo e
proteção durante os anos longe de casa.
À minha querida esposa, Gilcideya Prado, que me incentivou e me apoiou em
todos os momentos. Obrigado pela paciência, compreensão e ombro amigo desde o
mestrado! Sua presença ao meu lado foi fundamental para a concretização deste
sonho. Te amo!
À minha filha, Maria Clara, que veio ao mundo no momento mais crítico dessa
caminhada, mas trouxe um alento imensurável ao meu coração. Obrigado pelo seu
sorriso! Era dele que eu lembrava nos momentos mais difíceis que enfrentei nessa
fase final do doutorado.
Às minhas mães Fátima, Vicência e Maria Portela (in memorian) por todo o
apoio na busca dos meus sonhos. Durante todos esses anos longe de Santarém
vocês foram e continuam sendo minha referência, meu porto seguro.
Ao meu orientador, Adalberto Val, pela confiança no meu trabalho, pelos
conselhos e orientações recebidas ao longo dos últimos nove anos, desde o início
do mestrado. Sua disponibilidade em ler e reler meus textos, inclusive em finais de
semana e feriados, é um exemplo que demostra sua dedicação e amor pelo que faz.
Obrigado também por ter se tornado um exemplo, uma referência de quais valores
devem ser seguidos no mundo da ciência. Serei eternamente grato a você,
Adalberto!
À Dra. Vera Val pelo apoio, amizade e incentivo em diversos momentos dessa
jornada.
À Alzira Miranda e Fernanda Dragan pela colaboração e companheirismo
durante os vários meses de experimento nas futurísticas salas dos microcosmos. A
Daniel Fagundes e Renato Lemgruber pelo auxílio no sequenciamento.
À Lucas Canesin do Laboratório de Bioinformática e Biologia de Sistemas da
UNICAMP pelo auxílio com as análises de bioinformática.
Aos colegas da sala de doutorandos, especialmente Daiani Kochhann, Rafael
Duarte, Helen Sadauskas, Ramon Baptista, Jorge Sá e Derek Campos pelas
discussões científicas, conselhos e dicas em diversos momentos.
vii
Às minhas PIBICs preferidas, Jéssica Rany e Aldiane Passos, pela ajuda em
diversas etapas. À Susana Mota e Deney Araújo pela disponibilidade e auxílio em
vários momentos.
À Nazaré Paula (Naza) pela amizade, apoio e eficiência na resolução de
incontáveis problemas. Obrigado também pelos muitos conselhos diante dos
obstáculos enfrentados para se fazer ciência no meio da Amazônia.
À Raimunda Brandão, Claudinha Silva e Raquel Abecassiz pelo apoio no
setor administrativo do laboratório. Aos técnicos Reginaldo Oliveira e Rogério
Pereira pela disponibilidade em ajudar.
Aos colegas do Laboratório de Ecofisiologia e Evolução Molecular (LEEM) do
INPA pelo companheirismo, amizade e pelas inúmeras discussões científicas (e não
científicas também) ao longo desses últimos nove anos. Aprendi muito com vocês!
A todas as pessoas que direta ou indiretamente colaboraram para a
concretização deste sonho, inclusive aquelas que, infelizmente, tenha esquecido de
citar. Muito obrigado por tudo!
viii
“Por vezes sentimos que aquilo que fazemos não é senão uma gota de água no mar. Mas o mar seria menor se lhe faltasse uma gota”
(Madre Teresa de Calcutá)
ix
RESUMO
Nos últimos anos o equilíbrio dos ecossistemas naturais do planeta tem sido afetado pelas mudanças climáticas resultantes do aumento de gases do efeito estufa, especialmente dióxido de carbono. De acordo com o Painel Internacional sobre Mudanças no Clima, o IPCC, até o ano 2100 haverá elevação na temperatura média em todo o planeta, o que aumenta o risco de perda de biodiversidade em regiões mais vulneráveis como a Amazônia. Os peixes, assim como outros animais ectotérmicos, não possuem a capacidade de controlar sua temperatura corporal, ficando então sujeitos a variações ambientais que podem inviabilizar processos metabólicos vitais, levando o organismo à morte. Assim, para compreender como o tambaqui e outros peixes amazônicos poderão reagir ao aumento nos níveis de CO2 e de temperatura, o presente estudo teve como objetivo avaliar os efeitos biológicos da exposição do tambaqui, uma espécie símbolo da Amazônia, aos principais cenários de mudanças climáticas previstos pelo IPCC para o ano 2100. Exemplares de tambaqui foram expostos durante 150 dias ao cenário atual e a três cenários climáticos B1, A1B e A2. Na primeira parte do estudo foram investigadas alterações na expressão gênica após 5 e 15 dias de exposição por meio da construção de oito bibliotecas de RNA-Seq, que foram sequenciadas em um sequenciador de nova geração SOLID 4. Os resultados obtidos possibilitaram a identificação de 32.512 genes do transcriptoma do tambaqui, sendo 236 e 209 diferencialmente expressos após 5 e 15 dias de exposição, respectivamente. O grande número de genes diferencialmente expressos identificados sugere que uma complexa combinação de genes está envolvida na resposta do tambaqui às mudanças climáticas, especialmente genes relacionados ao metabolismo energético, chaperonas, fatores de iniciação da transcrição e tradução e genes ribossomais. Na segunda parte do estudo foram investigadas a ocorrência de danos ao DNA de eritrócitos, diversos parâmetros hematológicos e aspectos de regulação iônica do tambaqui durante 150 dias de exposição. Os resultados revelaram aumento no número de quebras no DNA de eritrócitos após 30 dias de exposição, alterações em diversos parâmetros hematológicos, especialmente aqueles relacionados ao aumento no número de eritrócitos e um severo desbalanceamento na concentração de íons plasmáticos e na atividade das principais enzimas branquiais de regulação iônica. Dessa forma, concluímos que os três cenários de mudanças climáticas avaliados podem provocar graves desequilíbrios em processos metabólicos vitais que alteram a homeostase celular do tambaqui e podem colocar em risco a sobrevivência da espécie.
Palavras-chave: Amazônia, aquecimento global, expressão diferencial, ensaio cometa, hematologia, regulação iônica.
x
ABSTRACT In recent years, the balance of the natural ecosystems has been affected by
climate change resulting from a continuous increase of greenhouse gases, mainly carbon dioxide. According to the Intergovernmental Panel on Climate Change, the IPCC, there will be an increase in the temperature around the planet, which enhances the risk of biodiversity loss in vulnerable regions such as the Amazon. Fish, like other ectothermic animals, do not control their body temperature and will then be subject to environmental variations that can compromise vital metabolic processes, causing to death. Thus, to understand how Amazonian fish can respond to global climate change, this study aimed to evaluate the biological effects of exposure of tambaqui, an Amazonian important fish species, to major climate change scenarios foreseen by IPCC for the year 2100. Juveniles of tambaqui were exposed during 150 days to the current environmental situation and B1, A1B and A2 climate change scenarios. Firstly were investigated changes in gene expression profile after 5 and 15 days of exposure through the construction of eight RNA-Seq libraries, which were sequenced using a next generation sequencer SOLID 4. The obtained results enabled to identify 32,512 genes on the transcriptome of tambaqui, being 236 and 209 differentially expressed after 5 and 15 days of exposure, respectively. A large number of differentially expressed genes identified indicates that a complex combination of genes is involved in tambaqui's response to climate change, especially genes related to energy metabolism, chaperones, transcription initiation factors and translation and ribosomal genes. Secondly, we investigated the occurrence of DNA damage in erythrocytes, several hematological parameters and ion regulation of tambaqui during 150 days of exposure to the various climate change driven environmental scenarios. The results revealed the existence of DNA strand breaks in erythrocytes after 30 days of exposure, changes in several hematological parameters, particularly those related to increase of red blood cells to compensate the increased demand of oxygen to tissues, as well as a severe imbalance in the plasma ion concentrations and the activity of key ion regulation enzymes of the gills. Thus, we concluded that the exposure of tambaqui to the analyzed climate change driven environmental scenarios can result in severe imbalances of vital metabolic processes that impair cellular homeostasis and pose a greater health risk to the analyzed species. Keywords: Amazonia, global warming, differential expression, comet assay, hematology, ionic regulation.
xi
SUMÁRIO
1 – INTRODUÇÃO GERAL....................................................................................... 18
1.1 - Mudanças climáticas globais.................................................................. 18
1.2 - Mudanças climáticas na Amazônia......................................................... 21
1.3 - Peixes expostos às mudanças climáticas.............................................. 22
1.4 - O tambaqui............................................................................................. 24
2 – OBJETIVOS........................................................................................................ 26
2.1 - Objetivo geral.......................................................................................... 26
2.2 - Objetivos específicos.............................................................................. 26
3 – RESULTADOS E DISCUSSÃO.......................................................................... 27
3.1 - Capítulo I – Efeitos de três cenários de mudanças climáticas sobre
danos ao DNA, hematologia e enzimas branquiais Na+/K+-ATPase e H+-
ATPase no peixe amazônico tambaqui (Colossoma macropomum).............. 28
3.1.1 - Introdução................................................................................. 30
3.1.2 - Materiais e métodos.................................................................. 32
3.1.3 - Resultados................................................................................ 36
3.1.4 - Discussão................................................................................. 45
3.1.5 - Referências bibliográficas......................................................... 51
3.2 - Capítulo II – Caracterização transcriptômica do tambaqui (Colossoma
macropomum, Cuvier, 1818) exposto a três cenários de mudanças
climáticas........................................................................................................ 59
3.2.1 - Introdução................................................................................. 61
3.2.2 - Materiais e métodos.................................................................. 63
3.2.3 - Resultados................................................................................ 66
3.2.4 - Discussão................................................................................. 80
xii
3.2.5 - Referências bibliográficas......................................................... 86
3.3 - Capítulo III: Da Genética à Fisiologia: uma abordagem integrativa sobre
a exposição do tambaqui (Colossoma macropomum) aos principais cenários de
mudanças climáticas previstos pelo IPCC.............................................................. 119
3.2.1 - Introdução............................................................................... 121
3.2.2 - Materiais e métodos................................................................ 123
3.2.3 - Resultados............................................................................... 123
3.2.4 - Discussão................................................................................ 125
3.2.5 - Referências bibliográficas....................................................... 136
4 – CONCLUSÕES GERAIS.................................................................................. 144
5 – PERSPECTIVAS............................................................................................... 145
6 – REFERÊNCIAS BIBLIOGRÁFICAS................................................................. 146
xiii
LISTA DE TABELAS
Capítulo I
Tabela 1. Parâmetros físico-químicos da água e do ar dos ambientes climáticos
controlados, onde os espécimes de tambaqui foram expostos por 150 dias . Os
dados são apresentados como média ± erro padrão da média (n= 6)...................... 33
Tabela 2. Parâmetros hematológicos do tambaqui durante exposição aos cenários
climáticos controle, B1, A1B e A2. Os dados são apresentados como média ± erro
padrão da média. t Indica diferença significante em comparação ao cenário controle
no mesmo tempo de exposição (P<0.05).* Indica diferença significante em
comparação ao tempo zero (P<0.05)........................................................................ 40
Tabela 3. Concentração de íons no plasma (mEq l-1) de tambaqui durante exposição
aos cenários climáticos atual, B1, A1B e A2. t Indica diferença significante em
comparação ao cenário controle no mesmo tempo de exposição (P<0.05).* Indica
diferença significante em comparação ao tempo zero (P<0.05)............................... 41
Capítulo II
Tabela 1. Parâmetros físico-químicos da água e do ar do ambiente onde os
espécimes de tambaqui foram expostos durante cinco e quinze dias aos cenários
climáticos atual, B1, A1B e A2. Os dados são apresentados como média ± erro
padrão da média........................................................................................................ 63
Tabela 2. Visão geral das sequências de RNA-Seq de tambaqui obtidas após cinco
e quinze dias de exposição aos cenários climáticos B1, A1B e A2.......................... 67
Tabela 3. Principais genes do tambaqui afetados pela exposição aos cenários
climáticos................................................................................................................... 69
Tabela S1. Lista de genes diferencialmente expressos (Log2FC) de tambaqui após 5
dias de exposição aos cenários climáticos B1, A1B e A2. Genes regulados
positivamente são mostrados como valores positivos e genes regulados
negativamente são mostrados como valores negativos............................................ 99
xiv
Tabela S2. Lista de genes diferencialmente expressos (Log2FC) de tambaqui após
15 dias de exposição aos cenários climáticos, B1, A1B e A2. Genes regulados
positivamente são mostrados como valores positivos e genes regulados
negativamente são mostrados como valores negativos.......................................... 105
Tabela S3. Genes de tambaqui após 5 e 15 dias de exposição aos cenários
climáticos B1, A1B e A2, agrupados em cinco clusters utilizando o programa
STRING (v. 10)........................................................................................................ 110
Tabela S4. Oligonucleotideos iniciadores e tipos de microssatélites encontrados nas
sequências de tambaqui.......................................................................................... 116
Capítulo III
Tabela 1. Principais genes diferencialmente expressos que responderam a
exposição do tambaqui aos cenários climáticos B1, A1B e A2............................... 124
xv
LISTA DE FIGURAS
Introdução
Figura 1. Diferentes cenários climáticos previstos pelo IPCC para o ano 2100. As
linhas sólidas representam tendências globais de aquecimento da superfície para os
cenários B1, A1B e A2, mostrados como continuações das simulações do século
XX. Os sombreamentos representam intervalos de desvio padrão das médias
anuais. A linha laranja simula a tendência de aquecimento caso as concentrações de
gás carbônico se mantenham constantes aos valores do ano 2000. As barras cinzas
a direita indicam a melhor estimativa (linha sólida dentro de cada barra) e a faixa
provável avaliada para seis cenários climáticos. Fonte: AR4, IPCC (2007)............. 19
Figura 2: Exemplar de Colossoma macropomum.................................................... 24
Capítulo I
Figura 1. Indicador de Dano Genético (GDI) em eritrócitos de tambaqui ao longo do
período experimental de exposição aos cenários climáticos controle, B1, A1B e A2. t Indica diferença significante em comparação ao cenário controle no mesmo tempo
de exposição (P<0.05). * Indica diferença significante em comparação ao tempo zero
(P<0.05)..................................................................................................................... 37
Figura 2. Integridade do DNA Celular (CDI) em eritrócitos de tambaqui ao longo do
período experimental de exposição aos cenários climáticos controle, B1, A1B e
A2.............................................................................................................................. 38
Figura 3. Atividade da Na+/K+-ATPase nas brânquias de tambaqui ao longo do
período experimental de exposição aos cenários climáticos controle, B1, A1B e A2. t Indica diferença significante em comparação ao cenário controle no mesmo tempo
de exposição (P<0.05). * Indica diferença significante em comparação ao tempo zero
(P<0.05)..................................................................................................................... 43
Figura 4. Atividade da H+-ATPase nas brânquias de tambaqui ao longo do período
experimental de exposição aos cenários climáticos controle, B1, A1B e A2. t Indica
diferença significante em comparação ao cenário controle no mesmo tempo de
xvi
exposição (P<0.05). * Indica diferença significante em comparação ao tempo zero
(P<0.05)..................................................................................................................... 44
Capítulo II
Figura 1. Número e direção dos transcritos diferencialmente expressos de tambaqui
identificados após cinco e quinze dias de exposição aos diferentes cenários
climáticos B1, A1B e A2. O gráfico de barras mostra o número de transcritos
diferencialmente expressos identificados após cinco dias (barras à esquerda) e
quinze dias (barras à direita) de exposição aos cenários climáticos B1, A1B e A2. Os
valores positivos e negativos do eixo Y representam o número de transcritos com
regulação positiva e negativa, respectivamente. ...................................................... 68
Figura 2. Representação dos 20 principais termos do Gene Ontology relacionados
aos genes regulados positivamente no tambaqui após cinco dias de exposição aos
cenários climáticos B1, A1B e A2, sendo função molecular (A), processo biológico
(B) e componente celular (C). .................................................................................. 71
Figura 3. Representação dos 20 principais termos do Gene Ontology relacionados
aos genes regulados negativamente no tambaqui após cinco dias de exposição aos
cenários climáticos B1, A1B e A2, sendo função molecular (A), processo biológico
(B) e componente celular (C).................................................................................... 73
Figura 4. Representação dos 20 principais termos do Gene Ontology relacionados
aos genes regulados positivamente no tambaqui após 15 dias de exposição aos
cenários climáticos B1, A1B e A2, sendo função molecular (A), processo biológico
(B) e componente celular (C).................................................................................... 75
Figura 5. Representação dos 20 principais termos do Gene Ontology relacionados
aos genes regulados negativamente no tambaqui após 15 dias de exposição aos
cenários climáticos B1, A1B e A2, sendo função molecular (A), processo biológico
(B) e componente celular (C).................................................................................... 77
Figura 6. Rede de interação gênica gerada pelo programa STRING (v.10). As
interações de genes (ou proteínas) foram expressas no músculo branco de tambaqui
xvii
após cinco e quinze dias de exposição aos cenários climáticos B1, A1B e A2. Os
círculos com cores diferentes representam genes diferentes (ou proteínas). As linhas
azuis representam fortes interações entre esses genes (ou proteínas). Os círculos
sem nenhuma interação foram ocultados................................................................. 79
Figura 7. Distribuição dos microssatélites encontrados nas sequências de tambaqui
................................................................................................................................... 80
Figura S1. Genes identificados no tambaqui após 5 e 15 dias de exposição aos
cenários climáticos B1, A1B e A2 agrupados no cluster 1 utilizando o programa
STRING (v.10)........................................................................................................... 94
Figura S2. Genes identificados no tambaqui após 5 e 15 dias de exposição aos
cenários climáticos B1, A1B e A2 agrupados no cluster 2 utilizando o programa
STRING (v.10)........................................................................................................... 95
Figura S3. Genes identificados no tambaqui após 5 e 15 dias de exposição aos
cenários climáticos B1, A1B e A2 agrupados no cluster 3 utilizando o programa
STRING (v.10)........................................................................................................... 96
Figura S4. Genes identificados no tambaqui após 5 e 15 dias de exposição aos
cenários climáticos B1, A1B e A2 agrupados no cluster 4 utilizando o programa
STRING (v.10)........................................................................................................... 97
Figura S5. Genes identificados no tambaqui após 5 e 15 dias de exposição aos
cenários climáticos B1, A1B e A2 agrupados no cluster 5 utilizando o programa
STRING (v.10)........................................................................................................... 98
18
1 - INTRODUÇÃO GERAL
1.1 – Mudanças climáticas globais
O aquecimento global, resultante principalmente do acúmulo de gases de
efeito estufa (GEE) na atmosfera, especialmente dióxido de carbono (CO2), metano
(CH4) e os óxidos nitrosos (N2O), representa uma grande ameaça ao planeta (IPCC,
2014). Diversos estudos comprovam que as mudanças climáticas já em curso
resultam em alterações nos padrões globais da vegetação e mudanças no uso da
terra (Hirota et al. 2011; Lapola et al. 2014), redução da biodiversidade mundial
(Ficke et al. 2007; Chown et al. 2010) e mudanças na composição atmosférica
(Walker e Steffen1997) em diversas regiões do planeta, inclusive no Brasil (Lapola et
al. 2014).
As primeiras evidências de modificações no clima do planeta surgiram ainda
na década de 1980 e, desde então, vêm despertando de forma crescente maior
interesse e preocupação tanto da comunidade científica quanto da população em
geral (Lima et al. 2011). Devido ao desconhecimento sobre os impactos de
alterações na estabilidade climática mundial, em 1988 a Organização das Nações
Unidas, por meio do Programa das Nações Unidas para o Meio Ambiente, e a
Organização Meteorológica Mundial, criaram o Painel Intergovernamental sobre
Mudanças Climáticas (Intergovernamental Panel on Climate Change - IPCC) com o
objetivo de avaliar as informações científicas, técnicas e socioeconômicas relevantes
para entender os riscos induzidos pelas mudanças climáticas na população humana,
bem como propor cenários de mudanças climáticas para o futuro (Marengo 2007).
A organização do IPCC, tal como seus cinco relatórios publicados em 1990,
1995, 2001, 2007 e 2014, baseia-se em três eixos principais: 1) compreensão dos
fatores humanos e naturais que causam as mudanças do clima; 2) impacto social e
ambiental das mudanças do clima, adaptação e vulnerabilidade; 3) busca de
medidas de mitigação e adaptação às mudanças climáticas. Os cientistas do IPCC
utilizam modelos matemáticos para simular os impactos das mudanças climáticas no
clima e nos ecossistemas em nível global e regional, especialmente relacionados a
alterações na concentração de GEE na atmosfera (Stéfanon et al. 2015). Dessa
forma, coube ao IPCC o importante papel de criar diferentes cenários climáticos
cientificamente embasados, utilizando indicadores de áreas como meteorologia,
climatologia, paleontologia, hidrologia, biologia e áreas afins para prever possíveis
19
trajetórias de desenvolvimento global a partir da emissão de diferentes níveis de
GEE na atmosfera (Viner et al. 1995; Moss et al. 2010).
Em seus últimos relatórios, publicados em 2007 (AR4) e 2014 (AR5), o IPCC
descreve vários avanços obtidos a partir da utilização de projeções de possíveis
cenários climáticos baseando-se na avaliação do impacto dos fatores humanos e
naturais nas mudanças climáticas, considerando diferentes níveis de emissão de
GEE (IPCC 2007; 2014). Cenários são estórias relevantes e cientificamente
embasadas sobre como o futuro pode se desdobrar, expressas na forma de palavras
e números, evidenciando incertezas e caminhos futuros. Portanto, não podem ser
considerados previsões, projeções ou recomendações (Raskinet al. 2005; IPCC
2007; 2014). Todos os 40 cenários previstos pelo AR4 para o ano 2100 têm origem
a partir de quatro grandes famílias de cenários (A1, A2, B1 e B2) caracterizadas
qualitativamente a partir de diferentes caminhos de desenvolvimento
socioeconômico e uso de combustíveis fósseis ou fontes de energia renováveis e
devem ser vistos como matéria-prima para o aprofundamento de estudos que visem
a elaboração de ações de mitigação de impactos e adaptação às mudanças
climáticas (IPCC 2007).
Figura 1. Diferentes cenários climáticos previstos pelo IPCC para o ano 2100. As linhas sólidas representam tendências globais de aquecimento da superfície para os cenários B1, A1B e A2, mostrados como continuações das simulações do século XX. Os sombreamentos representam intervalos de desvio padrão das médias anuais. A linha laranja simula a tendência de aquecimento caso as concentrações de gás carbônico se mantenham constantes aos valores do ano 2000. As barras cinzas a direita indicam a melhor estimativa (linha sólida dentro de cada barra) e a faixa provável avaliada para seis cenários climáticos. Fonte: AR4, IPCC (2007).
20
O crescente aumento nas emissões de GEE, principalmente CO2, registrado
nas últimas décadas, relacionado à queima de combustíveis fósseis e mudanças no
uso da terra, tem sido o fator decisivo para o aquecimento global. Entre os anos de
1906 e 2005 houve um aumento de 0,74oC na temperatura média do planeta, esse
aumento pode, no entanto, chegar a 4,5oC até o ano de 2100. Outras consequências
decorrentes do aquecimento global têm sido registradas com maior frequência nos
últimos anos, como mudanças nos padrões de vento e chuvas, alterações de
correntes marítimas e intensificação da desertificação em determinadas regiões
(IPCC 2007).
Desde a revolução industrial até o ano de 2005, a concentração de CO2 na
atmosfera cresceu 33%, passando de 280 para 379 ppm, ritmo muito acima do que
foi registrado nos últimos 800 mil anos (180 a 300 ppm) (Brundtland et al. 2012;
IPCC 2007). De acordo com AR4, entre 1995 e 2005 o aumento médio de CO2 na
atmosfera foi de 1,9 ppm, podendo chegar entre 730 a 1020 ppm até 2100 (IPCC
2007). Caso os níveis atuais de emissões de CO2 continuem a crescer, a
temperatura no planeta pode ficar 4oC acima da registrada antes da revolução
industrial (Rockström et al. 2014).
Diversos estudos que analisaram os efeitos das mudanças climáticas indicam
que seus efeitos não serão homogêneos em diferentes regiões do planeta (Döll e
Zhang 2010; Stéfanon et al. 2015). Em decorrência da Cordilheira dos Andes e de
uma grande heterogeneidade climática, a América do Sul é uma das regiões mais
vulneráveis às mudanças climáticas (Grimm e Natori 2006; Hirota et al. 2011). De
acordo com o IPCC, depois da Polinésia, África, parte da Ásia e Caribe, a América
do Sul é considerada a parte do planeta que mais sofrerá com os efeitos das
mudanças no clima, que poderão resultar no aumento de eventos climáticos
extremos como alterações significativas da disponibilidade hídrica, salinização e
desertificação de áreas utilizadas para agricultura, riscos de inundação em áreas
costeiras baixas e deslocamento dos estoques pesqueiros (IPCC 2007). A
temperatura média da América do Sul sofrerá um aumento que poderá chegar a 6ºC,
produzindo efeitos catastróficos em diversas regiões do continente, porém o Brasil
sofrerá as alterações mais severas, especialmente nas regiões mais sensíveis às
mudanças climáticas como a Amazônia e a região Nordeste (Nobre et al. 2007;
Hirota et al. 2010).
21
1.2 – Mudanças climáticas na Amazônia
A bacia amazônica, formada pelo rio Amazonas e seus afluentes, escoa para
o mar entre 15 e 20% de toda a água doce do planeta (Salati e Vose 1984). No
período chuvoso estima-se que até 29% da área da bacia fique coberta por água em
razão de seus muitos rios, lagos e igarapés que atuam como uma fonte geradora de
calor e umidade que regula o regime de chuvas em ambos os hemisférios,
possuindo um papel vital no clima global (Castello et al. 2013; Cheng et al. 2013).
Dessa forma, as mudanças climáticas podem afetar substancialmente a região
amazônica e, consequentemente, alterar o clima global (Nobre et al. 2005; Castello
et al. 2013).
A região amazônica vem sofrendo nas últimas décadas uma crescente
pressão antrópica que tem provocado redução na sua cobertura vegetal como
consequência do desmatamento e de incêndios florestais que, somados ao
aquecimento global, ameaçam a estabilidade climática, ecológica e ambiental da
região (Nobre et al. 2007). A crescente fragmentação de habitats e ecossistemas,
como consequência do desmatamento, consiste não apenas em um fator aditivo ao
impacto das mudanças climáticas, mas sim em um fator multiplicador quando se
consideram também o estresse associado a essas mudanças (Marengo 2007).
Sendo assim, é difícil estimar a vulnerabilidade das espécies às mudanças
climáticas devido à escassez de informações cientificamente embasadas (Canhos et
al. 2007).
De acordo com vários cenários do IPCC, até o ano de 2100 a temperatura
média na Amazônia terá um aumento acima de 3ºC, o que aumentaria a chance de
perda da cobertura florestal em 40% em algumas regiões, elevando o risco de perda
de biodiversidade e aumentando a ocorrência de eventos climáticos extremos, como
a seca de 2005 (IPCC 2007; Nobre et al. 2007). A assombrosa velocidade com que
as mudanças no clima do planeta vêm ocorrendo nas últimas décadas, quando
comparadas àquelas dos processos naturais, consiste em uma ameaça real para
espécies da flora e da fauna amazônicas, colocando em perigo a região que possui
a maior biodiversidade do mundo, tendo como consequência um provável
“empobrecimento biológico” na região (Nobre et al. 2005; 2007).
Além das florestas, o clima mais seco que o atual em parte da Amazônia
afetará também o ambiente aquático que sofrerá profundas alterações, tanto pelas
mudanças na dinâmica do sistema hidrológico, quanto por alterações pontuais que
22
podem ter profundos efeitos sobre os ecossistemas e as comunidades de
organismos aquáticos (Portner e Farrell 2008; Gamito et al. 2013). Essas alterações
tornarão o solo e a atmosfera da Amazônia menos úmidos, aumentado a
evapotranspiração das plantas que terá efeitos tanto na redução do escoamento
superficial quanto na vazão dos rios, modificando ecossistemas e dificultando a
navegação em alguns períodos do ano (Döll e Zhang 2010; Liberato e Brito 2010).
1.3 – Peixes expostos às mudanças climáticas
Diversas alterações em ambientes aquáticos relacionadas com variações
climáticas têm sido descritas nas últimas décadas, indicando que esses
ecossistemas são extremamente sensíveis e vulneráveis às mudanças climáticas
globais (Richardson e Poloczanska 2008). Vários impactos têm sido documentados
em todos os níveis da organização biológica que vão desde alterações na expressão
de genes (Clark et al. 2011); passando por modificações fisiológicas (Del Toro-Silva
et al. 2008), esqueléticas (Booth et al. 2014; Lopes 2016) e comportamentais
(Abrahams et al. 2007); até alterações na composição de assembleias (Ter Hofstede
e Rijnsdorp 2011) e na distribuição geográfica de peixes (Perry et al. 2005).
A elevação da temperatura atmosférica gera efeitos também no ambiente
aquático por meio do aumento na temperatura dos corpos d’água. De uma maneira
geral, em virtude de uma menor capacidade de armazenamento de calor, os corpos
d’água mais rasos tendem a apresentar temperaturas máximas e mínimas mais
acentuadas em comparação com aqueles mais profundos (Talling2001).
Considerando que a solubilidade do oxigênio é inversamente proporcional a
temperatura, ou seja, quando a temperatura da água aumenta, a concentração de
oxigênio dissolvido diminui, podendo resultar em um estresse adicional causado pela
hipóxia, justamente no momento em que as demandas metabólicas dos peixes se
elevam para superar o desafio ambiental (Talling 2001; Abrahams et al. 2007).
Consequentemente, a interação desses dois parâmetros físico-químicos
(temperatura e concentração de oxigênio) pode colocar em risco a sobrevivência de
um organismo devido ao comprometimento de suas atividades biológicas vitais (Del
Toro-Silva et al. 2008; Blair et al. 2013).
Apesar dos peixes de água doce serem ectotérmicos, ou seja, não
conseguirem regular fisiologicamente sua temperatura corporal, que geralmente é
muito próxima a temperatura do ambiente onde vivem, os peixes podem se deslocar
23
vertical ou horizontalmente na coluna d’água para zonas com maior conforto térmico
(Clarke 2003; Ficke et al. 2007). Essa estratégia comportamental permite superar
variações térmicas em seus habitats decorrentes de mudanças rápidas na energia
solar, movimentos anormais da água e eventos de precipitação rápida (Long et al.
2012). Porém, essa estratégia acaba sendo limitada à gama de temperaturas
disponíveis no ambiente aquático e, consequentemente, devido as reações
fisiológicas variarem de acordo com a temperatura corporal, as mudanças climáticas
podem comprometer processos básicos como alimentação, crescimento,
comportamento, reprodução e a capacidade de manter a homeostase interna (Ficke
et al. 2007; Somero 2010).
Para a compreensão dos efeitos das mudanças climáticas sobre os peixes da
Amazônia é necessário considerar diversos fatores que vão além das características
da espécie em estudo, como a interação com outras espécies, a capacidade
adaptativa, distribuição geográfica e ocorrência nos diferentes ecossistemas. Por
exemplo, espécies com distribuição restrita a algumas regiões da bacia são mais
vulneráveis às mudanças climáticas do que aquelas com distribuição mais ampla
(Val e Almeida-Val 2008). Outra característica importante que deve ser considerada
é a aclimatação térmica, que consiste numa estratégia de ajuste fisiológico em que o
organismo é capaz de sintetizar determinadas proteínas que conferem maior
resistência a variações de temperatura como as chaperonas ou HSPs (heat shock
proteins) (Basu et al. 2002; Hofmann 2005; Somero 2010).
Contudo, para responder as modificações ambientais geradas a partir do
aumento na temperatura da água e nas alterações de gases dissolvidos,
especialmente CO2 e oxigênio, os peixes podem adotar diversas estratégias como
nadar para regiões com temperaturas mais baixas ou com maior disponibilidade de
oxigênio, manter-se na coluna d’água onde for metabolicamente mais conveniente
ou, até mesmo, fazer uso de algum tipo de respiração acessória (Oliveira 2003;
Nowickiet al. 2012). Porém, quando essas estratégias não forem suficientes, os
organismos podem desencadear um conjunto de respostas bioquímicas e
moleculares com o objetivo de compensar esses efeitos e garantir a sobrevivência
mesmo sob estresse.
24
1.4 – O tambaqui
O tambaqui (Colossoma macropomum, Cuvier 1818), figura 2, é o maior
caraciforme da bacia amazônica (Goulding 1980, 1993), sendo endêmico desta
região e amplamente distribuído nos principais rios da bacia, onde pode alcançar
mais de um metro de comprimento e 30 kg de peso (Goulding 1993; Araújo-Lima e
Goulding 1998). Na natureza o tambaqui é onívoro, alimentando-se basicamente de
frutas e sementes durante o período chuvoso e zooplancton e insetos na estação
seca (Araújo-Lima e Goulding 1998). Apresenta comportamento migratório quando
se desloca para os rios de águas brancas em períodos de chuvas intensas em
busca de ambientes de várzea, considerados ideais para reprodução devido a sua
grande produtividade e disponibilidade de habitats que se tornam áreas de refúgio e
proteção para a espécie (Lima e Araujo-Lima 2004).
Figura 2: Exemplar de Colossoma macropomum. Foto: Maria de Nazaré Paula da Silva.
O sabor agradável e as características nutricionais de sua carne são
responsáveis pela ampla aceitação do tambaqui como fonte alimentar para a
população amazônica e de outras regiões do país, levando a um crescente esforço
de pesca das populações naturais (Araújo-Lima e Goulding 1998). Na década de
1970 o tambaqui correspondia a 45% da quantidade de peixe desembarcado no
mercado municipal de Manaus (Graef 1996), o que contribuiu fortemente para a
inclusão da espécie na lista oficial de espécies protegidas durante o defeso (IBAMA
2003).
Do ponto de vista fisiológico, diversos estudos mostram que o tambaqui é
uma espécie extremamente plástica, podendo adaptar-se a mudanças ambientais
por meio de ajustes metabólicos que combinam mudanças anatômicas com ajustes
hematológicos e de regulação da expressão gênica (Saint-Paul 1984; Val e Almeida-
2 cm
25
Val 1995). A principal modificação anatômica que ocorre no tambaqui, quando
submetido a baixas concentrações de oxigênio dissolvido, é a expansão do lábio
inferior que, apesar de não estar envolvido diretamente na troca gasosa, auxilia na
tomada da água próximo a superfície, aumentando assim o aporte de oxigênio para
as brânquias, ao mesmo tempo em que reduz os níveis intraeritrocitários de ATP e
GTP para amenizar os efeitos negativos provocados pela baixa concentração de
oxigênio dissolvido na água (Val e Almeida-Val 1995).
Devido à importância econômica do tambaqui para a região amazônica, os
programas para sua conservação e seu potencial para o desenvolvimento da
aquicultura, a espécie se tornou o peixe símbolo da Amazônia (Araújo-Lima e
Goulding 1998). Entretanto, a falta de informações relacionadas à adaptação de
peixes da Amazônia às mudanças climáticas globais, especialmente ao aumento da
temperatura e de CO2, deixa esses organismos e a Amazônia como um todo
altamente vulneráveis às variações ambientais. Tal fato pode ter consequências
graves para o meio ambiente, pois informações cientificamente embasadas são
fundamentais para a implementação de medidas mitigadoras por parte do poder
público.
26
2 – OBJETIVOS
2.1 – Objetivo geral
Avaliar os efeitos biológicos da exposição do tambaqui (Colossoma
macropomum) aos principais cenários de mudanças climáticas previstos pelo IPCC
para o ano 2100.
2.2 – Objetivos específicos
a) Avaliar o efeito da exposição do tambaqui aos cenários climáticos B1, A1B
e A2 previstos pelo IPCC para o ano 2100 sobre quinze parâmetros metabólicos e
fisiológicos.
b) Identificar alterações no transcriptoma do tambaqui relacionadas a
exposição aos cenários climáticos B1, A1B e A2 previstos pelo IPCC para o ano
2100.
c) Identificar e caracterizar potenciais genes relacionados aos ajustes
metabólicos e fisiológicos do tambaqui submetido aos cenários climáticos B1, A1B e
A2 previstos pelo IPCC para o ano 2100.
27
3 – RESULTADOS E DISCUSSÃO
O presente trabalho buscou investigar os principais efeitos biológicos da
exposição do tambaqui aos principais cenários de mudanças climáticas previstos
pelo IPCC para o ano 2100. Os resultados obtidos estão apresentados na forma de
artigos científicos, conforme descrito abaixo:
Capítulo I: Efeitos de três cenários de mudanças climáticas sobre danos ao DNA,
hematologia e enzimas branquiais Na+/K+-ATPase e H+-ATPase no
peixe amazônico tambaqui (Colossoma macropomum). Este capítulo
refere-se ao objetivo específico a.
Capítulo II: Caracterização transcriptômica do tambaqui (Colossoma macropomum,
Cuvier, 1818) exposto a três cenários de mudanças climáticas. Este
capítulo refere-se aos objetivos específicos b e c.
Capítulo III: Da Genética à Fisiologia: uma abordagem integrativa sobre a exposição
do tambaqui (Colossoma macropomum) aos principais cenários de
mudanças climáticas previstos pelo IPCC. Este capítulo faz uma
integração entre os objetivos específicos a, b e c.
28
Capítulo 1 ____________________________________________________________________ Prado-Lima, M.; Duarte, R.M. & Val, A.L. Effects of three climate change scenarios on DNA damage, hematology, and branchial Na+/K+-ATPase and H+-ATPase in the Amazonian fish tambaqui (Colossoma macropomum). Manuscrito formatado para Comparative Biochemistry and Physiology - Part A.
29
Abstract
Climate change-driven effects are likely to disturb all ecosystems around the world, especially those more sensible as Amazonia. Although Amazonia basin harbors a significant portion of Earth’s biodiversity, as well as the highest diversity of freshwater fishes in the world, there have been relatively few studies of Amazonian organisms, such as tambaqui, related to climate change. Thus, the aim of this study was to investigate the effects of long-term exposure (150 days) to B1, A1B and A2 climate scenarios foreseen by the IPCC on DNA damage of erythrocytes, hematology, plasma ion composition and Na+/K+-ATPase and H+-ATPase branchial ion regulation enzymes in the freshwater fish tambaqui. The results showed a significant increase on DNA strand breaks on erythrocytes of tambaqui after 30 days of exposure to the selected experimental scenarios. Increases in hematocrit, hemoglobin and red blood cells between 30 to 150 days of exposure, indicating a swelling of red blood cells of fish, were also observed. Plasma levels of monovalent ions Na+, K+, and Cl- was slightly affected, whereas the concentration of divalent ions Ca2+ and Mg2+ were reduced in animals exposed to all three analyzed climate scenarios. An apparent inhibition of both Na+/K+-ATPase and H+-ATPase activity, which may affect the internal ionic homeostasis of fish, was observed. Overall, the exposure of tambaqui to the three selected climate change scenarios promote an increase of DNA strand breaks in erythrocytes and severe changes in hematological parameters, plasmatic ion composition and branchial activity of Na+/K+-ATPase and H+-ATPase of tambaqui.
Keywords: global warming, Amazonia, DNA damage, ion composition
30
Introduction
The human society and the equilibrium of natural ecosystems have been
affected by climate changes caused especially by man (IPCC, 2014). To understand
the regional and global effects elicited by climate change and to provide information
for the development of adaptation and mitigation strategies, the scientists create
various climate scenarios based on the intensity of human activities causing
environmental degradation (Moss et al., 2010). Scenarios are plausible and relevant
descriptions about how the future might be, based on potential discharges of
greenhouse gases and aerosols into Earth’s atmosphere (Raskin et al., 2005).
According to the Fourth Assessment Report of the Intergovernmental Panel on
Climate Change (IPCC), three main scenarios of climate are foreseen for the year
2100: B1 (mild), A1B (intermediate) and A2 (extreme). These situations may vary
according to population growth, socioeconomic development and the use of fossil
fuels or renewable energy (IPCC, 2007).
Several studies have investigated the impact of climate change on water
ecosystems, specially increases of water temperatures (Brian et al., 2008; Booth et
al., 2014), changes in levels of dissolved gases (Miller et al., 2013; Dennis et al.,
2015), alterations of water flow regimes (Dall et al., 2010), and changes in
assemblage composition of fish (Last et al., 2011; Ter Hofstede et al., 2011;
Pletterbauer et al., 2014). The climate scenarios foreseen by the IPCC have been
used to preview responses of the marine and freshwater ecosystems to
environmental changes. The obtained results suggest that climate change will cause
severe disturbances such as impairing the distribution of species and fishery in
various countries (Brander, 2007; Last et al., 2011; Sharma et al., 2011).
Amazonia harbors the richest biodiversity on Earth with species that are still
unknown to the scientific community (Castello et al., 2013; Cheng et al., 2013). It is
also a massive source of heat and moisture in the tropics and has a crucial role in the
global climate system (Salazar and Nobre, 2010). Despite this, in last century it has
been subject to increasing anthropogenic environmental pressures, such as fires,
deforestation and growth of urban centers, occurring in connection with those
changes resulting from global warming (Nobre et al., 2007; Cheng et al., 2013).
Climate change substantially affects the Amazon region, which in turn is expected to
increase the risk of biodiversity loss considerably. Additionally, the hydrological cycle
of the Amazon rivers that is a major driving force of biological interactions have
31
experienced severe perturbations likely due climate change-driven processes, such
as the increase in temperature, changes in solar heat, and higher evapotranspiration
of plants (Roessig et al., 2004; Castello et al., 2013).
Climate change is considered foremost threats to aquatic ecosystems (Sala et
al., 2000). In both, marine and freshwater ecosystems, the climate change is
expected to modify various vital traits of aquatic organisms, such as growth,
metabolism, reproduction, species distribution, and even ecosystem structure (Ficke
et al., 2007; Brierley and Kingsford, 2009). The fishes are sensitive to environmental
modifications triggered by climate change due mainly to increases in water
temperature and variations in the concentrations of dissolved gases, especially
oxygen and carbon dioxide (CO2) (Ficke et al., 2007). Water temperature above of
thermal tolerance limit is known to cause many physiological changes in several fish
species, such as increased Na+/K+-ATPase activity in gills of Atlantic cod (Gadus
morhua) (Kreiss et al., 2015), DNA damage in goldfish (Carassius auratus) (Anitha et
al., 2000), modifications on gene expression in channel catfish (Ictalurus punctatus)
(Liu et al., 2013), metabolic alterations in Paralichthys lethostigma (Del Toro-Silva et
al., 2008), decreased growth rate in rainbow trout (Oncorhynchus mykiss) (Blair et
al., 2013) and increased mortality of cardinal tetra (Paracheirodon axelrodi) (Fé et al.
2013). The short-term exposure to increased PCO2 in water have also been shown to
cause physiological disturbances in salmonids, as hyperventilation (Janson and
Randall, 1975), reduced blood oxygen content (Eddy et al., 1977), lowered branchial
chloride influx rates (Goss et al., 1994) and chloride plasma concentration (Eddy et
al., 1977). Furthermore, at long-term exposure to high carbon dioxide levels in
freshwater, rainbow trout exhibited adverse sublethal effects on ion regulation,
lowered growth, reduced oxygen consumption and nephrocalcinosis (Smart et al.,
1979; Smart et al., 1981; Fivelstad et al., 1998).
Tambaqui (Colossoma macropomum) is a native fish species of the Amazon
basin found in rivers, lakes and floodplains (Junk et al., 2007). It is crucial to the local
economy, being the second most commonly raised fish in aquaculture in Brazil
(Brazil, 2012). It is widely known that tambaqui is one of most remarkable acidophilic
and hypoxia-tolerant fish species, displaying exceptional strategies on behavior and
morphology, as well as in their physiological and biochemical system, for living at
acidic and hypoxic waters of the Amazon (Val and Almeida-Val, 1995; Val and
Kapoor, 2003). In addition, tambaqui have also been considered tolerant to
32
hypercapnia conditions, exhibiting the typical responses of teleost fish to elevated
CO2 levels in the water (i.e. increased ventilatory frequencies and ventilation
amplitude, associated with pronounced bradycardia); however, the levels of CO2
required to trigger these physiological responses in tambaqui are quite higher than
those seen for salmonids (Gilmour and Perry, 1994; Reid et al., 2000; Florindo et al.,
2004).
To date, although tambaqui shows unique strategies to maintain their internal
homeostasis over a wide range of environmental challenges, there has been no
information regarding the effects of combined high temperature and CO2 levels in
water on their internal physiological responses. Therefore, the aim of the present
study was to investigate both the consequences of the exposure to three climate
change scenarios on hematology, plasma ionic composition and branchial ion
regulation enzymes (Na+/K+-ATPase and H+-ATPase) in Amazonian fish tambaqui,
and the potential effects of the simultaneous increment in temperature and CO2 to
cause DNA damage in erythrocytes of fish.
Materials and methods
Animals and rearing conditions
Juveniles of tambaqui weighting 15.5±1.9 g and measuring 8.3±0.3 cm (total
length) (mean ± SEM) were obtained from a local fish farm (Fazenda Tajá,
Amazonas, Brazil), and held in outdoors 500 L fiberglass tanks in the Laboratory of
Ecophysiology and Molecular Evolution (LEEM/INPA). They were acclimatized to
local well water ([Na+] = 31 µmol l-1, [K+] = 10 µmol l-1, [Cl-]= 30 µmol l-1, [Ca2+] = 9
µmol l-1, [Mg2+] = 4 µmol l-1, pH = 6.0, O2= 6.78 mg l-1, CO2= 8.25 ppm, temperature =
27oC) for at least one month prior the exposure to the selected experimental climate
change scenarios. No mortalities were observed during the acclimatization period.
The fishes were fed dry food pellets (Nutripeixe, Purina; 51% of total protein content)
ad libitum once a day during all experimental period, but feeding was suspended for
at least 48 h before starting the experiments. All experimental procedures followed
INPA’s animal care guidelines and were previously approved by the INPA’s Ethics
Committee on Animal Use (CEUA-INPA 056/2012).
Exposure to different climate change scenarios
Animals were exposed to four different environmental situations in
experimental rooms (microcosms), measuring 25m3 each. The characteristics of the
33
microcosms are described in details in Dragan et al. (in prep). Briefly, temperature,
carbon dioxide levels and humidity were measured every two minutes in a pristine
forest nearby the laboratory and radio-transmitted to the lab computers that set the
conditions to the control room (Table 1). The other three microcosms were designed
to simulate three future climate scenarios as foreseen by the Fourth Assessment
Report of the IPCC for the year 2100: mild scenario (B1) having a real-time
temperature adjusted to +1.5°C and +200 ppm CO2; intermediate scenario (A1B) with
+2.5°C and +400 ppm CO2; and the extreme scenario (A2) with +4.5°C and +850
ppm CO2 , all relative to control room.
Six PVC tanks (60 l each) containing 10 juveniles of tambaqui per tank, were
maintained in each of the microcosms for 150 days. Along the experiment, 30% of
the water was replaced every other day using environmentally stabilized water. The
fishes were transferred to each experimental microcosm (i.e. control and B1, A1B
and A2 scenarios) two days before to beginning the experiments. The pH, levels of
O2 and CO2 and water temperature were measured daily (Table 1).
Table 1. Physicochemical parameters of water and air in the microcosms (control,
B1, A1B, and A2) where the specimens of tambaqui were maintained for 150 days.
The data are reported as mean ± SEM (n= 6).
pH Water O2 (mg l-1)
Water CO2
(ppm)
Water temperature
(oC)
Enviromental CO2 (ppm)
Enviromental temperature
(oC) Control 5,8±0,1 7,0±0,1 15,5±0,4 26,0±0,1 478,6±0,2 28,0±0,01
B1 scenario
5,5±0,1 6,5±0,1 18,2±0,5 27,2±0,1 690,1±0,2 29,2±0,01
A1B scenario
5,5±0,1 6,2±0,1 20,0±0,3 28,3±0,2 898,3±0,2 30,4±0,01
A2 scenario
5,4±0,1 6,0±0,1 23,7±0,4 30,2±0,1 1325,9±0,2 32,4±0,01
One fish was removed from each tank at 0, 5, 15, 30, 60, 90, 120, and 150
days totally six fishes per scenario on each exposure time. After blood sampling, the
fishes were euthanized by rapidly severing their spinal cord with a scalpel, and a
sample of gills was collected for the experimental procedures determinations
described below.
34
Evaluation of genetic damage in erythrocytes
Comet assay. The assay was performed according to Singh et al. 1988 with
modifications. Firstly, a heparinized syringe was used to collect a blood sample from
the caudal vein from fishes. The blood was immediately transferred to an Eppendorf
tube with RPMI 1640 medium. Briefly, 5 µL of diluted blood were mixed with 95 µL of
0,75% (w/v) low melting agarose at 37oC and layered onto microscope slides
precoated with 1.5% (w/v) normal melting agarose and immediately covered with a
coverslip. After waiting 10 minutes to agarose solidify, the coverslips were removed
and slides were immersed in cold freshly made lysing solution (2.5 M NaCl, 10 mM
Tris, 100 mM EDTA, pH 10.2, 10% DMSO and 1% Triton X-100) and refrigerated at
4ºC for 2-24 hours. Slides were subsequently incubated in alkaline buffer (300 mM
NaOH and 1 mM EDTA, pH 13) for 20 min to allow DNA unwinding and horizontal
electrophoresis (300 mA and 25 V at 4oC) were performed. The steps described
above were carried out under indirect red light to avoid DNA damage. After
electrophoresis, the slides were washed three times with neutralizing buffer (0.4M
Tris, pH 7.5) during 5 min each time, then rinsed in distilled water, and left to dry
overnight at room temperature. The following step was the fixation of slides for 10
min (trichloroacetic acid 15% w/v, zinc sulfate 5% w/v, and glycerol 5% v/v), rinsing
three times with distilled water, and drying overnight at room temperature. Dried
slides were re-hydrated for 5 min in distilled water, and then submerged in silver
solution (5% sodium carbonate, 0.1% silver nitrate, 0.1% ammonia nitrate, 0.25%
acid tungstosilicic and 0.15% formaldehyde) to stain during 15 min at 37oC in water
bath. After stain, slides were cleaned with stop solution (acetic acid 1%) and rinsed
again in distilled water. After dried, slides were analyzed using an optical microscope
(Leica DM205) selecting randomly 100 cells from two replicate slides from each fish.
The cells were scored visually according to tail length into five classes, being class 0
undamaged and class 4 complete damage (comets with no heads), according to
Kobayashi et al. (1995). The DNA damage was evaluated according to two
parameters: Genetic Damage Indicator (GDI) and Cell DNA Integrity (CDI). The GDI
from each fish were calculated based on number of cells observed in each damage
class multiplied by arbitrary units in a scale of 0–400, according to respective
damage class: from zero (100 x 0 [100 undamaged cells]) to 400 (100 x 4 [100 cells
with maximum damage]). The CDI was calculated as mean of the number of cells
scored as class 0 in each group.
35
Physiological analyses
Blood parameters. From the total blood, both the hematocrit (Hct) and the total
content of haemoglobin in erythrocytes were measured immediately after collection.
Haemoglobin concentration (Hb) was measured spectrophotometrically in duplicate
using the Drabkin reagent. The red blood cell count (RBC) was performed in an
optical microscope (Leica DM205) with a conventional Neubauer hemocytometer,
and hematocrit (Hct) was determined after centrifugation of microhematocrit tubes
containing blood for 5 min at 10,000 g and percentage of red cell sedimentation was
determined using a microhematocrit reader card. The mean corpuscular volume
(MCV), mean corpuscular haemoglobin (MCH) and mean corpuscular haemoglobin
concentration (MCHC) were determined according to the equations described by
Brown et al. (1976).
Plasma ion concentrations. After determination of blood parameters, plasma
samples were separate by centrifugation for 5 min at 10,000 g. A portion of obtained
plasma was diluted 1000 times to measure Na+ and Cl- levels, and another portion
diluted 200 times in 0.2% lanthanum chloride was used to determine Ca2+, K+ and
Mg2+. The concentrations of Na+, K+, Ca2+ and Mg2+ were determined in duplicate
using a flame atomic absorption spectrophotometer (PerkinElmer, AAnalyst-800,
Singapore), while Cl- concentration was determined spectrophotometrically
(Spectramax Plus 384; Molecular Devices, Sunnyvale, CA) by the mercuric
thiocyanate method described by Zall et al. (1956).
Branchial Na+/K+-ATPase and H+-ATPase activity. The activities of both
Na+/K+-ATPase and H+-ATPase in gills of tambaqui were determined using the assay
described by Kültz and Somero (1995). The assay is based on the oxidation of
reduced NADH by the enzyme reaction coupled to the hydrolysis of ATP. Briefly,
frozen gill were homogenate in ice-cold SEID buffer (150 mM sucrose, 50 mM
imidazol, 10 mM EDTA, 0,5% Na-desoxycholate, pH 7.5) at 1:10 wet sample mass to
buffer volume. Crude homogenates were then centrifuged (4oC, 2000 g) for 10 min
and the supernatant was collected for enzymatic assay. The supernatant (5 µl) were
added to 12 wells of 96 well microplate and incubated in salt solution (30 mM
imidazol, 45 mM NaCl, 15 mM KCl, 3 mM MgCl2.6H2O, 0.4 mM KCN) on microplate
reader (Spectramax Plus 384; Molecular Devices, Sunnyvale, CA) at 27 and 33oC.
After 5 min, 200 µl of the reaction solution (1.0 mM ATP, 0.2 mM NADH, 0.1 mM
fructose 1,6 difosfate, 2 mM PEP, 3 IU ml-1 PK and 2 IU ml-1 LDH) were added to the
36
wells to start the assay. Four of twelve wells received reaction solution with 2 mM
ouabain, while crude homeganate in other four wells received reaction solution with 2
mM N-ethylmaleimide. The rate of NADH oxidation was monitored every 10 s over 10
min at 340 nm in each experimental temperature and pH conditions. The difference
in slope of NADH oxidation versus time reaction between reaction solution free of
inhibitors and containing the inhibitors (ouabain and N-ethylmaleimide) were used to
determine Na+/K+-ATPase and H+-ATPase activity, respectively. Both enzyme
activities were presented as µmol h-1 mgprotein-1. Protein concentration in gills crude
homogenates was determined using the Bradford method (Bradford, 1976).
Statistical analysis
All data are expressed as mean ± standard error of the mean (N=6; mean ±
SEM). Two-way ANOVA followed by Holm-Sidak multiple comparison test was used
to test significant differences in genetic damage of erythrocytes and physiological
endpoints between fish exposed to each climate change scenario, and also
throughout the exposure time. The two-way ANOVA was performed using Sigma Stat
software (Systat Software Inc., USA). Results were considered statistically significant
at P<0.05.
Results
Comet assay
Tambaqui exposed for 30 days to both intermediate (A1B) and extreme (A2)
climate change scenarios revealed a significantly higher amount of DNA damage in
erythrocytes, evidenced by an average of 1.8 times increase of GDI values, in
relation to fish in the control scenario at the same time of exposure (P<0.007) (Figure
1). Following 30 days of exposure, tambaqui exposed to the mild (B1), intermediate
(A1B) and extreme (A2) climate change scenarios presented 2.5, 2.1 and 1.9 times
higher GDI (P<0.005), respectively, than seen in fish at the respective treatment on
the beginning of the exposure period (T0) (Figure 1). No significant changes in the
erythrocytic DNA integrity were observed in tambaqui exposed to different climate
change scenario, throughout the entire time of exposure (Figure 2).
37
Fig. 1. Genetic Damage Indicator (GDI) in erythrocytes of tambaqui over the
experimental period of exposure to control, B1, A1B and A2 climate scenarios. The
data are reported as the mean ± SEM (n= 6). t Indicates significant difference
compared to control scenario on same exposure time (P<0.05). * Indicates significant
difference compared to time zero (P<0.05).
Time exposure (days)
0 5 15 30 60 90 120 150
GD
I va
lues
(0-4
00
)
0
50
100
150
200
250
300
Control B1 scenario A1B scenario A2 scenario
* * t t
t t
38
Fig. 2. Cell DNA Integrity (CDI) in erythrocytes of tambaqui over the experimental
period of exposure to control, B1, A1B and A2 climate scenarios. The data are
reported as the mean ± SEM (n= 6).
Blood parameters
A significant effect of exposure time at each climate change scenario on Hct,
Hb and RBC levels of tambaqui (P<0.001). Following 30 to 150 days of exposure,
tambaqui revealed a significantly increase in Hct (P<0.046) at control, intermediate
(A1B) and extreme (A2) climate change scenario (Table 2). Under mild scenario (B1),
Hct of tambaqui was significantly increased on average 1.3 times (P<0.028), but only
after 60, 120 and 150 days of exposure in relation to T0 (Table 2). Also, the Hb
concentration of fish exposed for 15 and 60 days to the control, B1, A1B and A2
scenarios was significantly increased (P<0.037). Following 90 days of exposure,
control tambaqui showed 1.5 times (P<0.04) increase in Hb concentration, whereas
fish at the extreme scenario (A2) displayed 1.6 times (P<0.021) higher content of Hb,
in relation to fish at T0 (Table 2).
Time exposure (days)
0 5 15 30 60 90 120 150
CD
I va
lue
s (%
)
0
20
40
60
80
100
Control B1 scenario A1B scenario A2 scenario
39
The RBC levels in tambaqui were significantly increased at an average of 1.4
times after 60 and 120 days of exposure to the control (P<0.033), and at an average
of 1.3 times in fish at intermediate scenario (A1B) after 30 and 120 days of exposure
(P<0.021), and at 90 days of exposure to A2 scenario (P<0.045) (Table 2).
Plasma ion concentrations
Tambaqui exposed for 5 days to the mild scenario (B1) exhibited Na+
concentration in plasma 1.2 times higher (P=0.02) than seen in fish at the same time
of exposure at the control scenario (Table 3). Within the analyzed climate change
scenario, plasma concentration of Na+ was significantly increased by 1.3 times
(P=0.001) and 1.2 times (P=0.006) only in tambaqui exposed to A1B scenario, after
15 and 150 days of exposure, respectively (Table 3). Regarding to plasma Cl- levels,
only minor effects were observed in fish as at 5 days under A2 scenario a significant
(P=0.015) increase of 1.2 times of Cl-, compared to control at the same time of
exposure (Table 3).
Fish exposed for 30 days to the mild scenario (B1) also showed 1.5 times
(P=0.005) increased K+ concentration in plasma in relation to animals under control
and 2.1 times after 30 days and 1.6 times after 60 days of exposure, in comparison
with animals at T0. Similarly, fish showed an increase at an average of 2 times of
plasma K+ following exposure to A1B scenario after 15 and 120 days (P<0.045),
which was also seen in tambaqui exposed to the extreme scenario (A2) after 30 and
90 days of exposure (P<0.01) (Table 3).
.
40
Table 2. Hematological parameters in tambaqui over the experimental exposure to the control, B1, A1B and A2 climate scenarios. The
data are reported as mean ± SEM (n= 6). t Indicates significant difference compared to control scenario on same exposure time
(P<0.05). * Indicates significant difference compared to time zero (P<0.05).
Hct (%) Hb (g dl-1) RBC (106mm-3) MCV (mm3) MCH (pg) MCHC (%)
Control scenario
0 day 20,33±3,27 5,56±1,41 1,72±0,19 121,52±18,89 37,00±12,62 28,05±7,37 5 days 21,33±2,32 5,76±1,04 1,70±0,26 131,56±10,51 40,94±13,12 29,14±6,75 15 days 23,67±1,38 8,29±1,34t 1,87±0,26 137,06±17,90 52,10±12,17 36,35±6,58 30 days 25,50±1,12t 7,46±0,96 2,19±0,16 118,01±4,91 35,30±5,19 29,50±3,86 60 days 30,67±1,80t 8,40±0,55t 2,52±0,13t 124,20±10,94 33,62±2,29 27,71±2,17 90 days 26,25±0,96t 8,12±0,70t 2,20±0,08 120,58±7,40 36,79±2,17 31,14±2,96 120 days 28,83±1,35t 6,36±0,21 2,29±0,15t 128,13±8,02 28,24±1,38 22,17±0,61 150 days 27,58±1,21t 6,25±0,60 1,98±0,17 145,06±15,40 31,58±1,69 23,07±2,86
B1 scenario
0 day 21,67±1,26 5,22±1,35 2,01±0,18 110,86±9,21 28,09±8,40 23,91±6,13 5 days 21,83±1,51 5,95±1,21 1,28±0,18t 178,61±12,08t* 49,14±10,17 27,17±5,12 15 days 23,83±0,48 8,43±1,23t 1,62±0,17 153,31±12,27 55,65±10,40 35,48±5,23 30 days 24,50±1,18 7,22±1,09 2,03±0,21 125,72±10,22 36,37±4,63 28,97±3,53 60 days 29,33±1,73t 8,14±0,56t 2,11±0,14 140,35±6,70 38,75±1,64 28,07±2,25 90 days 24,83±0,95 7,75±0,63 2,15±0,16 118,83±9,93 36,45±2,66 31,66±3,60 120 days 26,25±0,87t 5,87±0,43 2,28±0,16 116,80±5,80 25,80±1,14 22,34±1,46 150 days 28,50±0,87t 6,51±0,86 1,88±0,16 159,47±19,24t 34,38±2,95 22,85±2,70
A1B scenario
0 day 18,17±1,82 4,98±1,13 1,83±0,36 154,06±60,33 80,79±11,14 32,03±11,14 5 days 21,50±0,89 5,50±1,03 1,54±0,17 146,01±12,02 37,83±4,15 25,21±4,15 15 days 23,50±1,15t 8,30±1,10t 1,66±0,18 146,19±8,59 55,43±5,47 36,42±5,47 30 days 28,83±0,98t 6,82±0,98 2,54±0,26t 118,75±10,68 29,01±3,66 23,86±3,66 60 days 28,00±1,67t 8,11±1,67t 2,02±0,10 139,71±7,62 40,15±2,73 29,47±2,73 90 days 28,42±0,84t 8,65±0,84t 2,24±0,10 128,18±5,87 38,81±1,70 30,39±1,70 120 days 28,25±1,03t 6,96±1,03 2,44±0,18t 117,62±5,29 29,37±1,08 24,78±1,08 150 days 26,67±1,30t 6,87±1,30 1,99±0,21 138,64±9,82 34,67±2,11 25,63±2,11
A2 scenario
0 day 22,67±1,87 5,61±1,45 1,88±0,14 122,07±9,51 31,15±8,35 24,91±6,23 5 days 20,83±1,30 5,35±1,01 1,66±0,29 146,54±25,21 34,45±5,19 25,23±4,24 15 days 23,83±1,51 8,58±1,16t 1,78±0,24 141,31±12,35 53,96±10,45 36,38±5,05 30 days 26,83±1,51t 6,54±1,07 2,20±0,11 123,36±9,70 30,44±5,56 25,20±4,84 60 days 30,17±2,20t 8,56±0,66t 2,38±9,70 127,25±9,42 36,24±3,07 29,12±3,20 90 days 28,50±1,34t 8,65±0,40t 2,41±9,42t 121,45±9,99 37,15±3,61 30,76±2,16 120 days 28,75±0,72t 6,16±0,32 2,35±9,99 124,52±5,89 26,44±0,69 21,39±0,80 150 days 27,08±1,21t 6,75±0,69 1,97±5,89 138,67±6,73 34,46±3,58 24,82±2,19
41
Table 3. Ion plasma concentration (mEq l-1) in tambaqui over the experimental exposure to control, B1, A1B and A2 climate scenarios.
The data are reported as the mean ± SEM (n= 6). t Indicates significant difference compared to control scenario on same exposure time
(P<0.05). * Indicates significant difference compared to time zero (P<0.05).
[Na+] [K+] [Cl-] [Ca2+] [Mg2+]
Control scenario
0 day 169,62±6,01 4,25±0,28 142,35±2,09 1,22±0,04 0,79±0,03 5 days 162,98±8,45 4,70±0,51 140,30±3,81 1,00±0,14 0,39±0,02t 15 days 176,27±4,81 7,50±1,34t 155,08±3,00 1,30±0,14 0,49±0,03t 30 days 170,23±7,03 7,14±0,90t 145,36±6,48 1,24±0,08 0,43±0,03t 60 days 157,65±4,68 8,83±0,94t 139,51±3,36 1,15±0,08 0,47±0,03t 90 days 168,02±3,78 5,80±0,38 145,19±2,10 1,07±0,13 0,44±0,04t 120 days 184,37±5,16 6,42±0,60 147,63±3,99 1,46±0,13 0,50±0,04t 150 days 159,55±13,35 5,32±0,80 126,67±7,22 1,15±0,09 0,48±0,04t
B1 scenario
0 day 158,13±6,00 5,12±0,52 146,26±6,65 1,48±0,08 0,91±0,04* 5 days 190,65±17,42t* 6,52±2,78 157,85±11,85 1,38±0,44* 0,37±0,04t 15 days 179,73±6,03 6,17±0,99 161,31±4,94 1,19±0,04 0,37±0,03t* 30 days 169,08±8,60 10,58±0,79t* 139,51±5,65 1,15±0,06 0,41±0,03t 60 days 157,72±11,02 8,37±0,39t 137,23±8,00 0,98±0,09t 0,37±0,03t 90 days 169,80±5,25 7,31±0,36 143,40±3,10 0,98±0,13t 0,37±0,03t 120 days 170,08±5,95 6,23±1.36 137,55±4,68 1,22±0,20 0,46±0,05t 150 days 166,23±15,23 4,32±0,36 140,56±11,38 1,03±0,07t 0,45±0,02t
A1B scenario
0 day 148,53±7,80 3,74±0,74 134,77±6,27 1,38±0,19 0,77±0,06 5 days 96,67±20,94 5,93±0,46 151,31±5,27 1.24±0,10 0,51±0,04t* 15 days 189,72±9,31t 6,24±0,98t 158,35±5,87t 1,30±0,17 0,47±0,09t 30 days 169,83±2,67 9,38±0,85t 140,65±2,34 1,08±0,12 0,38±0,04t 60 days 155,72±7,11 8,20±0,79t 125,21±14,61 0,77±0,09t* 0,39±0,03t 90 days 157,19±12,12 6,95±0,84t 134,47±9,66 1,07±0,11 0,45±0,03t 120 days 162,88±7,68 6,19±0,61t 132,03±6,06 1,03±0,08* 0,43±0,02t 150 days 181,60±8,17t 4,29±0,62 141,13±5,06 1,13±0,12 0,45±0,03t
A2 scenario
0 day 169,57±11,14 3,72±0,37 149,75±8,02 1,90±0,15* 0,42±0,04* 5 days 174,58±8,68 4,12±0,52 162,58±3,49* 1,16±0,09t 0,46±0,04 15 days 192,22±8,23 5,82±0,61 158,19±4,51 1,22±0,06t 0,43±0,03 30 days 159,82±3,06 7,92±0,70t 137,23±1,53 1,19±0,12t 0,36±0,03 60 days 153,47±8,09 7,09±0,65t 133,98±5,89 0,95±0,09t 0,47±0,01 90 days 173,80±2,81 6,86±0,22t 138,53±2,13 0,94±0,09t 0,46±0,03 120 days 165,63±5,02 5,77±0,35 134,15±2,84 1,27±0,10t 0,47±0,04 150 days 161,82±7,39 4,95±0,24 136,75±8,56 1,38±0,05t 0,52±0,01
42
Interestingly, there was a significant imbalance in the concentration of divalent
cations in plasma of tambaqui exposed to the different climate change scenarios. At
both mild (B1) and extreme (A2) scenarios, tambaqui exhibited plasma Ca2+
concentration increased by 1.4 times after 5 days (P=0.046), and 1.6 times at the T0
(P<0.001), respectively; whereas in fish exposed for 60 and 120 days to the
intermediate scenario (A1B), the Ca2+ concentration was at an average of 0.7 times
reduced (P<0.048), in comparison with animals at the same time of exposure at the
control scenario. In fish exposed to the control climate scenario, B1 and A1B the
concentration of Mg2+ in plasma was significantly lowered by an average of 0.7 times,
1.3 time and 0.8 times, respectively (P<0.001), in relation to T0 under the respective
analyzed scenario (Table 3). In addition, plasma Mg2+ concentration was also
significantly reduced by 0.8 times (P<0.001) in tambaqui exposed to the A2 scenario
at T0, and by 0.3 times (P=0.025) at B1 scenario after 15 days, when compared with
animals under the control scenario at the same time of exposure (Table 3).
Branchial Na+/K+-ATPase and H+-ATPase activity
In comparison with fish at the control scenario, tambaqui revealed a
stimulation in the activity of Na+/K+-ATPase (NKA) in gills by 1.7 times (P=0.014) and
3.2 times (P<0.001) at B1 scenario after 5 and 30 days, respectively, while an
increase in an average of 1.3 times (P<0.016) in NKA activity was seen in fish
exposed for 30 and 150 days to A1B scenario (Figure 3). In contrast, fish exposed to
A1B scenario showed inhibition of NKA activity by 1.2 times at T0 (P=0.039) and 1.9
times after 15 days of exposure (P=0.031) (Figure 3).
43
Fig. 3. Na+/K+-ATPase activity in the gills of tambaqui over the experimental period of
exposure to the control, B1, A1B and A2 climate scenarios. The data are reported as
the mean ± SEM (n= 6). t Indicates significant difference compared to control
scenario on same exposure time (P<0.05). * Indicates significant difference
compared to time zero (P<0.05).
Overall, NKA activity in gills of tambaqui was significantly increased over the
exposure period to each climate change scenarios (B1, A1B and A2). Fish exposed
to both B1 and A1B scenarios exhibited NKA activity increased at an average of 3.0
times and 2.9 times (P<0.001) following 30, 90, 120 and 150 days of exposure,
whereas NKA activity was also significantly increased in gills of fish after 5 days of
exposure to mild scenario (B1). Similarly, at the extreme scenario (A2), the activity of
NKA was also increased, but only at an average of 2.2 times (P<0.016) after 5, 15,
90 and 120 days of exposure (Figure 3).
Instead, fish exposed to both A1B and A2 scenarios showed inhibition of H+-
ATPase activity in gills by 4.9 times and 2.9 times after 5 days (P<0.001), by 5.9
times and 7.1 times after 15 days (P<0.005), by 3.2 times and 4.7 times after 120
Time exposure (days)
0 5 15 30 60 90 120 150
AT
Pase
act
ivity
(µ
mo
l AT
P h-1
mg p
rote
in-1
)
0.0
0.5
1.0
1.5
2.0
2.5
3.0
Control B1 scenario A1B scenario A2 scenario
* * t
t
t
t
t
t
t
t
t t
t
t
t
t
t
t
t
*
*
*
*
*
44
days (P<0.001) and by 1.6 times and 2.8 times after 150 days of exposure
(P<0.032), respectively (Figure 4). Similarly, in tambaqui at mild scenario (B1), the
activity of H+-ATPase was significantly inhibited by 2.3 times and 2.6 times (P<0.005)
after 120 and 150 days of exposure (Figure 4). Interestingly, 60 days of exposure to
both B1 and A1B scenario markedly inhibit H+-ATPase in gills of tambaqui, as seen
by 20.3 times and 29.9 times inhibition of H+-ATPase activity in comparison with fish
at the control scenario (Figure 4).
Fig. 4. H+-ATPase activity in the gills of tambaqui over the experimental period of
exposure to the control, B1, A1B and A2 climate scenarios. The data are reported as
the mean ± SEM (n= 6). t Indicates significant difference compared to control
scenario on same exposure time (P<0.05). * Indicates significant difference
compared to time zero (P<0.05).
Time exposure (days)
0 5 15 30 60 90 120 150
AT
Pase
act
ivity
(µ
mol A
TP
h-1 m
g p
rote
in-1)
0
1
2
3
4
5
6
Control B1 scenario A1B scenario A2 scenario
*
t
t
t
t t
t
t
t t
t
t
t
t
t
t
t t
t
t
t t
t
t t
*
*
*
*
*
*
*
* *
*
*
*
* *
45
The comparison within each analyzed climate change scenario evidenced that
the time of exposure significantly affects the activity of H+-ATPase in gills of
tambaqui. At mild scenario (B1), a significant inhibition of 4.5 times, 8.3 times and 2.2
times in H+-ATPase activity (P<0.001) was seen in gills of fish following 15 days, 30
days and 120 days, respectively (Figure 4). Interestingly, 60 days of exposure to both
B1 and A1B scenarios promote an almost complete inhibition of branchial H+-ATPase
activity in tambaqui (P<0.001). In addition, fish exposed to intermediate scenario
(A1B) also showed H+-ATPase activity inhibited by 6.5 times, 14.3 times, 4.8 times,
2.1 times, 4.1 times and 3.4 times after 5, 15, 30, 90, 120 and 150 days of exposure
(P<0.001), respectively. At the extreme scenario (A2), H+-ATPase activity in gills of
tambaqui was inhibited at an average of 11.9 times over the exposure time, in
comparison with fish at T0 (Figure 4).
Discussion
To understand how organisms are responding to climate change is important
to protect the planet against consequences triggered by global warming (Cheng et
al., 2013). Climate change imperils all environments, being the greatest threat to the
aquatic biodiversity (IPCC, 2007; 2014), once water temperature is one of the major
abiotic factors that influences most activities of aquatic organisms, such as growth,
reproduction, migration, behavior and feeding (Portner and Farrell, 2008). Indeed,
increased temperature is being considered a significant threat to the aquatic fauna,
as well as to the ecological balance of ecosystems, once the risk of loss of genetic
variability in wild populations might have significant consequences for the long-term
survival of exposed populations (Buschini et al., 2003; Long et al., 2012).
In the present study, we evaluate physiological responses of tambaqui to three
climate change scenarios foreseen by the IPCC for 2100. Since it is well established
that marked changes in water temperature and CO2 levels will directly affect the
integrity and functions of erythrocytes in fish, comet assay was used to investigate
the potential genotoxic effect of the climates scenarios tested on the erythrocytes of
tambaqui. Our results showed a significant increase of DNA strand breaks after 30
days of exposure to all experimental climate scenarios. In erythrocytes of goldfish
(Carassius aurata), the higher the water temperature the higher the DNA damage,
evidencing the high mutagenic effect of increased temperature (Anitha et al., 2000;
Buschini et al., 2003). Similarly, DNA damage has been related to increased CO2
46
levels, as seen by Montalto et al. (2013). Usually, increased DNA damage,
evidenced by the comet assay, is positively correlated with a pro-oxidant state inside
the cells, which is achieved when the increment in the generation of reactive oxygen
species (ROS) overload the intracellular antioxidant defenses (Abele and Puntarulo,
2004). If this DNA lesion is not repaired rapidly, it can start a cascade of biological
events that might compromise the survival of the cell, resulting in apoptosis and cell
death. DNA damage in a number of aquatic organisms has triggered abnormal
development, reduced growth, and committed survival of embryos, larvae and adults
(Simoniello et al., 2009; Kienzler et al., 2013).
However, the decrease in DNA damage, particularly after 60 days of
exposure, might indicate the ability of repair mechanisms of DNA lesions, loss of
severely damaged cells, or both mechanisms (Mitchelmore and Chipman, 1998;
Kienzler et al., 2013). Another plausible explanation for the reduction in formation of
DNA strand breaks in erythrocytes of tambaqui might be the activation of genes
related to temperature acclimation, such as heat shock proteins (HSPs), which are
known to mediate the repair and degradation of altered proteins, including cellular
structures damaged by high temperatures (Anitha et al., 2000; Basu et al., 2002;
Roessig et al., 2004). These effects correlate well with the data from a parallel study
performed in the same facility, where the expression of genes from both Hsp 40 and
Hsp 90 families were up-regulated in tambaqui exposed to same climate change
scenarios (Prado-Lima and Val, 2016).
In the present study, the hematological parameters of tambaqui were slightly
affected by climate change exposure. However, within the various analyzed climate
change scenarios, tambaqui exhibited a marked trend to increase the Hct, Hb and
RBC levels, especially between 30 and 150 days of exposure. Alterations in
hematological parameters of freshwater fish are recognized to have strong effects on
oxygen transfer, being continuously adjusted under both physiological and
environmental constraints (Val, 1995; Val and Almeida-Val, 1995; Tavares-Dias and
Moraes, 2004). In the Atlantic salmon parr, long-term exposure to increased CO2
levels promoted a significant decrease in Hct and MCV, and also increased Hb
concentration inside the erythrocytes (MCHC), suggesting a strong erythrocyte
shrinkage in fish (Fivelstad et al., 2007). However, in this fish species acclimated to
freshwater condition, the effects of increased CO2 levels were lowered at higher
temperature condition (Fivelstad et al., 2007). In contrast, the enhanced levels of Hct,
47
Hb and RBC of tambaqui exposed to the various climate change scenarios were
similar to those responses previously reported by Val (1995), when tambaqui was
exposed to hypoxic, or even anoxic, conditions. In elevated temperature conditions,
as simulated in this study, the metabolism of ectothermic organisms is up-regulated
to face the increased demand for oxygen in tissues. Thus, it is likely that under
simultaneous increases in temperature and CO2 levels the number of erythrocytes is
increased to compensate for impairment in oxygen delivery to tissues.
The concentration of monovalent ions in plasma of tambaqui was slightly
affected by the simultaneous exposure to increased temperature and CO2 levels. In
general, there is a strong relationship between the concentration of the primary
plasma ions and the magnitude of the branchial and extra-branchial ion losses in fish
(Wood, 1989; Wood et al., 1998). The short-term exposure to the gradual increment
in water temperature resulted in enhanced net losses of Na+ and Cl- in Metynnis
hypsauchen, an Amazonian fish species from the Serrasalmidae family, which was
associated with an increase of branchial permeability to ions mediated by
temperature. In contrast, in the Amazonian fish Pterygoplychthys pardalis, the
exposure to high PCO2 levels in water resulted in significant reduction in net losses of
Na+ and Cl- (Brauner et al., 2004), suggesting that under hypercapnia conditions the
permeability of branchial membrane might be regulated to reduce ionoregulatory
disturbances associated with Na+ and Cl- homeostasis.
Surprisingly, plasma Cl- concentration in tambaqui was slightly, but
significantly, increased following 5 days of exposure to the extreme scenario (A2),
and also after 15 days to the intermediate scenario (A1B) in comparison with fish at
T0. In contrast, many previous studies have demonstrated a decline of plasma Cl-
levels of freshwater fish after short- and long-term exposure to high PCO2 levels,
which is strongly related to an equivalent increase in plasma bicarbonate
concentration, as a physiological response to compensate the elevation in the blood
PCO2 (Heisler, 1984; Fivelstad et al., 1998; Fivelstad et al., 2003; Fivelstad et al.,
2015). Thus, adjustments in both bicarbonate and Cl- levels seems to be the
predominant mechanism for the extracellular pH regulation in fish, particularly in
those environmental conditions, as increased temperature and hypercapnia, which
are expected to promote acid-base disturbances in animals (Heisler, 1984). Although
most of the studied fish species show a preferential extracellular regulation to
maintain their internal acid-base homeostasis under internal acidosis promoted by
48
hypercapnia (Brauner et al., 2004), the Amazonian fish P. pardalis exhibited a
preferential intracellular regulation of pH to compensate marked acid-base
disturbances (Harter et al., 2014). In this fish species, both the extracellular pH and
blood levels of HCO3- were reduced after internal acidosis induced by the exposure
to anoxic condition, which was tightly associate with the reduction in intracellular pH
of RBC. Indeed, it suggests that blood bicarbonate is intracellularly transported,
perhaps by a Cl-/HCO3- exchange, to buffer the elevation in intracellular H+ levels,
resulting in higher intracellular PCO2 and, consequently, increased levels of plasma
Cl-. Although our data suggest that tambaqui exposed to the analyzed climate
change scenarios might maintain their plasma Cl- levels to preferentially regulate the
intracellular pH, in detriment of the extracellular pH, as a compensatory response to
acid-base disturbances, these mechanisms requires further investigation.
Interestingly, plasma K+ levels were also increased after 30 days of exposure
to the mild scenario (B1), while within the analyzed scenarios, the concentration of
plasma K+ was also enhanced in tambaqui exposed to B1 (30 to 60 days), A1B (15 to
120 days) and A2 (30 to 90 days), in comparison with fish at T0. Increased plasma
K+ levels of fish have been related to disturbances of the membrane integrity of
erythrocytes, implying in a marked red blood cell disruption. Thus, we suggest that
such an increase in plasma K+ levels of tambaqui is related to red blood cells swelling
induced by climate change exposure (see discussion above). Although tambaqui
exhibited a slight increase in plasma Ca2+ levels after 5 days of exposure to mild
scenario (B1), and at T0 in the extreme scenario (A2), a general trend of reduction in
Ca2+ concentration in plasma was observed within the analyzed scenarios. Similarly,
at B1 and A1B scenarios a significant reduction in plasma Mg2+ levels of tambaqui
was seen over the exposure period. Reduction of plasma levels of divalent cations
(Ca2+ and Mg2+) have been associated with depletions in several fundamental
biological process as transmembrane ion leakage, electrical activity of cells and
protein synthesis, as well as to decreased buffering capacity of extracellular fluids in
aquatic organism, as turtles (Johnson et al., 2000) and fish (Heisler, 1984)
experiencing internal acidosis. One possible explanation for the reduction of plasma
Ca2+ and Mg2+levels of tambaqui exposed to climates change scenarios is its
complexation with lactate molecules, which have been shown to be enhanced in
blood in fish under short term and prolonged conditions of acidosis (Heisler, 1984;
Harter et al., 2014). Although our data suggest that the concentration of plasma
49
divalent ions of tambaqui is down-regulated as a consequence of uncompensated
extracellular acidosis induced by the simultaneous increase in temperature and CO2
levels, additional evidence regarding these exact mechanisms certainly needs further
investigations.
Short- and long-term changes in water quality properties have been
recognized to modulate the entire functional capacity of gills of freshwater fish,
particularly through alterations of active transport of ions from the surrounding water
to blood, to maintain their internal ion homeostasis (Hwang et al., 2011). In gills of the
freshwater teleost, the mechanisms for Na+ uptake are tightly coupled to excretion of
acid products from the intermediate metabolism (e.g. H+ and NH4+), and a central role
of both Na+/K+-ATPase and H+-ATPase in the maintenance of the required gradient
that drives Na+ uptake in fish have been proposed (Kirschner, 2004; Evans et al.,
2005). However, changes in the activity of both enzymes have been found in gills of
freshwater fish under short- and long-term exposures to increased temperature and
hypercapnia conditions (Metz et al., 2003; Fivelstad et al., 2007). In our study,
significant increases in the activity of Na+/K+-ATPase were seen in tambaqui after 5
and 30 days of exposure to the mild scenario (B1), as well as in fish exposed for 30
and 150 days to the intermediate scenario (A1B). Also, increased H+-ATPase activity
was only found in gills of tambaqui exposed to both B1 (5 and 90 days) and A1B (T0)
scenarios. Enhanced activity of ATPases in gills of fish exposed to increased
temperature has been reported for rainbow trout (Pfeiler, 1978) and goldfish (Murphy
and Houston, 1974), as a compensatory response to increased branchial
permeability to Na+ mediated by temperature. Furthermore, at elevated CO2
conditions, the hydration of CO2 in the intracellular compartment is thought to provide
acid products (H+) that would be the primary source of the electrogenic proton pump
activity (Randall et al., 1996). However, inhibition of both enzymes was markedly
more evident in gills of tambaqui exposed to the three analyzed climate change
scenarios. In these animals, the activity of Na+/K+-ATPase had a tendency to
decrease within the first 30 days of exposure to both B1 and A1B scenarios, while
only after 150 days under the extreme scenario (A2) the activity of Na+/K+-ATPase
was significantly reduced. In contrast, short-term (5 to 15 days) exposure to
intermediate (A1B) and extreme scenarios (A2) causes a marked inhibition of H+-
ATPase in gills of tambaqui. Note that long-term reduction in H+-ATPase was found
in all three analyzed scenarios, particularly after 120 and 150 days of exposure to
50
both A1B and A2 scenario. Increases in environmental temperature could affect
cellular lipid composition of fish gills, inhibiting the activity of membrane-bound
ATPase as a result of thermo-instability of proteins of the branchial membrane (Hazel
and Prosser, 1974; Metz et al., 2003). It has also been demonstrated that a moderate
to high hypercapnia conditions decrease the activity of Na+/K+-ATPase, but not H+-
ATPase in gills of the Atlantic cod (Gadus morhua) at different temperature regimes.
Overall, our data indicate that climate change exposure might promote an imbalance
in the activity of key enzymes for ion regulation in gills of tambaqui, adversely
affecting the generation of the electrochemical gradients that serves as the driving
force for Na+ uptake in the gills of this fish species that otherwise thrives poor ion
waters.
In conclusion, the exposure for 150 days to the three analyzed climate change
scenarios promote severe changes in hematological parameters, plasma ionic
composition and branchial activity of Na+/K+-ATPase and H+-ATPase of tambaqui.
However, a relationship between the degree of alteration and analyzed scenarios
(B1, A1B, and A2) was not evident. Tambaqui exhibited a marked trend to increase
the Hct, Hb and RBC levels in order to compensate for an impairment in oxygen
delivery to tissues. While only minor effects on plasma levels of both Na+ and Cl-
were seen in tambaqui, the exposure to the climate scenarios tends to increase K+
concentration and strongly reduce the plasma levels of Ca2+ and Mg2+. The severity
of the analyzed climate scenarios caused an apparent inhibition of both Na+/K+-
ATPase and H+-ATPase activity in tambaqui, which affect ion homeostasis of fish
under a longer time of exposure. Furthermore, it is noteworthy that the analyzed
climate change scenarios were genotoxic to fish, suggesting that climate change
might adversely act as inducers of DNA damage in erythrocytes of tambaqui.
Funding
This work was supported by Brazilian National Research Council (CNPq:
573976/2008-2) and the Amazon State Research Foundation (FAPEAM: 3159/08)
through the INCT-ADAPTA; M.P.L. was a recipient of a Ph.D. fellowship from
CAPES; A.L.V. is a recipient of a research fellowship from CNPq.
51
Acknowledgements
We thank Dra. Alzira Miranda de Oliveira, MSc. Fernanda Dragan and MSc.
Maria de Nazaré Paula da Silva for all the contributions during the experiments and
lab assistances, and also to Jéssica Lima and Aldiane Passos.
References
Abele, D., Puntarulo, S., 2004. Formation of reactive species and induction of
antioxidant defense systems in polar and temperate marine invertebrates and
fish. Comparative Biochemistry Physiology A 138, 405–415.
Anitha, B., Chandra, N., Gopinath, P.M., Durairaj, G., 2000. Genotoxicity evaluation
of heat shock in gold fish (Carassius auratus). Mutat. Res. 469, 1–8.
Basu, N., Todgham, A.E., Ackerman, P.A., Bibeau, M.R., Nakano, K., Schulte, P.M.,
Iwama, G.K., 2002. Heat shock protein genes and their functional significance in
fish. Gene 295, 173–183.
Blair, J.M., Ostrovsky, I., Hicks, B.J., Pitkethley, R.J., Scholes, P., 2013. Growth of
rainbow trout (Oncorhynchus mykiss) in warm-temperate lakes: implications for
environmental change. Can. J. Fish. Aquat. Sci. 70, 815–823.
doi:dx.doi.org/10.1139/cjfas-2012-0409.
Booth, D.J., Poulos, D.E., Poole, J., Feary, D.A., 2014. Growth and temperature
relationships for juvenile fish species in seagrass beds: Implications of climate
change. J. Fish Biol. 84, 231–236. doi:10.1111/jfb.12255.
Bradford, M.M., 1976. A rapid and sensitive method for the quantitation of microgram
quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem.
72, 248–254.
Brander, K.M., 2007. Global fish production and climate change. Proc. Natl. Acad.
Sci. USA. 104, 19709–19714. doi:10.1073/pnas.0702059104.
Brauner C. J., Wang, T., Wang, Y., Richards, J.G., Gonzalez, R.J., Bernier, N.J., Xi,
W., Patrick. A., Val, A.L., 2004. Limited extracellular but complete intracellular
acid-base regulation during short-term environmental hypercapnia in the
armoured catfish, Liposarcus pardalis. Journal of Experimental Biology 207(19),
3381–3390.
Brazil. Boletim Estatístico da Pesca e Aquicultura: Brasil 2011. Brasília; 2012.
Available: http://www.mpa.gov.br/files/docs/Boletim_MPA_2011_pub.pdf.
Accessed 2015 Sep 02.
52
Brian, J.V., Harris, C.A., Runnalls, T.J., Fantinati, A., Pojana, G., Marcomini, A.,
Booy, P., Lamoree, M., Kortenkamp, A., Sumpter, J.P., 2008. Evidence of
temperature-dependent effects on the estrogenic response of fish: Implications
with regard to climate change. Sci. Total Environ. 397, 72–81.
doi:10.1016/j.scitotenv.2008.02.036.
Brierley, A.S., Kingsford, M.J., 2009. Impacts of Climate Change on Marine
Organisms and Ecosystems. Curr. Biol.19, R602–R614.
Brown, B.A., 1976. Hematology: principles and procedures. 2nd ed. Philadelphia:
Lea & Febiger.
Buschini, A., Carboni, P., Martino, A., Poli, P., Rossi, C., 2003. Effects of temperature
on baseline and genotoxicant-induced DNA damage in haemocytes of Dreissena
polymorpha. Mutat. Res. Toxicol. Environ. Mutagen. 537, 81–92.
Castello, L., Mcgrath, D.G., Hess, L.L., Coe, M.T., Lefebvre, P. a., Petry, P., Macedo,
M.N., Renó, V.F., Arantes, C.C., 2013. The vulnerability of Amazon freshwater
ecosystems. Conserv. Lett. 6, 217–229. doi:10.1111/conl.12008.
Cheng, H., Sinha, A., Cruz, F.W., Wang, X., Edwards, R.L., d’Horta, F.M., Ribas,
C.C., Vuille, M., Stott, L.D., Auler, A.S., 2013. Climate change patterns in
Amazonia and biodiversity. Nat. Commun. 4, 1411.
Däll, P., Zhang, J., 2010. Impact of climate change on freshwater ecosystems: A
global-scale analysis of ecologically relevant river flow alterations. Hydrol. Earth
Syst. Sci. 14, 783–799. doi:10.5194/hess-14-783-2010.
Del Toro-Silva, F.M., Miller, J.M., Taylor, J.C., Ellis, T.A., 2008. Influence of oxygen
and temperature on growth and metabolic performance of Paralichthys
lethostigma (Pleuronectiformes: Paralichthyidae). J. Exp. Mar. Bio. Ecol. 358,
113–123.
Dennis, C.E., Kates, D.F., Noatch, M.R., Suski, C.D., 2015. Molecular responses of
fishes to elevated carbon dioxide. Comp. Biochem. Physiol. Part A Mol. Integr.
Physiol. 187, 224–231.
Evans, D.H., Piermarini, P.M., Choe, K.P., 2005. The multifunctional fish gill:
dominant site of gas exchange, osmoregulation, acid-base regulation, and
excretion nitrogenous waste. Physiological Review 85, 97-177.
Eddy, F.B., Lomholt, J.B., Weber, J.P., Weber, R.E., Johanson, K., 1977. Blood
respiratory properties of rainbow trout kept in water of high CO2 tension. Journal
of Experimental biology 67, 37-47.
53
Fé, L.M.L. Expressão gênica e atividade enzimática da L-Lactato Desidrogenase
(LDH) de Paracheirodon axeroldi (Shultz 1956) e Paracheirodon simulans (Géry
1963) expostos aos cenários climáticos previstos pelo IPCC para o ano 2100.
Dissertação de mestrado, Instituto Nacinal de Pesquisas dda Amazônia,
Manaus, AM. 74p.
Ficke, A.D., Myrick, C.A., Hansen, L.J., 2007. Potential impacts of global climate
change on freshwater fisheries. Rev. Fish Biol. Fish. 17, 581–613.
Fivelstad, S., Haavik, H., Lovik, G., Olsen A.B., 1998. Sublethal effects and safe
levels of carbon dioxide in seawater for Atlantic salmon posts molts (Salmo salar
L.): ion regulation and growth. Aquaculture 160, 305–316.
Fivelstad, S., Olsen, A., Asgard, T., Baeverfjord, G., Rasmussen, T., Vindheim, T.,
Stefansson, S.O., 2003. Long-term sub-lethal effects of carbon dioxide on
Atlantic salmon smolts: ion regulation, haematology, element composition,
nephrocalcinosis and growth parameters. Aquaculture 215, 301–319.
Fivelstad, S., Waagb, R., Stefansson, S., Olsen, A.B., 2007. Impacts of elevated
water carbon dioxide partial pressure at two temperatures on Atlantic salmon
(Salmo salar L.) parr growth and haematology. Aquaculture 269, 241–249.
Fivelstad, S., Wagbo, R., Olsen, A.B., Stefansson, S., 2007. Impacts of elevated
water carbon dioxide partial pressure at two temperatures on Atlantic salmon
(Salmo salar L.) parr growth and haematology. Aquaculture 269, 241–249.
Fivelstad, S., Kvamme, K., Handeland, S., Fivelstad, M., Olsen, A.B., Hosfeld, C.D.,
2015. Growth and physiological models for Atlantic salmon (Salmo salar L.) parr
exposed to elevated carbon dioxide concentrations at high temperature.
Aquaculture 436, 90–94.
Florindo, L.H., Reid, S.G., Kalinin, A.L, Milsom, W.K., Rantin, F.T., 2004.
Cardiorespiratory reflexes and aquatic surface respiration in the neotropical fish
tambaqui (Colossoma macropomum): acute responses to hypercarbia. Journal
of Comparative Physiology B 174, 319–328.
Goss, G.G., Laurent, P., Perry, S.F., 1994. Gill morphology during hypercapnia in
brown bullhead Ictalurus nebulosus: role of chloride cells and pavement cells in
acid–base regulation. Journal of Fish Biology 45, 705–718.
Gilmour, K.M., Perry, S.F., 1994. The effect of hypoxia, hyperoxia or hypercapnia on
the acid–base disequilibrium in the arterial blood of rainbow trout. Journal of
Experimental Biology 192, 269-284.
54
Harter, T.S., Shartau, R.B., Baker, D.W., Jackson, D.C., Val, A.L., Brauner, C.J.,
2014. Preferential intracellular pH regulation represents a general pattern of pH
homeostasis during acid–base disturbances in the armoured catfish,
Pterygoplichthys pardalis. Journal of Comparative Physiology B 184(6), 709-718.
Hazel J.R.; Prosser C.L., 1974. Molecular mechanisms of temperature compensation
in poikilotherms. Physiological Reviews 54, 620-668.
Heisler, N. 1984. Acid-base regulation in fishes. In: Hoar, W.S., Randall, D.J. (Eds.),
Fish Physiology, vol. XA. Academic Press, New York, pp. 315–399.
Hwang, P.P., Tsung-Han, L., Li-Yih, L., 2011. Ion regulation in fish gills: recent
progress in the cellular and molecular mechanisms. American Journal of
Physiology-Regulatory Integrative and Comparative Physiology 301, 28-47.
IPCC, 2007. Contribution of Working Groups I, II and III to the Fourth Assessment
Report of the Intergovernmental Panel on Climate Change. Geneva, Switzerland.
IPCC, 2014. Climate Change 2014: Synthesis Report. Contribution of Working
Groups I, II and III to the Fifth Assessment Report of the Intergovernmental
Panel on Climate Change. Geneva, Switzerland.
Jackson, D.C. 2000. Living without oxygen: lessons from the freshwater turtles.
Comparative Biochemistry and Physiology A 125, 299 -315.
Janson, R.G., Randall, D.J., 1975. The effects of changes in pH and PCO2 in blood
and water on breathing in rainbow trout, Salmo gairdneri. Respiration Physiology
25, 236–245.
Junk, W.J., Soares, M.G.M., Bayley, P.B., 2007. Freshwater fishes of the Amazon
river basin: their biodiversity, fisheries, and habitats. Aquat. Ecosyst. Health
Manag. 10, 153–173.
Kienzler, A., Bony, S., Devaux, A., 2013. DNA repair activity in fish and interest in
ecotoxicology: a review. Aquat. Toxicol. 134-135, 47–56.
Kobayashi, H., Sugiyama, C., Morikawa, Y., Hayashi, M., Sofuni, T.A., 1995.
Comparison between manual microscopic analysis and computerized image
analysis in the single cell gel electrophoresis. Mamm. Mutagen. Study Gr.
Commun. 3, 103–115.
Kreiss, C.M., Michael, K., Bock, C., Lucassen, M., Pörtner, H.O., 2015. Impact of
long-term moderate hypercapnia and elevated temperature on the energy budget
of isolated gills of Atlantic cod (Gadus morhua). Comp. Biochem. Physiol. Part A
Mol. Integr. Physiol. 182, 102–112.
55
Kültz, D., Somero, G.N., 1995. Osmotic and thermal effects of in situ ATPase activity
in permeabilized gill epithelial cells of the fish Gillichthys mirabilis. J. Exp. Biol.
198, 1883–1894.
Kirschner, L.B., 2004. The mechanism of sodium chloride uptake in hyperregulting
aquatic animals. J. Exp. Biol. 207, 1439-1452.
Last, P.R., White, W.T., Gledhill, D.C., Hobday, A.J., Brown, R., Edgar, G.J., Pecl,
G., 2011. Long-term shifts in abundance and distribution of a temperate fish
fauna: a response to climate change and fishing practices. Glob. Ecol. Biogeogr.
20, 58–72. doi:10.1111/j.1466-8238.2010.00575.x.
Liu, S., Wang, X., Sun, F., Zhang, J., Feng, J., Liu, H., Rajendran, K.V., Sun, L.,
Zhang, Y., Jiang, Y., Peatman, E., Kaltenboeck, L., Kucuktas, H., Liu, Z., 2013.
RNA-Seq reveals expression signatures of genes involved in oxygen transport,
protein synthesis, folding, and degradation in response to heat stress in catfish.
Physiol. Genomics 45, 462–476.
Long, Y., Li, L., Li, Q., He, X., Cui, Z., 2012. Transcriptomic characterization of
temperature stress responses in larval zebrafish. PLoS One7, e37209.
Metz, J.R., van der Burg, E.H., Bonga, S.E., Flik, G., 2003. Regulation of branchial
Na+/K+-ATPase in common carp Cyprinus carpio L. Acclimated to different
temperatures. The Journal of Experimental Biology 206, 2273-2280.
Miller, G.M., Watson, S.A., Mccormick, M.I., Munday, P.L., 2013. Increased CO2
stimulates reproduction in a coral reef fish. Glob. Chang. Biol. 19, 3037–3045.
doi:10.1111/gcb.12259.
Mitchelmore, C.L., Chipman, J.K., 1998. DNA strand breakage in aquatic organisms
and the potential value of the comet assay in environmental monitoring. Mutat.
Res. Mol. Mech. Mutagen. 399, 135–147.
Montalto, A.S., Curro, M., Russo, T., Visalli, G., Impellizzeri, P., Antonuccio, P.,
Arena, S., Borruto, F.A., Scalfari, G., Ientile, R., Romeo, C., 2013. In vitro CO2-
induced ROS production impairs cell cycle in SH-SY5Y neuroblastoma cells.
Pediatric Surgery International 29, 51–59.
Moss, R.H., Edmonds, J.A., Hibbard, K.A., Manning, M.R., Rose, S.K., van Vuuren,
D.P., Carter, T.R., Emori, S., Kainuma, M., Kram, T., Meehl, G.A., Mitchell,
J.F.B., Nakicenovic, N., Riahi, K., Smith, S.J., Stouffer, R.J., Thomson, A.M.,
Weyant, J.P., Wilbanks, T.J. 2010. The next generation of scenarios for climate
change research and assessment. Nature 463, 747–756.
56
Murphy, P.G., Houston, A.H.,1974. Environmental temperature and the body fluid
system of the fresh-water teleost. V. Plasma electrolyte levels and branchial
microsomal (Na+-K+) ATPase activity in thermally acclimated goldfish
(Carassiusauratus). Comparative Biochemistry and Physiology B 47, 563 -570.
Nobre, C.A., Sampaio, G., Salazar, L., 2007. Mudanças climáticas e Amazônia.
Cienc. Cult. 59, 22–27.
Perry, S.F., Malone, S., Ewing, D., 1986. Hypercapnic acidosis in the rainbow trout
(Salmon gairdneri): I. Branchial ionic fluxes and blood acid-base status.
Canadian Journal of Zoology, 888-895.
Pfeiler, E., 1978. Effects of hydrostatic pressure on (Na+ -K+)-ATPase and Mg2+-
ATPase in gills of marine teleost fish. Journal of Experimental Zoology 205, 393-
402.
Pletterbauer, F., Melcher, A.H., Ferreira, T., Schmutz, S., 2014. Impact of climate
change on the structure of fish assemblages in European rivers. Hydrobiologia
744, 235–254.
Portner, H.O., Farrell, A.P., 2008. Physiology and Climate Change. Science 322,
690–692.
Prado-Lima, M. and Val, A.L., 2016. Transcriptomic characterization of tambaqui
(Colossoma macropomum, Cuvier, 1818) exposed to three climate change
scenarios. PLoS One 11(3): e0152366.
Randall, D.J.; Brauner, C.; Wilson, J., 1996. Acid excretion in Amazonian fish. In: Val
A.L., Almeida-Val, V.M.F.; Randal, D.J. (Eds). Physiology and Biochemistry of
the fishes of the Amazon, INPA press, Manaus, AM, p 91-100.
Raskin, P., Monks, F., Ribeiro, T., Vuuren, D. van., Zurek, M., 2005. Global
Scenarios in Historical Perspective. In: Hassan, H., Scholes, R., Ash, N., (Eds).
Ecosystems and human well-being: current state and trends. Washington, D.C:
Island Press, pp. 35–44.
Reid, S.G., Sundin, L., Kalinin, A.L., Rantin, F.T., Milsom, W.K., 2000. Cardiovascular
and respiratory reflexes in the tropical fish, traíra (Hoplias malabaricus): CO2/pH
chemoresponses. Respiration Physiology 120, 47–59.
Roessig, J.M., Woodley, C.M., Cech, J.J., Hansen, L.J., 2004. Effects of global
climate change on marine and estuarine fishes and fisheries. Rev. Fish Biol.
Fish. 14, 251–275.
Sala, O.E., Chapin, F.S., Armesto, J.J., Berlow, E., Bloomfield, J., Dirzo, R., Huber-
57
Sanwald, E., Huenneke, L.F., Jackson, R.B., Kinzig, A., Leemans, R., Lodge,
D.M., Mooney, H.A., Oesterheld, M., Poff, N.L., Sykes, M.T., Walker, B.H.,
Walker, M., Wall, D.H., 2000. Global Biodiversity Scenarios for the Year 2100.
Science 287, 1770–1774.
Salazar, L.F., Nobre, C.A., 2010. Climate change and thresholds of biome shifts in
Amazonia. Geophys. Res. Lett. 37, 1–5. doi:10.1029/2010GL043538.
Sharma, S., Vander Zanden, M.J., Magnuson, J.J., Lyons, J., 2011. Comparing
climate change and species invasions as drivers of coldwater fish population
extirpations. PLoS One, 6. doi:10.1371/journal.pone.0022906.
Simoniello, M.F., Gigena, F., Poletta, G., Loteste, A., Kleinsorge, E., Campana, M.,
Scagnetti, J., Parma, M.J., 2009. Alkaline comet assay for genotoxic effect
detection in neotropical fish Prochilodus lineatus (Pisces, Curimatidae). Bull.
Environ. Contam. Toxicol. 83, 155–158.
Singh, N.P., McCoy, M.T., Tice, R.R., Schneider, E.L., 1988. A simple technique for
quantitation of low levels of DNA damage in individual cells. Exp. Cell Res. 175,
184–191. doi:10.1016/0014-4827(88)90265-0.
Smart, G.R., Knox, D., Harrison, J.G., Ralph, J.A., Richards, R.H., Cowey, C.B.,
1979. Nephrocalcinosis in rainbow trout Salmo gairdneri Richardson: the effect
of exposure to elevated CO2 concentrations. Journal of Fish Diseases 2, 279-
289.
Smart, G.R., 1981. Aspects of water quality producing stress in intensive fish culture.
In: Pickering, A.D. Stress and Fish. London. Academic Press. (pp. 277–289).
Tavares-Dias, M., Moraes, F.R., 2004. Hematologia de peixes teleósteos.
Villimpress. Ribeirão Preto, SP.
Ter Hofstede, R., Rijnsdorp, A.D., 2011. Comparing demersal fish assemblages
between periods of contrasting climate and fishing pressure. ICES J. Mar. Sci.
68, 1189–1198. doi:10.1093/icesjms/fsr053.
Val, A.L., 1995. Oxygen transfer in fishes: Morphological and molecular adjustments.
Brazilian Journal of Medical and Biological Research 28, 1119-1127.
Val, A.L., Almeida-Val, V.M.F., 1995. Fishes of the Amazon and their environment:
physiological and biochemical features. Springer-Verlag, Heidelberg.
Val, A.L., Kapoor, B.G., 2003. Fish Adaptations. Science Publishers, Enfield, NH.
Wood, C.M., 1989. The physiological problems of fish in acid water. In: Morris, R.,
Brown, D.J.A., Taylor, E.W., Brown, J.A. (Eds.). Acid Toxicity and Aquatic
58
Animals. Society for Experimental Biology Seminar Series, Cambridge University
Press, Cambridge p. 125-152.
Wood, C.M., Wilson, R.W., Gonzalez R.J., Patrick M.L., Bergman H.L., Narahara A.,
Val, A.L., 1998. Responses of an Amazonian teleost, the tambaqui (Colossoma
macropomum), to low pH in extremely soft water. Physiological Zoology 71, 658-
670.
Zall, D.M., Fisher, D., Garner, M.Q., 1956. Photometric Determination of Chlorides in
Water. Anal. Chem.28, 1665–1668.
59
Capítulo 2
_____________________________________________________________________ Prado-Lima, M. & Val, A.L. 2016. Transcriptomic characterization of tambaqui (Colossoma macropomum, Cuvier, 1818) exposed to three climate change scenarios. PLoS ONE, 11(3): e0152366.
60
61
Introduction
Climate change, resulting mainly from increases in the concentration of
greenhouse gases (GHG) in the atmosphere, will affect all human activities and
different ecosystems [1–3]. Various climate change scenarios have been proposed
based on the intensity of human activities causing environmental degradation. These
scenarios provide plausible predictions in several key areas, such as the emissions
of GHG and aerosols and environmental and socioeconomic conditions [2,3].
When applied to climate change research, the various climate scenarios help
provide a preview of how Earth’s systems will respond to different levels of
greenhouse emissions as well as aid the design of strategies to reduce the resulting
impacts on organisms [4]. According to the Fourth Assessment Report of the
Intergovernmental Panel on Climate Change (IPCC), three main scenarios of climate
are foreseen for the year 2100: B1 (soft), A1B (intermediate) and A2 (extreme).
These scenarios may vary according to population growth, socioeconomic
development and the use of fossil fuels or renewable energy [2].
Several studies have used climate change scenarios foreseen by the IPCC to
predict the qualitative and quantitative responses of marine and freshwater
ecosystems to environmental changes associated with the accumulation of GHG in
the atmosphere [5,6]. These studies suggest that climate change will cause severe
disturbances to both marine and freshwater ecosystems, impairing the distribution of
species and fishery in various countries [7,8].
The Amazon basin harbors a significant portion of the world’s biodiversity and
exhibits the highest diversity of freshwater fishes in the world, with approximately
3,000 fish species [9–11]. The Amazon River and its tributaries are home to species
that are still unknown to the scientific community. Despite this, the Amazon region
has been subjected to environmental pressures in recent decades, including
pressures of anthropogenic origin, such as deforestation, fires and growth of urban
centers, and those resulting from global warming [11,12].
Climate change may affect many organisms, ranging from bacteria to
mammals [3]. Fishes are especially susceptible to climate change, due mainly to
increases in water temperature and variations in the concentrations of dissolved
gases, particularly oxygen and carbon dioxide (CO2) [6]. Poikilothermic aquatic
organisms, such as fishes, can face a new challenge in warm water because it holds
less oxygen, resulting in a hypoxic environment. Because each fish species has a
62
specific thermal tolerance, a species may face death and extinction if the water
temperature exceeds its thermal tolerance [13–15]. This is an issue of increasing
concern because temperatures may continue to increase as a result of global climate
change [16].
Tambaqui (Colossoma macropomum) is a native fish species of the Amazon
basin and member of the family Serrasalmidae [9] that plays an important economic
role in the Amazon region [17]. In Brazil, it is the second most commonly raised fish
in aquaculture [17]. This species exhibits a high tolerance for environmental changes
in dissolved oxygen, temperature and pH [18,19]. Therefore, in the face of global
climate change, it is important to understand the molecular mechanisms that confer
tolerance in this species.
Molecular methods such as high-throughput RNA sequencing (RNA-Seq)
provide the opportunity to investigate the transcriptional response of various
organisms, including fishes, to climate change, allowing the identification of
mechanisms underlying adaptation to environmental stress [20,21]. Furthermore,
RNA-Seq enables the correlation of the number of times that a transcript is
sequenced with its abundance in a tissue or organism, which provides evidence of
the quantitative gene expression profile [21,22].
To combat the adverse effects elicited by fluctuations in temperature and
dissolved gases, fishes have developed the ability to adapt to a wide range of
environmental challenges to maintain normal cellular functions [19,23,24]. The
biochemical changes induced by stress are attributed to modulation of gene
expression, including controlling the cell cycle, DNA and chromatin stabilization,
protein folding and repair, the removal of damaged proteins, and energy metabolism
[25–27]. While stress response genes have been well characterized in many species
[28], there have been relatively few studies of Amazonian organisms, such as
tambaqui, particularly in relation to issues of ecological and evolutionary significance,
such as climate change [29]. Thus, RNA-Seq provides the possibility to investigate
differential expression and identify biological pathways involved in the response of
fishes to climate change.
Therefore, the present study aimed to analyze alterations of gene expression
in tambaqui when exposed to the B1, A1B and A2 future climate scenarios foreseen
by the IPCC for the year 2100.
63
Materials and methods
Ethics statement
All experimental procedures were carried out in accordance with Brazilian
legislation and approved by the Ethics Committee on Animal Use of the Brazilian
National Institute for Research in the Amazon (CEUA-INPA) (Protocol 056/2012).
Climate change exposure
Tambaqui juveniles (15.5±1.9 g and 8.3±0.3 cm) were obtained from a local
fish farm (Fazenda Tajá, Amazonas, Brazil) and transported to the Laboratory of
Ecophysiology and Molecular Evolution of the Brazilian Institute for Amazonian
Research (INPA), Manaus, Amazonas state, Brazil. The fish were maintained in 500
L fiberglass outdoor tanks for one month, for local acclimatization.
Three future climate scenarios provided by the Fourth Assessment Report of
the IPCC for the year 2100 [2] were simulated: B1 (soft scenario): 1.5°C and 200
ppm CO2 above current levels; A1B (intermediate scenario): 2.5°C and 400 ppm CO2
above current levels; and A2 (extreme scenario): 4.5°C and 850 ppm CO2 above
current levels. The control scenario was the current real-time temperatures and CO2
levels (Table 1) in a near-forested area. Sensors measure these parameters every
other minute and transmit the data to laboratory computers that control
environmental rooms according to the above scenarios.
Table 1. Physicochemical parameters of water and air in the control climate
environment where the specimens of tambaqui were kept for five and fifteen days
while being exposed to the B1, A1B and A2 climate scenarios. The data are reported
as the mean ± standard error of the mean.
Scenario pH
Water O2
(mg.L-1)
Water CO2
(ppm)
Water temperature
(oC)
Environment CO2 (ppm)
Environment temperature
(oC)
5 days
Control 6.2±0.3 7.4±0.1 8.8±0.9 24.7±0.2 416±11.7 30.2±0.7 B1 5.4±0.2 7.3±0.1 11±0.8 25.7±0.2 622.1±17.5 32±0.8
A1B 5.3±0.2 7.3±0.2 12.3±0.7 26±0.2 830.6±23.4 33±0.8 A2 5.0±0.1 7.4±0.1 13.8±0.8 27.3±0.3 1257.1±35.4 34.3±0.9
15 days
Control 6.1±0.2 7.4±0.1 8.9±0.8 24.9±0.3 441.1±10.4 30.1±0.7 B1 5.5±0.2 7.4±0.1 11.9±0.9 25.8±0.2 641.3±15.1 31.7±0.8
A1B 5.3±0.1 7.5±0.1 15.3±0.6 26.1±0.1 856.6±20.2 32.8±0.8 A2 5.1±0.1 7.5±0.1 19±0.9 27.6±0.3 1280.9±30.2 34.2±0.9
64
Tambaqui juveniles were transferred to the conditions of the above climate
scenarios two days prior to beginning the experiments. Six 60-L PVC tanks
containing four fish per tank were maintained in each climate room. To avoid
ammonia accumulation, 30% of the water was replaced every other day using
environmentally stabilized water. The pH, O2 and CO2 levels and temperature of the
water were measured daily (Table 1). The fish were fed ad libitum once a day using
commercial pelleted feed (Nutripeixe, Purina). After each exposure period, one fish
was removed from each tank, with a total of six fish per scenario being collected after
five days and another six after fifteen days. The fish were subsequently euthanized
by rapidly severing their spinal cord with a scalpel, and white muscle samples were
collected and immediately stored in liquid nitrogen until RNA isolation.
RNA purification
Total RNA was isolated from the white muscle specimens from 48 tambaqui
using TRIzol (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s
instructions. Total RNA samples were then digested with DNase I to remove
potentially remaining genomic DNA, and ribosomal RNA was depleted using the
RiboMinusTM Eukaryote Kit for RNA-Seq (Invitrogen, Carlsbad, CA, USA). RNA
yields and quality were checked using both an Agilent 2100 Bioanalyzer (Agilent
Technologies, Waldbronn, Germany) and a Qubit 2.0 Fluorometer (Invitrogen,
Carlsbad, CA, USA). None of the samples showed signs of degradation or impurities
(260/280 and 260/230 >1.8, RIN >8.5). Using the total RNA (gDNA-free) from each
sample, mRNA was isolated with the Poly(A)PuristTM Kit (Ambion, Austin, TX, USA)
according to the manufacturer's protocol.
For each group, equal amounts of mRNA from six fish were pooled for RNA-
Seq library construction, with a total of eight RNA-Seq libraries being generated.
Using this method, we aimed to increase transcript diversity and to detect rare
transcripts in both the control and experimental libraries
RNA-Seq library construction and sequencing
Approximately 500 ng of mRNA from each pool was used to construct eight
RNA-Seq libraries [four for animals after five days and four for animals after fifteen
days of exposure to the climate scenarios (Control, B1, A1B and A2)] with the
SOLiD™ Total RNA-Seq Kit for Whole Transcriptome Libraries (ABI, Foster, CA,
65
USA), following the manufacturer’s instructions. To improve the statistical analyses,
one replicate of each of the eight libraries was constructed, resulting in a total of 16
libraries. Barcodes were used to identify each library individually. The libraries were
deposited on two full slides and sequenced using a SOLiD (v.4) sequencer (ABI,
Foster, CA, USA) to generate fifty-base sequences.
Processing of sequence data
The raw reads of 50 bp generated by the SOLiD sequencer from each sample
were trimmed and analyzed in CLC Genomics Workbench (CLC Bio, v. 7.5.1). First,
adapter sequences and low-quality reads were removed based on default
parameters. High-quality reads were then mapped to the D. rerio genome (the
closest species with an available genome). The D. rerio gene annotations were then
used for expression analyses. The expression profiles for each library were analyzed
using the EdgeR method implemented in CLC Genomics Workbench, with default
parameters. Statistical tests were conducted to identify the differentially expressed
genes between the control and experimental samples, subjected to five or fifteen
days of exposure to the B1, A1B and A2 climate scenarios. Genes with false
discovery rate (FDR)-corrected P values ≤0.05 and absolute fold change values ≥2.0
were included in the analysis as differentially expressed genes. Contigs with gene
annotations were used for further analysis.
Gene ontology
All of the differentially expressed genes identified only under the A2 scenario
after both five and fifteen days of exposure were split into two groups: up-regulated
and down-regulated genes. Then, each group was mapped separately to gene
ontology terms using the AmiGO (v. 2.0) program (http://www.geneontology.org/),
against the database of annotated genes for D. rerio. The Gene Ontology (GO)
program employs three general categories: molecular function (MF), biological
process (BP), and cellular component (CC). For each category, there is a structure of
terms and/or more specific levels for categorizing genes.
Protein interactions
To generate the protein functional interaction network, all of the differentially
expressed genes were submitted together, using their gene symbols, to STRING
66
(Search Tool for the Retrieval of Interacting Genes) software (v.10) and subjected to
searches against the D. rerio database to look for known interactions among the
genes. The STRING database (http://string-db.org/) is a collection of known and
predicted protein associations obtained from the mining of databases and the
literature, high-throughput experimental data, and predictions based on genomic
analyses of more than 2000 organisms [30]. From the STRING interaction data, we
extracted conserved genomic neighborhoods, gene fusion events, phylogenetic
profiles or gene co-occurrences across multiple genomes, text mining, experiments,
and other databases with the highest confidence scores (0.9) allowed by the STRING
schemes.
Identification of SSR motifs
To identify all repetitive elements in the assembled contigs from tambaqui, all
sequences were searched for SSR motifs using the Msatcommander software (v.
0.8.2, with default settings). To be considered a dinucleotide SSR, the sequence
must have a minimum of six repeats. All other types of SSRs should have a minimum
of five repetitions. To be considered a compound SSR, the interruption between two
neighboring SSRs cannot surpass 100 nucleotides. The Primer3 software [31] was
used to design PCR primers for flanking all identified SSR motifs.
Results
To characterize the transcriptional responses of genes affected by climate
change in tambaqui, eight RNA-Seq libraries were built after five and fifteen days of
exposure to the B1, A1B and A2 climate scenarios. A total of 776,301,503 reads
were sequenced, with an average of 97 million of reads per library (Table 2). Each
raw read was sequenced from one end, and the length was 50 bp. After filtering to
remove adaptors and low-quality sequences, we obtained a total of 116,176,912
trimmed reads. After clustering and de novo assembly, 54,206 contigs of high quality,
showing lengths ranging from 74 to 1,094 bp were generated. The redundant and
ribosomal protein sequences were excluded, and 32,512 genes were identified
based on comparison with the D. rerio database. The raw reads generated in this
study have been deposited in the National Center for Biotechnology Sequence Read
Archive (NCBI-SRA) database (SRP062336).
67
Table 2. Overview of the RNA-Seq reads acquired from tambaqui after five and
fifteen days of exposure to the B1, A1B and A2 climate scenarios.
Scenario Total
Reads Trimmed
reads
All uniquely mapped reads to Danio rerio genes
Uniquely mapped reads to
Danio rerio exons
5 days
Control 83.673.651 16.996.336 4.280.731 1.031.276
B1 116.529.116 16.594.828 4.543.412 752.684
A1B 96.692.812 16.531.446 4.082.882 1.035.552
A2 79.983.888 17.909.708 4.344.590 1.179.861
15 days
Control 93.479.183 19.706.164 4.785.282 1.301.147
B1 98.635.208 16.328.332 3.946.647 1.090.509
A1B 112.023.018 13.701.912 3.659.181 723.738
A2 95.284.627 15.404.522 3.931.801 953.959
Total 776.301.503 133.173.248 33.574.526 8.068.726
Considering only those genes with a p-value ≤0.05 and a ≥2-fold change in
expression across the control and treated libraries, we identified a total of 236 and
209 differentially expressed genes after five and fifteen days, respectively, of
exposure to the B1, A1B and A2 climate scenarios (Fig 1). After five days, 104, 114
and 116 up-regulated genes were observed in animals exposed to the B1, A1B and
A2 climate scenarios, respectively. The corresponding numbers of down-regulated
genes were 132, 124 and 120, respectively. After fifteen days, 61, 78 and 69 up-
regulated genes were identified in animals exposed to B1, A1B and A2, respectively.
The corresponding numbers of down-regulated genes were 149, 133 and 138,
respectively. A complete list of the differentially expressed genes, including the level
of expression, can be found in the Supplementary material (S1 and S2 Tables).
68
Figure 1. Comparison of the number and direction of differentially expressed
transcripts identified in tambaqui after five and fifteen days of exposure to different
climate scenarios. The bar chart shows the number of differentially expressed
transcripts identified after five days (left bars) and fifteen days (right bars) under the
B1, A1B and A2 climate scenarios. Positive and negative values on the Y-axis
represent the number of up-regulated and down-regulated transcripts, respectively.
The list of differentially expressed genes showed several genes that play roles
in energy production, protein folding and maintaining cellular homeostasis, among
other functions. Genes encoding aldolases (aldoaa, aldoab and aldocb), enolases
(eno1, eno3), lactate dehydrogenase (ldha), pyruvate kinase (pkmb), cytochrome c
oxidase (cox5bs, cox4i2, cox8b) and chaperones such as Hsp40 (Dnaja2, Dnajc7)
and Hsp90 (hsp90aa1.1 and hsp90aa1.2) and genes responsible for protein folding
(such as hmgb1a and pfdn2) were identified. The main genes responsible for the
adaptation of tambaqui to climate change were grouped according to the current
literature, metabolic routes and the GO database (Table 3).
69
Table 3. Tambaqui genes1 affected by exposure to climate change scenarios.
Gene symbol Gene name Gene Ontology2
dnaja23 DnaJ (Hsp40) homolog, subfamily A, member 2
response to temperature stimulus (BP) heat shock protein binding (MF)
dnajc73 DnaJ (Hsp40) homolog, subfamily C, member 7
response to temperature stimulus (BP) heat shock protein binding (MF)
hmgb1a5 high mobility group box 1a response to temperature stimulus (BP)
chromatin remodeling (BP)
hsp90aa1.13 heat shock protein 90, alpha (cytosolic), class A member
1, tandem duplicate 1
chaperone-mediated protein (BP) complex assembly (BP)
hsp90aa1.24 heat shock protein 90, alpha (cytosolic), class A member
1, tandem duplicate 2
chaperone-mediated protein (BP) complex assembly (BP)
pfdn25 prefoldin subunit 2 protein folding (BP)
unfolded protein binding (MF)
1Genes selected based on the stress response using Blast X and the scientific literature. 2Functional annotation associated with the Danio rerio database. Gene ontology (GO) categories: biological process (BP) and molecular function (MF). 3Gene showing differential expression only after five days of exposure to the B1, A1B and A2 climate scenarios. 4Gene showing differential expression only after fifteen days of exposure to the B1, A1B and A2 climate scenarios. 5Gene showing differential expression after both five and fifteen days of exposure to the B1, A1B and A2 climate scenarios.
The GO database was used to categorize the differentially expressed genes
identified only under the A2 scenario after five and fifteen days of exposure. The A2
scenario was chosen because it was the most extreme scenario considered in the
present study. Among all the genes identified, 241 were successfully categorized, 82
of which were up-regulated, while 159 were down-regulated. Analysis of the GO term
distribution of the up-regulated genes at five days revealed 235 terms (MF: 48, BP:
138 and CC: 49) (Fig 2), while there were 263 terms associated with down-regulated
genes (MF: 118, BP: 91 and CC: 54) (Fig 3). The GO analysis using the fifteen-day
library revealed 257 terms for the up-regulated genes (MF: 25, BP: 194 and CC: 38)
(Fig 4) and 180 terms for the down-regulated genes (MF: 83, BP: 23 and CC: 74)
(Fig 5). For three broad categories (MF, BP and CC), four pie chart graphs were
generated: two containing the corresponding top 20 terms linked to up-regulated
genes after five and fifteen days and another two containing the top 20 terms linked
to down-regulated genes identified after five and fifteen days under the A2 climate
70
scenario. In both cases, the top 20 terms were those with the highest percentage of
representation within each of the three general categories. The terms other than the
top 20, with low percentages, usually ranging from 1 to 2% of the total
representation, were grouped and are also represented in the pie chart.
71
72
Figure 2. Pie chart of the top 20 GO terms associated with up-regulated genes
identified in tambaqui after five days of exposure to the B1, A1B and A2 climate
scenarios. Representation of the top 20 GO terms from the molecular function (A),
biological process (B) and cellular component (C) categories in the experimental
groups compared with the control. The terms other than the top 20 are represented
together.
73
74
Figure 3. Pie chart of the top 20 GO terms associated with down-regulated genes
identified in tambaqui after five days of exposure to the B1, A1B and A2 climate
scenarios. Representation of the top 20 GO terms from the molecular function (A),
biological process (B) and cellular component (C) categories in the experimental
groups compared with the control. The terms other than the top 20 are represented
together.
75
76
Figure 4. Pie chart of the top 20 GO terms associated with up-regulated genes
identified in tambaqui after fifteen days of exposure to the B1, A1B and A2 climate
scenarios. Representation of the top 20 GO terms from the molecular function (A),
biological process (B) and cellular component (C) categories in the experimental
groups compared with the control. The terms other than the top 20 are represented
together.
77
78
Figure 5. Pie chart of the top 20 GO terms associated with down-regulated genes
identified in tambaqui after fifteen days of exposure to the B1, A1B and A2 climate
scenarios. Representation of the top 20 GO terms from the molecular function (A),
biological process (B) and cellular component (C) categories in the experimental
groups compared with the control. The terms other than the top 20 are represented
together.
STRING software was used to generate a confidence gene interaction network
merging all of the differentially expressed genes identified after five and fifteen days
in animals exposed to the B1, A1B and A2 climate scenarios (Fig 6). The proteins are
represented with nodes. Direct protein-protein interactions are represented with
continuous blue lines. Due to the high number of interactions observed, the settings
were changed to only identify gene expression with the “highest confidence” (score
>0.9). Nodes with no interactions were hidden. A total of 985 interactions (S3 Table)
were obtained using 296 nodes among the analyzed genes. The gene network
showed five major clusters. Cluster 1, Cluster 2, Cluster 3 and Cluster 4 exhibited
interconnected interactions and sparsely connected sub-networks. Only Cluster 5
showed no connections with the other clusters. The lists of genes grouped in each of
the five clusters are highlighted in S1-S5 Figs.
79
Figure 6. Gene network interactions identified using STRING software (v.10).
Interactions of genes (or proteins) expressed in the white muscle of tambaqui after
five and fifteen days of exposure to the B1, A1B and A2 climate scenarios. Circles
with different colors represent different genes (or proteins). Blue lines represent
strong interactions between genes (or proteins). Nodes with no interactions have
been hidden.
A total of 1,201 SSRs, comprising 93% simple and 7% compound motifs, were
detected among the tambaqui contigs (Fig 7). These SSRs included the following
80
types of repeats: 81% dinucleotides, 16% trinucleotides and 3%
tetra/pentanucleotides. Among the dinucleotide repeats, the GT (33.5%) and CT
types (32.8%) were most abundant, while GAT was the most frequent trinucleotide
repeat (15.5%). Based on the detected SSRs, 88 primer sets were successfully
designed and will be tested in natural or captive populations (S4 Table).
Figure 7: Distribution of simple sequence repeats found in tambaqui sequences.
Discussion
Climate change is likely to endanger regions with high biodiversity, such as the
Amazon. Although several studies have sought to predict the impacts of climate
change in the Amazon, they are generally based on computer models that do not
always take into account all of the hidden characteristics of the rainforest. Thus, we
used the second most commonly farmed species in Brazil, and the most commonly
farmed species in the Amazon, to investigate the main impacts of climate change on
the regulation of gene expression in fish exposed to the B1, A1B and A2 climate
scenarios foreseen by the IPCC for the year 2100.
In the present study, a transcriptome-level analysis was conducted to
determine how tambaqui will respond to exposure to climate change using the NGS
81
and RNA-Seq methods. Two critical factors for fish survival were tested at different
levels during five and fifteen days of exposure to the B1, A1B and A2 climate
scenarios: temperature and CO2 levels. Because thermal stress and CO2 elevation
have broad biological effects on organisms, the transcriptional responses to these
parameters are expected to be highly diverse across a number of genes found in
ectothermic species such as tambaqui. This study confirms that numerous genes are
differentially expressed in tambaqui under the B1, A1B and A2 climate scenarios,
and several pathways are involved (S1 and S2 Tables). However, according to the
GO tool, a few key pathways contained a high proportion of differentially expressed
transcripts, including the mitochondrion, protein binding, protein metabolic process,
metabolic processes, gene expression, structural constituent of ribosome and
translation categories.
In the present study, SOLiD sequencing allowed the identification of 32,512
genes. Considering that no sequenced genome currently exists for tambaqui,
comparison with the D. rerio transcriptome was performed. Because D. rerio has a
total of 34,460 annotated genes [32], if we consider that the two species have the
same number of genes, the identified genes in the present work would represent
approximately 94% of the genes of the tambaqui transcriptome and can therefore be
employed in various approaches to evaluate information on the transcriptome,
genome and genetic breeding of tambaqui. The tool used in the present study
allowed us to identify 388 genes that showed different levels of expression according
to the time of exposure and the climate scenario. Evidence of acclimation was
indicated by the 11.4% decrease in the number of differentially expressed transcripts
from five to fifteen days (Fig 1). Despite the short period of time, this result is in
accordance with theories on acclimation to heat stress under which organisms can
regulate their heat shock response over time [15], as opposed to the theory in which
immediate survival is a priority [33]. However, the current results demonstrate that
from five to fifteen days, acclimation occurs throughout much of the transcriptome
and is not limited to genes related to heat shock, such as chaperones.
Climate change may introduce a number of environmental challenges for
fishes due to increased temperatures above the optimal range, leading to altered
transcription of genes involved in protein folding and heat-shock responses
[29,34,35], ribosomal and metabolism-related genes [27,36,37] and genes
associated with cell cycle arrest and apoptosis [23,29,34]. Ectothermic animals, such
82
as fishes, generally show temperature-dependent oxygen consumption [38].
Considering that increases in temperature may induce low-oxygen stress because
oxygen solubility is reduced in warmer water [18], fishes may also experience
hypoxia at elevated temperatures due to a reduced binding capacity of hemoglobin
for oxygen transport [19,39].
A sufficient oxygen supply is fundamental to ensuring optimal growth, foraging
and reproduction performance in fishes [13]. Under these conditions, the tambaqui
have developed several adaptation mechanisms to safeguard survival ability. For
example, tambaqui are able to expand their lower lip to direct the first film of the
water column, which is richer in oxygen, over their gills [18]. Simultaneously, the
species can reduce erythrocytic ATP and GTP to increase Hb-O2 affinity [18,40]. All
of these biochemical and physiological adaptations are important for increasing the
thermal tolerance of tambaqui and buffering the negative effects of low oxygen
concentrations in water.
In the present study, at least four gene groups were identified among all of the
differentially expressed genes. The first group comprised several types of heat shock
proteins (Hsps), including Hsp90 and Hsp40 (dnaja2, dnajc7). The expression levels
of these genes changed after five and fifteen days under the B1, A1B and A2 climate
scenarios. Hsps are a well-studied group of highly conserved, ubiquitously distributed
genes that are expressed upon exposure to various stress factors, including elevated
temperatures [41]. Hsps are part of an important mechanism that helps organisms
survive under different environmental conditions, such as thermal stress [41]. Hsp90
is a highly conserved molecular chaperone that has been proposed to act as a hub
for the signaling network and protein homeostasis associated with diverse
physiological processes, including the heat shock response, signal transduction and
stress responses, in eukaryotic cells [42]. Our findings suggest that Hsps are directly
involved in the thermal tolerance of tambaqui.
The second group of differentially expressed genes were involved in ATP-
derived energy production. Genes related to glycolysis, such as aldoaa, aldoab,
aldocb, eno1a, eno3, ldha, and pkmb, were down-regulated under all three tested
climate scenarios. Similarly, genes such fh, ndufs4, cox5b2, and mdh2, which play
important functions in the tricarboxylic acid cycle and electron transport chain, were
down-regulated in the white muscle of tambaqui under all three tested climate
scenarios. These results suggest an impairment of several ATP-generating enzymes,
83
which can cause an increase in the expression of transcription factors and target
genes as well changes in the fatty acid composition of membranes to equilibrate the
cellular energy balance and to maintain cellular homeostasis [43].
The third group consisted of genes that act as translation initiation factors.
These genes were repressed in tambaqui after fifteen days of exposure to all three
climate scenarios (eef1a1a, eef1a1l1, eef1a2, eif2s1b, eif4a3, eif4eb, and eif4ebp3l).
These genes encode proteins that are components of the eukaryotic translation
initiation factor complex, which is fundamental for several steps in the initiation of
protein synthesis through association with the 40S ribosome, and facilitate the
recruitment of eif-1, eif-1a, eif-2, and eif-5 to form a complex known as the 43S pre-
initiation complex (43S PIC), which is necessary for scanning mRNA for the
translation-initiation codon AUG [44,45]. Another important translation initiation factor
that was identified was the high-mobility group b1 protein, encoded by hmgb1. This
protein plays key roles in the immune system, transcription initiation and the
assembly of numerous nucleoprotein complexes that are critical to cell function and
the formation of enhanceosome complexes. Through these functions, hmgb1a acts
as a compensatory modulator of transcription in response to increased temperature,
making it a global temperature sensor that reduces the expression of key genes in
response to elevated temperature [46]. Hmgb1a may be also involved in the
modulation of the immune system of tambaqui in response to diverse climate
changes scenarios. However, additional studies are needed to confirm this
hypothesis.
The fourth and last group was composed of genes that are related to the
production of constituents of ribosomes or are important in the assembly and stability
of ribosomal subunits. Some of these genes were significantly repressed in
tambaqui, especially after fifteen days (rpl3, rpl7, rpl13, rpl18a, rpl35, rps10, rps27.1
and rpsa), while others (rpl5a, rpl14, rpl23, rpl32, rplp2 and rps26) showed varying
expression levels. Similar results have been obtained following thermal stress in
Arctic char [27]. These results, together with the translation initiation factors that were
found to be repressed, indicate that commitment of the translational machinery after
fifteen days of exposure preserves the synthesis of specific stress-responsive
proteins to enhance cell survival under climate changes, which can cause
disequilibrium of vital functions, such as metabolism, reproduction, growth and
competitiveness [13,14].
84
As explained above, the list of differentially expressed genes indicates that the
cellular responses to climate change in tambaqui are complex, involving a number of
genes, and may be controlled by different cues and transcription/translation
regulation mechanisms, as observed in other fishes [29,34,47] and various other
types of organisms [48,49], including humans [50].
When exposed to thermal stress, fishes need to increase their oxygen supply
in response to an elevated metabolic rate, resulting in behavioral changes [47].
Consequently, food consumption and foraging activities may be increased at higher
temperatures, increasing the energy requirement of the fishes. However, if a constant
search for food is not successful, fishes will be unable to maintain their growth rates
[51]. Furthermore, under conditions of increased CO2, the effects caused by thermal
stress are potentiated, impairing feeding and growth [52]. Another consequence is
that increases in temperature have a significant impact on predator–prey interactions,
potentially leading to ecosystem imbalances with consequences at various food
chain levels [53,51].
Gene ontology is commonly used to categorize gene products and to
standardize their representation across different species or environmental stress
situations [54–56]. To characterize transcriptional events over time, only the
differentially expressed genes related to the A2 climate scenario were subjected to
GO analysis (Figs 2-5). The results showed that the up-regulated genes were related
to the following categories: protein binding (MF), protein dimerization activity (MF),
protein heterodimerization activity (MF), protein homodimerization activity (MF), and
identical protein binding (MF). This is expected under thermal stress given that
proteins such as HSPs are involved in protein folding and unfolding, providing
thermo-tolerance in cells upon exposure to heat stress [41]. In the opposite situation,
the down-regulated genes were related to the following categories: cellular metabolic
process (BP), phosphorus metabolic process (BP), organic substance metabolic
process (BP), primary metabolic process (BP), protein metabolic process (BP),
macromolecule metabolic process (BP) and cellular protein metabolic process (BP).
These results, together with those for the gene expression (BP) and translation (BP)
categories, indicate suppression of various metabolic processes to ensure cellular
homeostasis and, thus, overcome the environmental challenge. The categories
mentioned above appeared at low percentages after five days, but their percentages
almost doubled after fifteen days of exposure to the A2 climate scenario, indicating
85
that these mechanisms that enable organisms to minimize some temperature-related
effects were already present at five days and increased after fifteen days. The results
of GO analysis followed a similar pattern to those observed in transcriptomic
analyses of other fish species [34,46,57].
Protein functional interaction networks, such as the one we generated using
the STRING database, are commonly employed to predict protein–protein
associations derived from high-throughput experimental data or from the mining of
databases and the literature as well as predictions based on genomic analyses of
more than 2,000 organisms [30]. We searched the interactions among all of the
differentially expressed genes obtained after five and fifteen days of exposure to the
three climate scenarios and used STRING to construct an interaction network (Fig 6).
The 296 nodes allowed the identification of five clusters (S1-S5 Figs). A central
interplay cluster was not detected, although cluster 1 appeared to start a chain of
interactions that extended to cluster 4. Cluster 1 included genes related to the folding
and unfolding of proteins, such as pdfn2, dnaja2, hsp90aa1.1 and hsp90aa1.2, which
are known to control gene expression in a number of organisms under thermal stress
[41,35,48]. Hsp90 (also known as endoplasmin) is a molecular chaperone that
functions in the processing and transport of secreted proteins [58]. The up-regulation
of Hsp90 is often used as a hallmark of endoplasmic reticulum stress [29]. Hsp90
interacts with more than 100 proteins, and some of its notable partners include
kinases, nuclear hormone receptors, transcription factors, and ion channels [58].
Clusters 2 and 3 comprised genes related to glycolysis and the mitochondrial
respiratory chain, including pkmb, ldha, aldoab, eno2, atp5d, and cox5b2. Cluster 5
mainly consisted of translation factors (eif2s1, eif4eb, eif3f, and eif1a1a) and genes
related to rRNA processing and ribosomal biogenesis (rpl11, rpl7, rps 3, and rps29)
that play key roles in the regulation of gene expression. Ribosomal proteins are
potential biomarkers of tolerance to thermal stress in fishes [27].
The 1201 SSRs identified and 88 primer sets designed in the current study
(S4 Table) provide a valuable resource for the development of molecular tools for
tambaqui and other closely related species. Given that only 41 SSR loci had
previously been developed for tambaqui [59–61], the 88 primer sets designed in the
present study more than double the number of SSR loci currently available. The high
number of dinucleotide repeats (Fig 7) observed in tambaqui (approximately 81%) is
consistent with previous studies in fishes and other aquatic organisms [62,63]. SSR
86
markers have been efficiently used for the identification of individuals, population
diversity and quantitative trait loci (QTL) analyses, and genetic breeding of stocks
[64,65]. The SSR loci developed here must be validated before use in future
applications.
Conclusions
This is the first RNA-Seq-based study of the transcriptional response of
tambaqui exposed to climate change. Several candidate genes that can be employed
to screen for genetic markers for climate change were identified. Using GO
enrichment analysis and STRING software, we identified diverse biological processes
and intracellular pathways related to the functional impacts of the observed changes
in transcript expression. The obtained results provide clues toward elucidating the
molecular mechanisms underlying the regulatory networks of gene expression during
climate change exposure. In addition, an analysis of repetitive elements was
conducted, and SSRs were identified for future marker development and linkage
analysis. The large number of differentially expressed genes recorded in this study
suggests that a complex combination of genes has evolved in tambaqui as a
response to climate change scenarios; in particular, these genes include chaperones,
energetic metabolism-related genes, translation initiation factors and ribosomal
genes. Overall, the results of this study on the tambaqui transcriptome should serve
as a valuable resource for future genetic or genomic studies.
Acknowledgments
We thank Dr. Alzira Miranda, Fernanda Dragan, MSc., and Maria de Nazaré
Paula da Silva, MSc., for their contributions to the fish exposure experiments and
Lucas Canesin, MSc., for the help provided with the bioinformatics analysis. This
work forms part of INCT-ADAPTA (CNPq/FAPEAM). MPL was a recipient of a Ph.D.
fellowship from CAPES, and ALV is a recipient of a research fellowship from CNPq.
References
1. Rockström J, Brasseur G, Hoskins B, Lucht W, Schellnhuber J, Kabat P, et al.
Climate change: the necessary, the possible and the desirable Earth League
climate statement on the implications for climate policy from the 5th IPCC
assessment. Earth's Future. 2014;2: 606–611. doi: 10.1002/2014EF000280.
87
2. IPCC. Climate change 2007: contribution of working groups I, II and III to the
fourth assessment report of the Intergovernmental Panel on Climate Change.
Metz B, Davidson OR, Bosch PR, Dave R, Meyer LA, eds. Cambridge, UK:
Oxford University Press; 2007.
3. IPCC. Climate change 2014: synthesis report. Contribution of working groups I,
II and III to the fifth assessment report of the Intergovernmental Panel on
Climate Change. The Core Writing Team, Pachauri RK, Meyer L, eds. Geneva:
IPCC; 2014.
4. Moss RH, Edmonds JA, Hibbard KA, Manning MR, Rose SK, van Vuuren DP,
et al. The next generation of scenarios for climate change research and
assessment. Nature. 2010;463: 747–756. doi: 10.1038/nature08823.
5. Pletterbauer F, Melcher AH, Ferreira T, Schmutz S. Impact of climate change
on the structure of fish assemblages in European rivers. Hydrobiologia.
2015;744: 235–254. doi: 10.1007/s10750-014-2079-y.
6. Ficke AD, Myrick CA, Hansen LJ. Potential impacts of global climate change on
freshwater fisheries. Rev Fish Biol Fish. 2007;17: 581-613. doi:
10.1007/s11160-007-9059-5.
7. Sharma S, Vander Zanden MJ, Magnuson JJ, Lyons J. Comparing climate
change and species invasions as drivers of coldwater fish population
extirpations. PLOS ONE. 2011;6: e22906. doi: 10.1371/journal.pone.0022906.
8. Brander KM. Global fish production and climate change. Proc Natl Acad Sci U
S A. 2007;104: 19709–19714. doi: 10.1073/pnas.0702059104.
9. Junk WJ, Soares MGM, Bayley PB. Freshwater fishes of the Amazon River
basin: their biodiversity, fisheries, and habitats. Aquat Ecosyst Health Manag.
2007;10: 153–173. doi: 10.1080/14634980701351023.
10. Reis RE. Conserving the freshwater fishes of South America. Int Zoo Yb.
2013;47: 65–70. doi: 10.1111/izy.12000.
11. Castello L, Mcgrath DG, Hess LL, Coe MT, Lefebvre PA, Petry P, et al. The
vulnerability of Amazon freshwater ecosystems. Conserv Lett. 2013;6: 217–
229. doi: 10.1111/conl.12008.
12. Cheng H, Sinha A, Cruz FW, Wang X, Edwards RL, d’Horta FM, et al. Climate
change patterns in Amazonia and biodiversity. Nat Commun. 2013;4: 1411.
doi: 10.1038/ncomms2415.
88
13. Pörtner HO, Farrell AP. Ecology. Physiology and climate change. Science.
2008;322: 690–692. doi: 10.1126/science.1163156.
14. Long Y, Li L, Li Q, He X, Cui Z. Transcriptomic characterization of temperature
stress responses in larval zebrafish. PLOS ONE. 2012;7: e37209. doi:
10.1371/journal.pone.0037209.
15. Long Y, Song G, Yan J, He X, Li Q, Cui Z. Transcriptomic characterization of
cold acclimation in larval zebrafish. BMC Genomics. 2013;14: 612. doi:
10.1186/1471-2164-14-612.
16. Clarke A. Costs and consequences of evolutionary temperature adaptation.
Trends Ecol Evol. 2003;18: 573–581. doi: 10.1016/j.tree.2003.08.007.
17. Brazil. Boletim Estatístico da Pesca e Aquicultura: Brasil 2011. Brasília; 2012.
Available: http://www.mpa.gov.br/files/docs/Boletim_MPA_2011_pub.pdf.
Accessed 02 Sep 2015.
18. Val AL, Almeida-Val VMF. Fishes of the Amazon and their environment:
physiological and biochemical features. Heidelberg: Springer-Verlag; 1995.
19. Val AL, Kapoor BG. Fish adaptations. Enfield: Science and Publishing House
Publishers; 2003.
20. Tarazona S, García-Alcalde F, Dopazo J, Ferrer A, Conesa A. Differential
expression in RNA-seq: a matter of depth. Genome Res. 2011;21: 2213–2223.
doi: 10.1101/gr.124321.111.
21. Wang Z, Gerstein M, Snyder M. RNA-Seq: a revolutionary tool for
transcriptomics. Nat Rev Genet. 2009;10: 57–63. doi: 10.1038/nrg2484.
22. Oshlack A, Robinson MD, Young MD. From RNA-seq reads to differential
expression results. Genome Biol. 2010;11: 220. doi: 10.1186/gb-2010-11-12-
220.
23. Bilyk KT, Cheng CH. RNA-seq analyses of cellular responses to elevated body
temperature in the high Antarctic cryopelagic nototheniid fish Pagothenia
borchgrevinki. Mar Genomics. 2014;18: 163–171. doi:
10.1016/j.margen.2014.06.006.
24. Cossins AR, Crawford DL. Fish as models for environmental genomics. Nat
Rev Genet. 2005;6: 324–333. doi: 10.1038/nrg1590.
25. Hazel JR, Williams EE. The role of alterations in membrane lipid composition in
enabling physiological adaptation of organisms to their physical environment.
Prog Lipid Res. 1990;29: 167–227. doi: 10.1016/0163-7827(90)90002-3.
89
26. Vergauwen L, Benoot D, Blust R, Knapen D. 2010. Long-term warm or cold
acclimation elicits a specific transcriptional response and affects energy
metabolism in zebrafish. Comp Biochem Physiol A Mol Integr Physiol.
2010;157: 149–157.
27. Quinn NL, McGowan CR, Cooper GA, Koop BF, Davidson WS. Ribosomal
genes and heat shock proteins as putative markers for chronic, sublethal heat
stress in Arctic charr: applications for aquaculture and wild fish. Physiol
Genomics. 2011;43: 1056–1064. doi: 10.1152/physiolgenomics.00090.2011.
28. López-Olmeda JF, Sánchez-Vázquez FJ. Thermal biology of zebrafish (Danio
rerio). J Therm Biol. 2011;36: 91–104. doi: 10.1016/j.jtherbio.2010.12.005.
29. Logan CA, Somero GN. Effects of thermal acclimation on transcriptional
responses to acute heat stress in the eurythermal fish Gillichthys mirabilis
(Cooper). Am J Physiol Regul Integr Comp Physiol. 2011;300: R1373–R1383.
doi: 10.1152/ajpregu.00689.2010.
30. Szklarczyk D, Franceschini A, Wyder S, Forslund K, Heller D, Huerta-Cepas J,
et al. String v10: protein-protein interaction networks, integrated over the tree
of life. Nucleic Acids Res. 2015;43: D447–D452. doi: 10.1093/nar/gku1003.
31. Rozen S, Skaletsky H. Primer3 on the WWW for general users and for biologist
programmers. In: Krawetz S, Misener S, editors. Bioinformatics methods and
protocols: methods in molecular biology. Totowa, NJ: Humana Press; 2000.
32. National Center for Biotechnology Information (NCBI). Website. Available:
http://www.ncbi.nlm.nih.gov/genome/?term = danio+rerio. Accessed 02 Sep
2015.
33. Somero GN. The physiology of climate change: how potentials for
acclimatization and genetic adaptation will determine ‘winners’ and ‘losers’. J
Exp Biol. 2010;213: 912–920. doi: 10.1242/jeb.037473.
34. Jeffries KM, Hinch SG, Sierocinski T, Pavlidis P, Miller KM. Transcriptomic
responses to high water temperature in two species of Pacific salmon. Evol
Appl. 2014;7: 286–300. doi: 10.1111/eva.12119.
35. Hori TS, Gamperl AK, Afonso LO, Johnson SC, Hubert S, Kimball J, et al.
Heat-shock responsive genes identified and validated in Atlantic cod (Gadus
morhua) liver, head kidney and skeletal muscle using genomic techniques.
BMC Genomics. 2010;11: 72
90
36. Ju Z, Dunham RA, Liu Z. Differential gene expression in the brain of channel
catfish (Ictalurus punctatus) in response to cold acclimation. Mol Genet
Genomics. 2002;268: 87–95. doi: 10.1007/s00438-002-0727-9.
37. Windisch HS, Frickenhaus S, John U, Knust R, Pörtner HO, Lucassen M.
Stress response or beneficial temperature acclimation: transcriptomic
signatures in Antarctic fish (Pachycara brachycephalum). Mol Ecol. 2014;23:
3469–3482. doi: 10.1111/mec.12822.
38. Imsland AK, Folkvord A, Stefansson SO. Growth, oxygen consumption and
activity of juvenile turbot (Scophthalmus maximus L.) reared under different
temperatures and photoperiods. Neth J Sea Res. 1995;34: 149–159. doi:
10.1016/0077-7579(95)90023-3.
39. Quinn NL, McGowan CR, Cooper GA, Koop BF, Davidson WS. Identification of
genes associated with heat tolerance in Arctic charr exposed to acute thermal
stress. Physiol Genomics. 2011;43: 685–696. doi:
10.1152/physiolgenomics.00008.2011.
40. Val AL. Organic phosphates in the red blood cells of fish. Comp Biochem Phys
A. 2000;125: 417-435. doi: 10.1016/S1095-6433(00)00184-7.
41. Basu N, Todgham AE, Ackerman PA, Bibeau MR, Nakano K, Schulte PM, et
al. Heat shock protein genes and their functional significance in fish. Gene.
2002;295: 173–183. doi: 10.1016/S0378-1119(02)00687-X.
42. Wang S-J, Wu M-J, Chen X-J, Jiang Y, Yan Y-B. DsHsp90 is involved in the
early response of Dunaliella salina to environmental stress. Int J Mol Sci.
2012;13: 7963–7979. doi: 10.3390/ijms13077963.
43. Seebacher F, Brand MD, Else PL, Guderley H, Hulbert AJ, Moyes CD.
Plasticity of oxidative metabolism in variable climates: molecular mechanisms.
Physiol Biochem Zool. 2010;83: 721–732. doi: 10.1086/649964.
44. Kinoshita M, Kani S, Ozato K, Wakamatsu Y. Activity of the medaka translation
elongation factor 1α-A promoter examined using the GFP gene as a reporter.
Dev Growth Differ. 2000;42: 469–478. doi: 10.1046/j.1440-169x.2000.00530.x.
45. Fekete CA, Applefield DJ, Blakely SA, Shirokikh N, Pestova T, Lorsch JR, et al.
The eIF1A C-terminal domain promotes initiation complex assembly, scanning
and AUG selection in vivo. EMBO J. 2005;24: 3588–3601. doi:
10.1038/sj.emboj.7600821.
91
46. Podrabsky JE, Somero GN. Changes in gene expression associated with
acclimation to constant temperatures and fluctuating daily temperatures in an
annual killifish Austrofundulus limnaeus. J Exp Biol. 2004;207: 2237–2254. doi:
10.1242/jeb.01016.
47. Liu S, Wang X, Sun F, Zhang J, Feng J, Liu H, et al. RNA-Seq reveals
expression signatures of genes involved in oxygen transport, protein synthesis,
folding, and degradation in response to heat stress in catfish. Physiol
Genomics. 2013;45: 462–476. doi: 10.1152/physiolgenomics.00026.2013.
48. Ellers J, Mariën J, Driessen G, van Straalen NM. Temperature-induced gene
expression associated with different thermal reaction norms for growth Rate. J
Exp Zool B Mol Dev Evol. 2008;310: 137–147. doi: 10.1002/jez.b.21194.
49. Sun J, Ren L, Cheng Y, Gao J, Dong B, Chen S, et al. Identification of
differentially expressed genes in chrysanthemum nankingense (Asteraceae)
under heat stress by RNA Seq. Gene. 2014;552: 59–66. doi:
10.1016/j.gene.2014.09.013.
50. Watowich SS, Morimoto RI. Complex regulation of heat shock- and glucose-
responsive genes in human cells. Mol Cell Biol. 1988;8: 393–405. doi:
10.1128/MCB.8.1.393.
51. Abrahams MV, Mangel M, Hedges K. Predator-prey interactions and changing
environments: who benefits? Philos Trans R Soc Lond B Biol Sci. 2007;362:
2095–2104. doi: 10.1098/rstb.2007.2102.
52. Nowicki JP, Miller GM, Munday PL. Interactive effects of elevated temperature
and CO2 on foraging behavior of juvenile coral reef fish. J Exp Mar Biol Ecol.
2012;412: 46-51. doi: 10.1016/j.jembe.2011.10.020.
53. Feary DA, Burt JA, Bauman AG, Usseglio P, Sale PF, Cavalcante GH. Fish
communities on the world's warmest reefs: what can they tell us about the
effects of climate change in the future? J Fish Biol. 2010;77: 1931–1947. doi:
10.1111/j.1095-8649.2010.02777.x.
54. Papakostas S, Vøllestad LA, Bruneaux M, Aykanat T, Vanoverbeke J, Ning M, et
al. Gene pleiotropy constrains gene expression changes in fish adapted to
different thermal conditions. Nat Commun. 2014;5: 4071. doi:
10.1038/ncomms5071.
55. Lemgruber RdSP, Marshall NAdA, Ghelfi A, Fagundes DB, Val AL. Functional
Categorization of Transcriptome in the Species Symphysodon aequifasciatus
92
Pellegrin 1904 (Perciformes: Cichlidae) Exposed to Benzo[a]pyrene and
Phenanthrene PLoS ONE. 2013;8: e81083. doi: 10.1371/journal.pone.0081083.
56. Ji P, Liu G, Xu J, Wang X, Li J, Zhao Z, et al. Characterization of common carp
transcriptome: sequencing, de novo assembly, annotation and comparative
genomics. PLoS One. 2012;7: e35152. doi: 10.1371/journal.pone.0035152.
57. Narum SR, Campbell NR. Transcriptomic response to heat stress among
ecologically divergent populations of redband trout. BMC Genomics. 2015;16:
103. doi: 10.1186/s12864-015-1246-5.
58. Chen B, Piel WH, Gui L, Bruford E, Monteiro A. The HSP90 family of genes in
the human genome: insights into their divergence and evolution. Genomics.
2005;86: 627–637. doi: 10.1016/j.ygeno.2005.08.012.
59. Santana GX, Santos CHA, Sousa CFS, Nascimento PRM, Paula-Silva MN,
Sousa ACB, et al. Isolation of novel microsatellite markers for tambaqui
(Colossoma macropomum, Cuvier 1818), an important freshwater fish of the
Amazon. Conservation Genet Resour. 2012;4: 197–200. doi: 10.1007/s12686-
011-9507-3.
60. Hamoy IG, Cidade FW, Barbosa MS, Gonçalves EC, Santos S. Isolation and
characterization of tri and tetranucleotide microsatellite markers for the tambaqui
(Colossoma macropomum, Serrasalmidae, Characiformes). Conservation Genet
Resour. 2011;3: 33–36. doi: 10.1007/s12686-010-9275-5.
61. Santos MD, Hrbek T, Farias IP. Microsatellite markers for the tambaqui
(Colossoma macropomum, Serrasalmidae, Characiformes), an economically
important keystone species of the Amazon River floodplain. Mol Ecol Resour.
2009;9: 874–876. doi: 10.1111/j.1755-0998.2008.02331.x.
62. Prado-Lima M, Campos T, Sousa ACB, Souza AP, Almeida-Val VMF. Isolation
and characterization of microsatellite markers for Cichla monoculus (Agassiz,
1831), an important freshwater fish in the Amazon. Conservation Genet Resour.
2010;2: 215–218. doi: 10.1007/s12686-010-9240-3.
63. Iranawati F, Jung H, Chand V, Hurwood DA, Mather PB. Analysis of genome
survey sequences and SSR marker development for Siamese mud carp,
Henicorhynchus siamensis, using 454 pyrosequencing. Int J Mol Sci. 2012;13:
10807–10827. doi: 10.3390/ijms130910807.
64. O’Connell M, Wright JM. Microsatellite DNA in fishes. Rev Fish Biol Fish.
1997;7: 331–363. doi: 10.1023/A:1018443912945.
93
65. Vilas R, Vandamme SG, Vera M, Bouza C, Maes GE, Volckaert FA, et al. A
genome scan for candidate genes involved in the adaptation of turbot
(Scophthalmus maximus). Mar Genomics. 2015;23: 77-86. doi:
10.1016/j.margen.2015.04.011.
94
Supplementary material
Figures
S1 Figure: Tambaqui genes identified after five and fifteen days of exposure to the
B1, A1B and A2 climate scenarios grouped in cluster 1 using STRING software (v.
10).
95
S2 Figure: Tambaqui genes identified after five and fifteen days of exposure to the
B1, A1B and A2 climate scenarios grouped in cluster 2 using STRING software (v.
10).
96
S3 Figure: Tambaqui genes identified after five and fifteen days of exposure to the
B1, A1B and A2 climate scenarios grouped in cluster 3 using STRING software (v.
10).
97
S4 Figure: Tambaqui genes identified after five and fifteen days of exposure to the
B1, A1B and A2 climate scenarios grouped in cluster 4 using STRING software (v.
10).
98
S5 Figure: Tambaqui genes identified after five and fifteen days of exposure to the
B1, A1B and A2 climate scenarios grouped in cluster 5 using STRING software (v.
10).
99
Tables
S1 Table: The list of differentially expressed genes (Log2FC) of tambaqui after five
days of exposure to B1, A1B and A2 climate scenarios. Up-regulated genes are
shown with positive values and down-regulated genes are shown with negative
values.
Five days of exposition
Gene symbol B1 Scenario A1B Scenario A2 Scenario
A2ML1 (5 of 12) 2.174 1.288 1.153
AC024175.1 -1.415 -4.791 -1.642
AC024175.11 -1.428 -1.764 -2.903
AC024175.13 -1.237 -1.477 -2.283
AC024175.14 -3.587 -93.539 -93.539
AC024175.17 -1.328 -1.727 -1.98
AC024175.6 -1.112 -2.221 -2.282
AC024175.7 4.638 4.605 -31.24
AC024175.8 2.303 -97.023 -1.131
AC024175.9 2.637 1.029 1.208
acta1b -2.208 -1.014 -1.339
actc1b -1.591 1.095 -1.184
ACVR2B (1 of 2) 2.616 4.631 7.597
Adss -5.739 1.096 -1.008
AL929108.1 5.227 -21.065 -21.065
AL935186.3 -1.797 -5.291 -2.062
Aldoaa -3.935 -2.237 -1.306
Aldoab -4.239 -1.361 -2.124
anp32b 1.847 -1.259 -1.349
arhgef9b_2 -4.073 -4.64 -4.688
arl8bb -2.233 2.305 2.611
arpc3 -1.198 -2.673 1.197
atg4a 2.055 5.596 -1.414
atp2a1l -3.825 -1.1 -1.265
atp2a2b -4.553 1.79 -1.161
atp5a1 -2.81 -1.112 -1.089
ATP5B -2.994 -1.191 1.026
atp5c1 -2.585 -1.231 -1.684
atp5d -1.67 -1.662 -1.92
atp5h 1.016 -1.21 -1.697
Bhmt -3.513 -2.274 -1.077
btf3 -1.598 1.325 2.251
BX470224.1 1.147 -1.627 3.412
BX548011.3_1 2.364 1.135 1.333
CABZ01055869.1 -1.278 -3.28 -148.539
100
CABZ01061343.1 93.445 1 1
CABZ01076182.1 -32.265 -32.265 -32.265
CABZ01077555.1 6.606 27.918 15.989
capn1a -8.046 -2.627 -4.7
ccng1 -1.115 2.39 3.601
cdh23_2 -1.394 -1.677 -2.194
cep89 -2.004 -1.293 2.085
Ckma -1.733 -1.475 -1.518
Ckmb -2.322 -1.358 -1.318
ckmt1 -2.52 -1.109 -1.11
cmc4 -1.249 -5.794 -4.401
cox4i2 -11.376 -1.51 -3.53
cox7c -1.282 -3.077 1.315
cox8b -2.699 -1.772 -2.402
cpn1_2 3.051 2.051 -1.097
CR354374.1 -1.54 1.041 -2.245
CR356235.1 48.411 1 1
CR381646.1 -1.402 -45.81 -2.241
CR450736.2 -3.646 1.22 1.482
CR854899.1 255.709 355.202 1
CR936200.1_1 2.612 1.146 -1.216
creb3l3l -2.466 1.11 7.259
cstf2_1 3.568 1.012 1.209
CU459159.1 1 38.331 1
CU570683.1 10.145 19.967 23.423
CU633479.5_1 -3.952 -1.253 2.269
CU929274.1 1.002 -81.378 -81.378
cxcr3.1_1 2.076 1.398 1.433
Dbi 11.457 12.846 5.819
Ddost 2.451 2.01 3.198
Desma 1.289 2.062 1.941
dicp1.1 -1.347 -3.469 -1.259
dlg3_2 3.646 1.598 1.654
dnaja2 -2.864 -1.376 -1.415
dnajc7_2 5.065 5.969 2.234
dre-let-7a-1 1.712 -103.825 -1.925
dre-let-7a-4 -1.427 -61.669 2.254
dre-let-7c-2 2.817 3.721 5.532
dre-let-7d-1 100.024 1 49.639
dre-let-7d-2 84.961 64.599 57.037
dre-let-7f 16.173 1 28.652
dre-mir-125a-2 42.165 1 1
dre-mir-193a-2 45.976 1 1
dre-mir-206-2 1.734 -1.104 1.751
dre-mir-20b -60.971 -60.971 -3.199
dre-mir-21-2 1 15.671 53.275
101
dre-mir-301c 1 1 36.96
dre-mir-363 -3.988 -1.794 -59.262
dre-mir-731 58.59 1 1
edil3 3.538 10.618 5.203
eef2l2 -1.878 -1.369 1.107
efr3a_2 2.388 1.21 1.001
eif3f 2.113 1.264 1.135
eif3m -1.883 1.092 1.115
eif4ebp3l -1.335 -1.432 -2.751
eno1a -5.643 -7.741 -1.309
eno3 -3.388 -2.06 -1.611
ENSDARG00000041884 3.247 2.64 1.9
ENSDARG00000071292 -2.688 -1.329 2.461
ENSDARG00000088545 95.301 14.619 5.694
ENSDARG00000091099 1.436 5.715 5.346
FBXL6 2.491 -1.74 -2.416
FER1L6 -15.823 -3.65 -8.985
Fh -3.469 -1.119 -1.194
FP102784.1 6.397 3.556 -4.975
Gapdh -3.189 -1.321 -1.466
Gapdhs -3.272 -1.856 -1.463
Gcdhl -5.069 -1.45 1.68
Gpib -10.688 -1.203 -1.835
her9 -1.074 2.041 1.606
hip1ra -8.784 -2.096 -3.488
hmgb1a -1.722 -2.413 -1.931
HSCB 1.76 2.209 1.844
hsp90aa1.1 1.124 2.389 3.465
ical1_1 1.382 2.116 1.047
IDH2 -1.85 -1.265 -1.647
IFT43_2 35.882 1 19.915
kcnab1_1 1.989 -1.455 -1.349
kif22 19.187 -4.436 5.065
lama2_1 1.755 -1.105 -1.176
lhfpl2a 1.406 -1.661 -2.369
lhfpl2b_2 15.019 2.976 4.816
lsm12b -5.189 -1.54 -1.35
map4k2l_2 3.271 -1.055 -1.501
me2_1 1.581 -1.146 -1.641
Metazoa_SRP_2 59.604 14.79 6.115
Metazoa_SRP_56 1 29.74 1
mhc1zaa_2 -1.089 -1.14 -3.138
mospd1 -9.36 -8.567 -3.124
MTHFS 7.442 4.056 24.842
MUSTN1 5.369 14.364 38.182
MYH13 (5 of 11) -2.561 1.158 1.808
102
myhz1.3 -3.906 1.23 1.332
myl1 -1.134 1.901 1.448
myl10 -2.568 1.361 8.015
MYL2 (1 of 2) -4.99 2.818 6.899
MYL3 -3.177 2.62 11.621
Mylpfb -3.199 1.843 3.341
mylz3 -2.075 -1.106 -1.051
ndufs4 -4.021 -3.862 -1.405
ngfrb_1 -1.212 1.242 -2.358
nipsnap3 -5.069 -1.767 -1.729
nmrk2 5.359 7.937 5.455
Nnt 1.698 3.589 1.205
nphp3 -2.687 -2.743 -4.803
Nudc 1.23 -2.24 1.031
OTTDARG00000019147_1 -2.5 -10.402 -2.181
pabpc4 -1.928 -1.312 1.077
PET100 1.68 1.199 2.893
pfdn2 -1.378 1.621 3.999
pgk1 -3.3 -1.019 -1.234
pgm1 -3.206 -1.725 -1.509
Pkmb -5.666 -1.415 -1.197
Pomp -2.064 -2.324 -2.348
psma1 -2.726 -1.704 -4.381
psma2 1.424 -1.368 -4.261
psma3 -3.814 -2.145 -2.055
psmb3 -3.859 -2.404 -2.806
pthlhb_2 -3.219 -2.061 -7.976
ptpn9b -5.287 1.078 -1.453
pvalb1 1.039 1.106 -1.381
rab10 -2.238 -5.857 -2.148
rbm19 -3.354 1.194 -1.393
rn7sk -1.474 -1.728 -2.217
rpl11 -1.605 1.118 -1.449
rpl22 1.583 2.034 1.426
rpl35 -1.181 -1.555 -1.083
rpl6 3.207 7.783 35.03
rpl7 -2.356 -1.515 -1.314
rps10 2.208 1.956 2.97
rps27.2_1 -1.288 -1.015 -1.63
rps29 10.681 4.009 6.317
rps3 -1.629 -1.168 1.403
Rpsa -1.584 -1.487 1.097
rtn2a -3.465 -2.398 -1.914
scn1a_2 -4.251 -3.138 -3.262
Sdhb -5.083 -2.757 -1.641
si:ch1073-140o9.2 -2.207 -1.129 3.627
103
si:ch211-122a17.5 1 47.534 65.228
si:ch211-122l24.5 -5.539 2.846 6.512
si:ch211-130l20.1 52.716 1 1
si:ch211-238p8.23 4.216 -1.276 1.783
si:ch211-241d24.2 1.048 -32.529 -3.761
si:ch211-242m24.8 1 1 26.102
si:ch211-37e10.1 4.32 1.485 1.301
si:ch211-39k3.2 1.087 -3.194 -1.596
si:ch211-59c24.1 -1.313 -8.559 -3.319
si:ch73-191k20.4 34.213 9.716 4.468
si:ch73-346o4.2 6.973 28.429 7.737
si:dkey-15h8.10 -5.996 -1.016 1.325
si:dkey-17m8.1 2.131 -1.224 1.208
si:dkey-186k21.2 37.868 26.195 7.779
si:dkey-234n3.3 -23.253 -23.253 -23.253
si:dkey-267i17.3 5.092 36.106 6.167
si:dkey-34e4.1 12.263 5.353 1.909
si:dkey-52l6.2 26.459 10.276 12.651
si:dkey-86e18.1 1.433 1.914 1.194
slc25a4 -1.991 -2.015 -1.596
smarcal1 -3.323 -2.32 -6.086
smyhc1 -1.886 1.282 2.772
SNORA17 38.671 1 1
SNORA9_2 -2.294 -78.718 -78.718
snoZ178 37.465 19.204 198.783
SPTBN4 (1 of 2) 10.132 1.757 -1.384
ssr3_2 -1.897 -33.199 -3.507
stxbp1a -1.917 2.271 -1.065
tank_1 -1.127 -1.982 -2.373
TARS2 (1 of 2) -5.619 -3.116 -2.525
thoc7 4.993 2.051 3.19
tmem167b_1 2.547 1.59 1.113
tmem55a 710.93 -3.561 -3.561
TNFRSF9 (2 of 2) -4.796 5.832 56.282
tnnc1a 1.565 2.592 30.773
tnnc1b -4.037 1.666 8.398
TNNC2 (2 of 2) 5.244 17.074 10.416
tnni2a.1 -1.439 -1.703 -1.465
tnni2a.4 -1.034 2.789 1.482
tnnt1 4.144 4.107 3.938
tomm20b -3.047 -2.328 -2.057
tpi1a -5.416 -1.344 -1.155
tpm2 -1.133 2.089 6.497
tpm3 -1.308 3.024 3.663
Tpma -2.409 1.374 1.275
txndc12 -5.319 1.195 -1.248
104
U1_101 24.934 1 1
U3_15 -1.449 -9.113 -22.542
U6_2 -3.86 -65.905 -65.905
ubxn6 -2.715 1.023 -1.272
ugt2b6_1 1.85 -1.174 -1.158
Ungb 8.259 22.533 1.342
v2rh25p 29.068 4.745 11.195
Vault_4 38.671 1 1
Vcp -5.996 -1.65 -1.757
WDR70 (1 of 2) 36.128 8.439 4.019
xrcc5_1 -1.881 -1.81 -3.714
zak_1 1.664 4.728 1.176
zgc:153129 -27.503 -1.784 -4.617
zgc:165409_2 -1.435 -5.547 -14.411
zgc:65894 1.448 3.02 11.202
zgc:86598 -4.076 -1.197 -1.06
zgc:91860 1.325 -1.437 -1.855
105
S2 Table: The list of differentially expressed genes (Log2FC) of tambaqui after fifteen
days of exposure to B1, A1B and A2 climate scenarios. Up-regulated genes are
shown with positive values and down-regulated genes are shown with negative
values.
Fifteen days of exposition
Gene symbol B1 Scenario A1B Scenario A2 Scenario
abca12 3.537 -1.935 1.567 abce1 -1.69 -11.541 -1.912 AC024175.1 -15.542 1.065 -2.27 AC024175.11 -2.292 1.608 -1.847 AC024175.13 -3.738 -1.179 -2.237
AC024175.17 -3.653 -1.44 -2.323
AC024175.4 -1.909 -1.07 -1.259
AC024175.6 -3.31 1.44 -2.019
AC024175.9 -4.043 2.935 2.081
actc1a -1.994 -3.548 -1.63
actn2 -1.031 -5.925 -1.459
actr3b 1.056 -5.167 -1.749
ACVR2B (1 of 2) -1.118 -7.484 -3.065
AL845481.1 -2.623 -1.028 -58.662
AL929192.1 -7.423 -42.884 -42.884
AL935186.3 -1.314 1.367 -5.339
AL935186.6 -1.33 1.919 1.234
aldocb -2.517 -6.145 -5.47
ampd3b -1.358 -2.252 -3.125
arpc3 1.037 -2.695 -1.643
atp5l -1.855 1.084 -1.148
atpif1b 2.46 18.894 14.318
bcl2_2 -1.227 1.658 1.123
bin3 31.527 1 34.876
BIN3 (2 of 2) 33.668 1 4.962
btf3 -1.77 -10.563 -2.192
BX005423.2 -37.367 -37.367 -1.534
BX322605.3 2.886 25.793 3.364
BX548011.3_1 -1.591 -1.122 -1.171
BX890616.1 -1.189 1.521 3.769
CABZ01025931.1 -5.754 1.713 2.5
CABZ01041280.1 27.687 11.276 25.724
calm2a -1.418 -2.376 -2.507
calm3a -1.919 -2.874 -1.567
casq1b 1.184 -2.355 -1.571
ccng1 -2.152 -3.466 -8.178
chchd10 -2.673 -6.581 1.006
106
clasrp 38.746 10.065 -1.545
clk4a 1.051 -1.673 3.154
col5a3a_1 -1.94 3.168 2.329
cops3 -1.927 -5.353 -1.653
cox5b2 -5.997 -2.881 -48.526
CR318660.2 49.585 1 1
CR354374.1 -4.112 1.175 -1.227
CR354382.1 1 1 45.405
CR354430.2 -65.91 -2.337 -65.91
CR790365.1 18.206 72.803 60.316
CR847944.3 1 159.101 1
CR854899.1 191.493 1 25.381
creb3l3l -8.451 -6.314 -1.816
ctnnd1_2 -1.109 2.237 1.592
CU633479.5_1 3.09 -1.05 1.361
CU984584.1 4.135 6.537 2.41
cxcl-c5c 5.163 24.858 5.659
ddx56 -6.631 -17.802 -2.089
desma -1.975 -3.991 -1.797
desmb 1.198 -3.035 1.199
dicp1.1 -2.982 -2.414 -4.124
dre-let-7a-1 -1.093 -1.015 -89.706
dre-let-7a-2 1.349 2.924 -76.928
dre-let-7a-3 -2.215 -2.946 -1.645
dre-let-7a-4 -3.621 -4.957 -139.727
dre-let-7a-5 1.154 -39.845 -1.159
dre-let-7d-1 -34.74 -1.293 -34.74
dre-mir-125b-2 -2.519 -56.941 -2.22
dre-mir-130b 20.493 69.759 99.54
dre-mir-142a 1 64.428 1
dre-mir-15a-1 1.129 -37.736 -37.736
dre-mir-181a-1 -39.98 1.483 -39.98
dre-mir-206-2 -1.754 -2.802 -1.241
dre-mir-210 -1.186 -88.136 -88.136
dre-mir-2188 34.612 1 20.637
dre-mir-218b 1 65.136 1
dre-mir-222b -34.746 -1.156 -34.746
dre-mir-363 21.539 -1.706 2.082
dre-mir-454b -2.149 -66.921 114.024
eef1a1a -1.265 -2.33 -3.688
eef1a1l1 -1.441 -2.164 -1.488
eef1a2 -1.647 -8.341 -1.48
efr3a_2 1.649 2.905 1.509
eif2s1b -5.704 -1.48 -1.299
eif4a3 -1.229 -4.222 -1.423
eif4eb -1.364 -26.474 -4.209
107
eif4ebp3l -1.466 -3.262 -1.615
ENSDARG00000073911 -1.029 -29.118 1.558
ENSDARG00000086253 -6.631 9.189 -6.631
ENSDARG00000088545 -6.245 9.845 -6.245
ENSDARG00000091099 1.546 -7.45 -2.004
ENSDARG00000094466 -1.522 -23.501 -2.571
ENSDARG00000096531 -1.257 -4.726 1.246
FER1L6 -1.46 -5.087 -2.849
FIS1 -3.74 -6.596 -5.249
GABARAP (2 of 2) 1.375 -3.316 -1.028
heatr5a_1 -1.889 3.461 1.054
her9 2.119 1.177 3.539
hmgb1a -1.842 -4.908 -1.181
hoxd3a 55.467 -1.749 -1.749
hsp90aa1.2 1.34 -18.356 -1.648
Hypk -2.63 -2.581 -2.02
Iars -2.312 -5.766 -1.64
kdm7ab 23.681 -1.296 -1.077
KLHDC8A 57.146 -2.482 13.435
lamtor2 12.788 4.297 29.943
Ldha -1.126 -3.705 -1.721
map4k2l_2 -3.067 -3.051 -2.419
mdh2 -1.564 -1.499 -1.359
Metazoa_SRP_23 -12.267 -4.251 -1.049
Metazoa_SRP_24 -23.171 -2.379 -23.171
Metazoa_SRP_38 3.863 9.774 1.193
mob4 1.008 -25.959 -2.522
mpc1 1.177 -4.901 -2.446
MTBP -1.828 3.661 1.793
MYH13 (10 of 11) 1.039 -5.111 -3.712
myl10 -9.559 -3.748 -2.687
MYL3 -8.388 -1.732 -2.259
mylpfb -1.385 -5.255 -2.677
naa10 -2.792 -5.044 -1.239
ndufa12 -5.742 1.231 -1.911
ndufaf6 -1.094 4.101 1.47
NDUFC2 -1.417 2.064 1.591
ndufv1 -1.741 -2.859 -1.543
nwd1_2 -3.272 -3.055 -1.616
Ostc -4.648 -2.55 -1.561
OXR1 (2 of 2) -1.689 -40.804 -2.167
parvb -1.038 -3.599 -1.242
pdap1b -1.609 -4.138 -1.99
pdlim7 1.861 -4.67 1.109
pfdn2 -2.897 -9.682 -2.246
prkag3b 4.991 -1.416 7.286
108
prmt1 -2.216 -24.793 -2.541
rbm8a -1.403 -3.084 -1.533
Rheb -1.805 -2.829 -2.171
rn7sk -4.028 -1.173 -2.461
rock2a 11.765 1.726 1.192
rpl13 -3.677 -2.207 -1.304
rpl14 -1.774 1.474 1.28
rpl18a -2.18 -2.574 -1.858
rpl19 -1.934 1.039 -1.398
rpl23 -2.051 1.253 1.163
rpl28 -1.897 1.05 -1.12
rpl3 -2.332 -1.16 -1.229
rpl32 -1.71 1.888 1.152
rpl35 -4.35 -1.042 -1.935
rpl36a -1.792 1.62 -1.017
rpl5a -1.909 1.749 1.143
rpl7 -1.993 -1.662 -1.163
rplp2 -1.488 1.702 1.172
rps10 -2.453 -1.032 -1.289
rps16 -1.286 1.642 -1.098
rps23 -1.254 1.468 -1.041
rps24 -3.95 2.206 -1.015
rps26 -1.936 1.071 1.04
rps26l -2.053 1.146 -1.511
rps27.1 -1.497 -1.127 -1.404
rps3a -1.777 1.184 -1.136
Rpsa -1.73 -1.187 -1.177
rtn2b -1.062 -9.541 -1.558
scn1a_2 1.89 3.587 1.951
SHISA7 (1 of 2) -1.343 -3.898 -1.645
si:ch1073-140o9.2 3.025 -1.568 -1.657
si:ch211-37e10.1 1.001 3.72 1.363
si:ch211-39k3.2 -1.559 -3.201 -2.088
si:ch211-59c24.1 -8.472 1.457 2.249
si:ch73-106n3.1 -5.941 -1.072 2.229
si:dkey-111b14.2 -5.253 -1.36 -2.48
si:dkey-151g10.6 -2.099 1.001 -1.713
si:dkey-153m14.1 -1.786 1.146 -1.255
si:dkey-16m19.1_2 -1.739 -51.973 -1.092
si:dkey-1b17.10 5.22 -2.277 2.319
si:dkey-240k8.2 31.051 1 1
si:dkey-41e15.4 -4.831 -2.098 1.263
si:dkey-86e18.1 1.852 2.387 2.311
si:dkeyp-84g1.2 22.863 1 9.819
slc25a4 -1.292 -2.418 -2.101
slc4a4b -2.735 1.476 -1.077
109
SMIM4 5.317 -14.296 -1.511
SNORA3_4 43.599 1 1
SNORD31_2 1.428 3.404 -91.533
snR56 -564.829 -7.481 -564.829
snrpb -4.447 -2.482 -1.307
soul4_1 2.382 -1.406 7.944
sparc -1.79 -15.228 -1.666
spcs1 -2.833 -2.171 -5.309
sssca1 -8.74 -6.637 -1.885
tcp1 -1.859 -3.275 -1.738
thoc7 -2.564 -13.11 -1.101
tmem38a -1.324 -5.143 -2.999
tmsb4x -1.058 -2.424 1.02
tnnc1a -10.433 -2.413 1.055
tnnc1b -4.96 -2.945 -1.066
tnnt3b -2.307 -1.8 -1.26
tomm20b -1.877 -4.951 -2.17
TSG101 (3 of 3) 13.702 10.623 28.24
U1_25 1 1 26.211
U2_9 1.302 2.822 1.493
u2af1 -2.012 -5.379 -1.996
U3_27 1.08 1.551 6.55
U6_234 -150.018 2.364 -2.515
U8_8 -1.279 3.026 -1.573
ugt2b6_1 -1.053 2.456 1.431
uqcrc1 -1.442 -6.095 -2.971
utp18 -3.263 -7.462 -1.941
vbp1 -2.723 -3.968 -6.275
WWP1 1.43 -5.171 -2.085
ybx1 -2.909 -5.797 -1.78
zgc:113295_1 -1.519 1.851 1.006
zgc:171759_4 -1.307 3.092 1.413
zgc:65894 -1.613 -12.707 -3.023
ZP2 (1 of 4) -1.974 -1.873 -2.536
110
S3 Table: Genes of tambaqui after five and fifteen days of B1, A1B and A2 climate scenarios exposure grouped in five clusters
using STRING software (v. 10).
STRING protein name
STRING id Gene name and description
Cluster 1
mob4 7955.ENSDARP00000072975 MOB family member 4, phocein tcp1 7955.ENSDARP00000104575 t-complex polypeptide 1
vbp1 7955.ENSDARP00000111810 von Hippel-Lindau binding protein 1
pfdn2 7955.ENSDARP00000035261 prefoldin subunit 2
zgc:65894 7955.ENSDARP00000002175 zgc:65894; Tubulin is the major constituent of microtubules. It binds two moles of GTP, one at an exchangeable site on the beta chain and one at a non-exchangeable site on the alpha chain (By similarity)
hsp90aa1.1 7955.ENSDARP00000022302
heat shock protein 90, alpha (cytosolic), class A member 1, tandem duplicate 1; Molecular chaperone that promotes the maturation, structural maintenance and proper regulation of specific target proteins involved for instance in cell cycle control and signal transduction. Undergoes a functional cycle that is linked to its ATPase activity. This cycle probably induces conformational changes in the client proteins, thereby causing their activation. Interacts dynamically with various co-chaperones that modulate its substrate recognition, ATPase cycle and chaperone function (By similarity). [...]
dnaja2 7955.ENSDARP00000028641 DnaJ (Hsp40) homolog, subfamily A, member 2
hsp90aa1.2 7955.ENSDARP00000026065 heat shock protein 90, alpha (cytosolic), class A member 1, tandem duplicate 2
zgc:86598 7955.ENSDARP00000024748 zgc:86598
Cluster 2
ATP5B 7955.ENSDARP00000060309 ATP synthase, H+ transporting, mitochondrial F1 complex, beta polypeptide; Produces ATP from ADP in the presence of a proton gradient across the membrane (By similarity)
atp5a1 7955.ENSDARP00000027947 ATP synthase, H+ transporting, mitochondrial F1 complex, alpha subunit 1, cardiac muscle; Produces ATP from ADP in the presence of a proton gradient across the membrane (By similarity)
atp5h 7955.ENSDARP00000038799 ATP synthase, H+ transporting, mitochondrial F0 complex, subunit d
atp5l 7955.ENSDARP00000007716 ATP synthase, H+ transporting, mitochondrial F0 complex, subunit g
111
atp5d 7955.ENSDARP00000022528 ATP synthase, H+ transporting, mitochondrial F1 complex, delta subunit
atp5c1 7955.ENSDARP00000066929
ATP synthase, H+ transporting, mitochondrial F1 complex, gamma polypeptide 1; Mitochondrial membrane ATP synthase (F(1)F(0) ATP synthase or Complex V) produces ATP from ADP in the presence of a proton gradient across the membrane which is generated by electron transport complexes of the respiratory chain. F-type ATPases consist of two structural domains, F(1) - containing the extramembraneous catalytic core, and F(0) - containing the membrane proton channel, linked together by a central stalk and a peripheral stalk. During catalysis, ATP synthesis in the catalytic domain of F(1) is cou [...]
ndufs4 7955.ENSDARP00000051054 NADH dehydrogenase (ubiquinone) Fe-S protein 4, (NADH-coenzyme Q reductase) ndufv1 7955.ENSDARP00000052929 NADH dehydrogenase (ubiquinone) flavoprotein 1
ndufa12 7955.ENSDARP00000062277 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 12
NDUFC2 7955.ENSDARP00000110392
NADH dehydrogenase (ubiquinone) 1, subcomplex unknown, 2, 14.5kDa; Accessory subunit of the mitochondrial membrane respiratory chain NADH dehydrogenase (Complex I), that is believed not to be involved in catalysis. Complex I functions in the transfer of electrons from NADH to the respiratory chain. The immediate electron acceptor for the enzyme is believed to be ubiquinone (By similarity)
uqcrc1 7955.ENSDARP00000108798 ubiquinol-cytochrome c reductase core protein I
cox7c 7955.ENSDARP00000069896 cytochrome c oxidase, subunit VIIc
cox4i2 7955.ENSDARP00000095260 cytochrome c oxidase subunit IV isoform 2
cox5b2 7955.ENSDARP00000105206 cytochrome c oxidase subunit Vb 2
Cluster 3 aldoaa 7955.ENSDARP00000119413 aldolase a, fructose-bisphosphate, a
aldocb 7955.ENSDARP00000024492 aldolase C, fructose-bisphosphate, b
pgm1 7955.ENSDARP00000006510 phosphoglucomutase 1
gapdhs 7955.ENSDARP00000058383
glyceraldehyde-3-phosphate dehydrogenase, spermatogenic; Glyceraldehyde-3-phosphate dehydrogenase is a key enzyme in glycolysis that catalyzes the first step of the pathway by converting D-glyceraldehyde 3-phosphate (G3P) into 3-phospho-D- glyceroyl phosphate (By similarity)
eno3 7955.ENSDARP00000120742 enolase 3, (beta, muscle)
gpib 7955.ENSDARP00000014578 glucose phosphate isomerase b
112
Gapdh 7955.ENSDARP00000063799
glyceraldehyde-3-phosphate dehydrogenase; Has both glyceraldehyde-3-phosphate dehydrogenase and nitrosylase activities, thereby playing a role in glycolysis and nuclear functions, respectively. Glyceraldehyde-3-phosphate dehydrogenase is a key enzyme in glycolysis that catalyzes the first step of the pathway by converting D-glyceraldehyde 3- phosphate (G3P) into 3-phospho-D-glyceroyl phosphate. Modulates the organization and assembly of the cytoskeleton. Also participates in nuclear events including transcription, RNA transport, DNA replication and apoptosis. Nuclear functions are prob [...]
pgk1 7955.ENSDARP00000070807 phosphoglycerate kinase 1
eno1a 7955.ENSDARP00000003738 enolase 1a, (alpha)
ldha 7955.ENSDARP00000059885 lactate dehydrogenase A4
eno2 7955.ENSDARP00000032456 enolase 2
tpi1a 7955.ENSDARP00000033907 triosephosphate isomerase 1a
pkmb 7955.ENSDARP00000122764 pyruvate kinase, muscle, b
aldoab 7955.ENSDARP00000042199 aldolase a, fructose-bisphosphate, b
Cluster 4 ns:zf-e68 7955.ENSDARP00000111326 myosin, heavy polypeptide 1.3, skeletal muscle
myl10 7955.ENSDARP00000050204 myosin, light chain 10, regulatory
actc1a 7955.ENSDARP00000100434 hm:zewp0073
tpma 7955.ENSDARP00000039656
alpha-tropomyosin; Binds to actin filaments in muscle and non-muscle cells. Plays a central role, in association with the troponin complex, in the calcium dependent regulation of vertebrate striated muscle contraction. Smooth muscle contraction is regulated by interaction with caldesmon. In non-muscle cells is implicated in stabilizing cytoskeleton actin filaments
actc1b 7955.ENSDARP00000055135 actin, alpha, cardiac muscle 1b
ckma 7955.ENSDARP00000037871 creatine kinase, muscle a
ckmb 7955.ENSDARP00000059365 creatine kinase, muscle b
pdlim7 7955.ENSDARP00000044908 PDZ and LIM domain 7
tnnc2 7955.ENSDARP00000095111 troponin C type 2 (fast)
myl1 7955.ENSDARP00000004932 myosin, light chain 1, alkali; skeletal, fast
mylz3 7955.ENSDARP00000018197 myosin, light polypeptide 3, skeletal muscle
smyhc1 7955.ENSDARP00000056852 slow myosin heavy chain 1
tpm3 7955.ENSDARP00000004352 tropomyosin 3
113
slc25a4 7955.ENSDARP00000030881 solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 4 atp2a1l 7955.ENSDARP00000096674 ATPase, Ca++ transporting, cardiac muscle, fast twitch 1 like
desma 7955.ENSDARP00000075994 desmin a
tnnt3b 7955.ENSDARP00000105443 troponin T3b, skeletal, fast
mylpfb 7955.ENSDARP00000023063 myosin light chain, phosphorylatable, fast skeletal muscle b
rock2a 7955.ENSDARP00000122621 rho-associated, coiled-coil containing protein kinase 2a
myl2 7955.ENSDARP00000116241 myosin, light polypeptide 2, regulatory, cardiac, slow
LOC567740 7955.ENSDARP00000122502 Uncharacterized protein
tnni2a.4 7955.ENSDARP00000037759 troponin I, skeletal, fast 2a.4
MYL3 7955.ENSDARP00000066500 myosin, light chain 3, alkali; ventricular, skeletal, slow
pvalb1 7955.ENSDARP00000055061 parvalbumin 1
tmem38a 7955.ENSDARP00000037150 transmembrane protein 38A; Monovalent cation channel required for maintenance of rapid intracellular calcium release. May act as a potassium counter-ion channel that functions in synchronization with calcium release from intracellular stores (By similarity)
tnnc1b 7955.ENSDARP00000054663 troponin C type 1b (slow)
actn2 7955.ENSDARP00000095652 actinin, alpha 2
desmb 7955.ENSDARP00000065355 desmin b
tnnc1a 7955.ENSDARP00000025541 troponin C type 1a (slow)
tnni2a.1 7955.ENSDARP00000031650 troponin I, skeletal, fast 2a.1
calm1a 7955.ENSDARP00000092307 calmodulin 1b; Calmodulin mediates the control of a large number of enzymes, ion channels and other proteins by Ca(2+). Among the enzymes to be stimulated by the calmodulin-Ca(2+) complex are a number of protein kinases and phosphatases
tnnt1 7955.ENSDARP00000044153 troponin T2c, cardiac Cluster 5
eif4ebp3l 7955.ENSDARP00000060989 eukaryotic translation initiation factor 4E binding protein 3, like; Regulates eif4e1a activity by preventing its assembly into the eIF4F complex (By similarity)
eif2s1 7955.ENSDARP00000068470 eukaryotic translation initiation factor 2, subunit 1 alpha
EIF3F 7955.ENSDARP00000099664
eukaryotic translation initiation factor 3, subunit F; Component of the eukaryotic translation initiation factor 3 (eIF-3) complex, which is involved in protein synthesis and, together with other initiation factors, stimulates binding of mRNA and methionyl-tRNAi to the 40S ribosome (By similarity)
114
eef1a1a 7955.ENSDARP00000104468 eukaryotic translation elongation factor 1 alpha 1a; This protein promotes the GTP-dependent binding of aminoacyl-tRNA to the A-site of ribosomes during protein biosynthesis (By similarity)
rpl11 7955.ENSDARP00000063869 ribosomal protein L11
rpl5a 7955.ENSDARP00000006085 ribosomal protein L5a
rpl7 7955.ENSDARP00000018980 ribosomal protein L7
rps26 7955.ENSDARP00000105328 ribosomal protein S26
rps3a 7955.ENSDARP00000051762 ribosomal protein S3A
rpsa 7955.ENSDARP00000123183
ribosomal protein SA; Required for the assembly and/or stability of the 40S ribosomal subunit. Required for the processing of the 20S rRNA- precursor to mature 18S rRNA in a late step of the maturation of 40S ribosomal subunits. Also functions as a cell surface receptor for laminin. Plays a role in cell adhesion to the basement membrane and in the consequent activation of signaling transduction pathways. May play a role in cell fate determination and tissue morphogenesis (By similarity)
rps29 7955.ENSDARP00000060443 ribosomal protein S29
rps26l 7955.ENSDARP00000111782 ribosomal protein S26, like
eif4a3 7955.ENSDARP00000027276
eukaryotic translation initiation factor 4A, isoform 3; ATP-dependent RNA helicase. Component of a splicing- dependent multiprotein exon junction complex (EJC) deposited at splice junction on mRNAs. The EJC is a dynamic structure consisting of a few core proteins and several more peripheral nuclear and cytoplasmic associated factors that join the complex only transiently either during EJC assembly or during subsequent mRNA metabolism. Core components of the EJC, that remains bound to spliced mRNAs throughout all stages of mRNA metabolism, functions to mark the position of the exon-exon [...]
rps3 7955.ENSDARP00000067802 ribosomal protein S3
eef2l2 7955.ENSDARP00000051080 eukaryotic translation elongation factor 2, like 2
rps27.1 7955.ENSDARP00000029079 ribosomal protein S27, isoform 1
rps23 7955.ENSDARP00000035273 ribosomal protein S23
rpl18a 7955.ENSDARP00000038658 ribosomal protein L18a
rps27.2 7955.ENSDARP00000072300 ribosomal protein S27, isoform 2
rpl35 7955.ENSDARP00000018594 ribosomal protein L35; Plays an essential role in early embryonic development. May act as a haploinsufficient tumor supressor
115
rpl28 7955.ENSDARP00000024189 ribosomal protein L28
rpl22 7955.ENSDARP00000111487 ribosomal protein L22
eef1a1l1 7955.ENSDARP00000111742 eukaryotic translation elongation factor 1 alpha 1, like 1; This protein promotes the GTP-dependent binding of aminoacyl-tRNA to the A-site of ribosomes during protein biosynthesis (By similarity)
rpl3 7955.ENSDARP00000003700 ribosomal protein L3
rpl32 7955.ENSDARP00000060004 ribosomal protein L32
ddost 7955.ENSDARP00000054289
dolichyl-diphosphooligosaccharide-protein glycosyltransferase; Essential subunit of the N-oligosaccharyl transferase (OST) complex which catalyzes the transfer of a high mannose oligosaccharide from a lipid-linked oligosaccharide donor to an asparagine residue within an Asn-X-Ser/Thr consensus motif in nascent polypeptide chains (By similarity)
rplp2 7955.ENSDARP00000025616 ribosomal protein, large P2
spcs1 7955.ENSDARP00000076814 signal peptidase complex subunit 1 homolog (S. cerevisiae)
rbm8a 7955.ENSDARP00000026575
RNA binding motif protein 8A; Component of a splicing-dependent multiprotein exon junction complex (EJC) deposited at splice junction on mRNAs. The EJC is a dynamic structure consisting of a few core proteins and several more peripheral nuclear and cytoplasmic associated factors that join the complex only transiently either during EJC assembly or during subsequent mRNA metabolism. Core components of the EJC, that remains bound to spliced mRNAs throughout all stages of mRNA metabolism, functions to mark the position of the exon-exon junction in the mature mRNA and thereby influences dow [...]
rpl36a 7955.ENSDARP00000075363 ribosomal protein L36A
rpl14 7955.ENSDARP00000052528 ribosomal protein L14
rpl19 7955.ENSDARP00000105649 ribosomal protein L19
rps10 7955.ENSDARP00000045900 ribosomal protein S10
rps16 7955.ENSDARP00000066897 ribosomal protein S16
rpl6 7955.ENSDARP00000091899 ribosomal protein L6
rpl13 7955.ENSDARP00000047390 ribosomal protein L13
rpl23 7955.ENSDARP00000069977 ribosomal protein L23
rps24 7955.ENSDARP00000091586 ribosomal protein S24
116
S4 Table: Primers and types of SSR motifs found in tambaqui sequences.
Contig name Primer left Left_Tm Primer_right Right_Tm Motif
contig_117 AGGCTGGGTGGGAATTGTC 60 CAGCTTTACTGCAGATTTGGC 58,873 (CT)8 contig_133 CTTTGTCTAAGCCTGTTTACCTC 57,894 CGACCGTTCAGGGAAATGC 59,939 (CT)6...(CT)6 contig_175 ATGAGTGAAGCTAGTCTGGAG 57,316 ACGGCACATTATTGCAGGAC 59,655 (CT)6...(CT)6 contig_442 GGAGGGACGTGAAGAAGCC 60,828 GCTGATTCTCAGACATGGAGG 58,92 (CT)6 contig_652 AATGAATGGCGCGTTCTGG 59,937 CACTGTGATAGATCAGGTGGC 58,924 (GGT)5 contig_923 TGACCTGCATTAACTCTGCC 58,643 TCTTACTACATATACAAGTGTGCAGG 59,288 (AG)6 contig_1824 GAGACCGATGACCTGTGAAC 58,745 TCTGCTCACAACTACCTATCCG 60,076 (AG)6 contig_2593 TCAGGCCAGTTTCTTTGGC 59,024 GGGTGAACAGCTCATTTCTAGC 60,077 (GT)10 contig_2837 AAGCTTTGCAAGGTCAGCG 60,084 AAGGGATTCTGGGACAGGG 59,065 (AC)6 contig_3417 GAGAAGTAGCCGCTTGCAC 59,648 GCAGCGTGAATCTGGTTGG 60,231 (CT)8 contig_3664 GGCAGTAAACAGCAGGTGG 59,488 TGTGTTTGGCCGGTTTGAC 59,935 (AG)7 contig_3778 TGCCTTCCTTCATAAATGTGC 57,609 ACATGAACAAAGTCTCAACCC 57,123 (CT)7 contig_4294 AGGCCTGATCCTCGACAAC 59,856 CTGCCCTTCCAGCATTCAG 59,259 (CT)6 contig_5697 ACTGATTTCCAAAGATGACGG 57 GACAGAACCAAACTCGGGAC 59,235 (GT)9 contig_5857 AGCACACAAGCAAAGGTTCC 60,009 AGGCGATCAGAGTGTCAGC 60,232 (CT)6 contig_5979 AGCAAGTTTGAGGCCATGC 59,782 CCTCATCGCTGGAGGCG 60,659 (AG)6 contig_6299 AAGGCACCGTGAAATCTCC 58,502 CGTAACAGGCATTTATCATCGC 58,94 (AG)6 contig_6507 TGTATATTATCGCTGCTCTGTAGAC 58,923 CTGAAGCACACTGCCAAGC 60,451 (GT)6 contig_7058 AAGCCAAGGTGCAGAAGGG 60,995 TCGGAGTTCATCACTGCGG 60,528 (GAT)6 contig_7092 GTTTAGGATCATTTCTACAGTGGTATC 58,512 AGGCAGTGACATGATTGTGC 59,582 (AC)7 contig_7457 CGTTTCCTGCCTCAAGTCC 59,196 TGGTGTCTGCTCCAACGTC 60,678 (CCT)5 contig_7514 CAGGCTGTTTCTAATCTGCAC 57,992 TAAGGCGCCAGGTCAACAG 60,756 (AG)8 contig_7662 TTCCTGATGAATGCACCAATAC 57,511 ACAGCTGGCATATCAATGTCTTAC 59,953 (AG)9 contig_7842 GGACGCTTGGATAACACTGG 59,376 CCGGCAGTTGGCTTCTTTG 60,452 (GT)11 contig_7949 AGGATTGGAGCAGAGCCAC 60,157 AGCTTTGCGAATGCTAGAAGG 59,741 (GT)6 contig_7989 AGAGCCACCTGTGACTGAAG 60,079 GGGAAAGAATCCCAGTAGTAAGTTC 59,664 (CT)6 contig_8910 GGGACCTTAGACGAGCGG 59,931 CAGTGCATGAACGTTGTCTTCAG 61,353 (AG)6
117
contig_9621 ATTCATGGGCAACAGCTCC 58,867 CAATTGGCCCTGAGGTTGG 59,477 (AAC)5 contig_9628 TCACGATGAGTGAAGGCCG 60,528 AACTGTCTCCAGTCGGTGG 59,705 (CT)6 contig_9836 TAGCCTGCTACCCAAAGCC 60,157 ACTAACAGCCAGCACACTTG 59,155 (GCT)5 contig_10005 GTGGTGAAGGACTCTGTGG 58,133 TGATGTGGTGGTCCGCTC 60,085 (AAG)5 contig_10270 AGGCACACCAATGCTTCAC 59,407 GCTGCTCGTTTCACTGGTC 59,867 (GTT)5 contig_10556 TGTCAGGGAGATCTGAGTATGG 59 TTGGGACATGGGTTTCTGG 58,003 (GT)7 contig_10804 GAGAGAATGCCACTGATCTCG 59 AAGGAGTCCACAGTTTGCG 58,739 (CT)6 contig_11599 ACCGAGAGTTTACGAGCTG 57,643 AGGCACTCCCAGCTACAAG 59,777 (ATT)5 contig_11819 AGTGATGGAGGGTCGTTCG 60 TGGGTGATTCTTGCACAGC 59,106 (CT)7 contig_12219 AAGAAACTGTCCTTATTGTGTCC 57 AAATGGCCCACCAAAGCTG 59,701 (ATTTT)6 contig_12543 TCATGATTGTGGCCTTCTAGTATTG 59,721 TGCGCACGCGTAAACAG 59,776 (GT)6 contig_12583 GGCTATGGTCAAGGTAATGGAG 59,023 AGTCAGACCCTTGCTGACC 59,701 (AGC)7 contig_12782 GGCATGGTCCACCACAATTC 60,223 ACCCTAGCGTCACAATCAG 57,604 (CT)6 contig_13525 ACGTTAACTGTTGTGACCGC 59,804 AGTGAAATTAGCACAGCGATGG 60,077 (CT)6 contig_14183 TGGACCATGCCCTCAACG 60,402 GCAGTGCAGAAGTCAATGG 57,65 (GT)8 contig_14300 ACAACTATGGGTGTACATGGC 58,767 GTACTGTGATCTGTAACCAGACG 59,339 (AC)6 contig_14669 CGCTCTCAGCTTTGGGTTG 59,864 CAGGCATGTGCAAGACACC 60,158 (GT)6 contig_14961 TCTTGTCAGTTTCAGCTCTGG 58,642 GTGGCACTCAAGCTCATTC 57,352 (GTTT)5 contig_14981 CTCGTCCTCTGTGGAGCTG 60,232 GGATCCAGGCAGAGCTTTAG 58,503 (CCT)7 contig_15075 TGCAGAGGAATCTCCTTGTGG 60,492 GACCGTCCACTGTGTCATC 58,612 (GGT)5 contig_15957 CGTGGCGATCTCACCAAAG 59,648 TGCAACTTCAGAACAAGGCAC 60,35 (GGT)6 contig_16842 TAGGACTTGAGCGAATGTTTACTTG 60,13 GCAGTCGGAGGGAACACG 61,163 (CT)6 contig_17081 GCTAAAGGCGTAAGGTATGTC 57,256 AGGAGCAGCGACATGGG 59,753 (CT)8 contig_17305 TACATGGGACAGGGAAGTACTCG 61,969 AAATAGCTTGGATTAGCACCTG 57,238 (ATC)7 contig_19077 TGCAGCAGAGCTTTCTGATTG 59,944 AAAGCAGGCGTGGCATTAG 59,562 (GT)9 contig_20535 AGAGCATCAAAGTGTCCCTG 58,274 GGACTGGGAGGTGCTCTTG 60,459 (AGC)5 contig_21230 AACGTTAGCGTGGTGGCTC 61,407 TCATGAGTCCAAACTGCACC 58,861 (AC)6 contig_21296 GAATTCCAAAGAGGGCAGGTC 59,667 TGCCAGTCTCTGCTGGTAG 59,477 (AG)6 contig_21606 ACACCGAACATGGAGGGAC 60,082 ACGAACTGGAGCACTTTATGG 59,057 (CCT)5 contig_21771 GAGTTCCAGAGTCCTGCCC 60,157 CATCGTTGTGCCGCCAG 59,851 (CT)8 contig_22559 GAAGCTTGGAGCTCATCCAC 59,372 ACACATCTCCACAAGATATTTCTCC 59,428 (AAG)5
118
contig_22894 CGGCTACATCAATGCCCTC 59,12 AGGCTCCATCAGGAACTGTC 59,861 (GCT)7 contig_23572 CAGGGTTCTATTCCAGCAGTC 58,848 CAGGGAGCCAATGAAACGG 59,562 (CCT)6 contig_24414 GTTTGACACCTTTGACTGACG 58,418 ACTGACCAGTCCACTTACAG 57,259 (AG)6 contig_24661 ACACTCTTTGATGACCTGGTTG 59,287 GATGGAGTGGCCTCCCG 59,837 (GT)7 contig_24694 TCAGAGCCCATACCTGGAC 58,851 GTATCTGCGGGCGTGAAG 59,017 (AC)6 contig_25297 AAGTACTCGGTTGCCCGTG 60,751 TGATGTGCTGTAGATCCCGAG 60,078 (CTT)5 contig_25982 TCCATCCTGAGCCCAAACG 60,46 TCTGCAGCCTAAACTCAGC 58,208 (AG)6 contig_26248 CCCTGCCCTTGACAATCC 58,408 TTGATAAGCGCCACGTTCC 59,274 (GTT)5 contig_26320 CGACGAGTCCACAAACCTG 59,211 CTGAGCACTGACCACATCTTC 59,405 (GT)7 contig_26841 AGCCCTCACCAGTATTCACC 59,859 CTGAGGCACGTTGAAGCAG 59,867 (CT)7 contig_26880 TGGATGTTCAGGGTTAATGTCAG 59,186 CCACTGGCTCTTCCAGGTC 60,459 (GT)7 contig_27711 TGTAGTGCCCTTTGATCGTC 58,371 ACAGATACGCGCAATATGACC 59,342 (CT)7 contig_28070 AGTTGGAATCAGGACCCGC 60,46 ACGCTGTTCTTTGCACCAG 59,715 (CCT)6 contig_28755 GAAAGTACTGCACCTCTGCC 59,303 ACCACTGTTTAGGTCGAAGTATC 58,696 (GTTT)8 contig_28913 CCAATGTTCAGCTCCAGCC 59,561 CCTCAACTGCCAAAGTCCC 59,106 (AGC)6 contig_33077 GCAAGATCAGTTCGCAGGC 60,304 ACTTGGCAATCTGCTGTGG 59,103 (GTTT)5 contig_34226 CGCACTCCGAAAGCAACC 60,165 GGTCCTGTGGGCTTGTAAAC 59,51 (GCT)5 contig_34496 CTGTAAAGGTGTGACGCGG 59,577 GAGCACTATGATGGAGTGCG 59,243 (AC)6 contig_34868 TTCCACGCCTGCCTTCAAC 61,648 AGTCTAGTCATCAAGCGTTTAGC 59,332 (CCT)5 contig_34991 GACTTTGACGGTTCCACCTG 59,518 GCGCTCTTTGGATTTGGAGC 60,92 (AGC)5 contig_35837 CCCTTCCTCAATACTCTGACCC 60,34 TGTACGGCGGTGCATAGAC 60,6 (CTGT)5 contig_37007 TTGTCACGGGCTTCTTCCG 61,047 AGCAGTATCCAGAGCCAACC 60,224 (CT)10 contig_37854 ACTTCTGTGCTCGTTTCGG 58,835 TACCCGTGGACTCAGATCG 58,959 (CTT)7 contig_39773 CCCTGTTGTTTCCTTTCAGTC 57,763 CGTCATACTGCGTCCCGTG 61,597 (CTGT)6 contig_41091 AGACAGTGGCACGCATCG 61,165 ACATAGCACCCAGATAGGTTGG 60,341 (AG)8 contig_46762 GCTGAGCAATGAGCGTTCG 60,66 TGGATTCCGTAGTCGGAGG 58,951 (GAT)5 contig_48037 GAAGCTGGTGACATGGTACG 59,381 GACAACATGTAGACGGCATTTC 58,74 (CT)7 contig_48388 ACTGTAATTATACGGTCAGAACCC 58,862 TGTCACAGCGCCATAACTTG 59,589 (AC)6 contig_48788 TGAAAGAAGTAACATTACAGAGTCAGG 59,907 AAGCTGAGCACTGGCATTC 59,185 (GT)11 contig_48799 TGTGCCCAGTTGCTCCAC 60,956 TCTGTTCGGTCAGTAGAATGG 57,889 (CT)6
119
Capítulo 3 ___________________________________________________________________ Prado-Lima, M. & Val, A.L. Da Genética à Fisiologia: uma abordagem integrativa sobre a exposição do tambaqui (Colossoma macropomum) aos principais cenários de mudanças climáticas previstos pelo IPCC. Manuscrito formatado de acordo com as regras da Acta Amazonica.
120
Resumo As mudanças climáticas têm causado alterações físicas e biológicas nas
diversas partes do planeta e impactado o clima, os ecossistemas e seus organismos. As consequências geradas pelo aquecimento global ameaçam todos os níveis da organização biológica, desde os mais abrangentes até o molecular. No caso dos peixes, que estão sujeitos a variações ambientais, a elevação na temperatura da água e as modificações na concentração de gases dissolvidos colocam em risco a sobrevivência de diversas espécies, especialmente aquelas mais sensíveis. A capacidade de se adaptar às variações na temperatura ambiental depende de alterações em diversos processos metabólicos e bioquímicos que têm origem na regulação da expressão gênica em resposta ao agente estressor. Dessa forma, o objetivo do presente estudo foi investigar como o tambaqui (Colossoma macropomum), uma espécie amazônica de grande importância ecológica e econômica, pode reagir à exposição às mudanças climáticas globais. Os peixes foram expostos durante 150 dias aos cenários climáticos atual, B1, A1B e A2, previstos pelo IPCC para o ano 2100, e tiveram investigadas as alterações no transcriptoma, na integridade do DNA de eritrócitos, em parâmetros hematológicos e enzimas de regulação iônica. Os resultados obtidos indicam que os principais genes que responderam à exposição foram: atp2a1, atp2a2b, calm2a, calm3a, cox4i2, cox5b2, cox7c, cox8b, dnaja2, dnajc7, hmgb1a, hsp90aa1.1, hsp90aa1.2, pfdn2 e slc4a4b. As análises de ontologia indicaram que esses genes atuam em importantes processos metabólicos responsáveis pela homeostase celular e sobrevivência do organismo em situações de estresse térmico, principalmente, síntese, dobramento e transporte de proteínas, remodelamento da membrana plasmática, mecanismos de defesa antioxidante, osmoregulação e atividade das principais enzimas de regulação iônica. Assim, a análise integrativa de parâmetros genéticos e fisiológicos possibilitou um importante avanço na compreensão dos mecanismos moleculares relacionados à exposição do tambaqui às mudanças climáticas globais previstas pelo IPCC.
Palavras-chave: aquecimento global, Amazônia, adaptação, transcriptoma, fisiologia, ensaio cometa
121
Introdução
A temperatura corporal dos animais ectotérmicos está sujeita a variações
decorrentes de alterações na temperatura do ambiente onde vivem (Huey e
Kingsolver 1993). Dessa forma, muitos organismos aquáticos, como os peixes, não
conseguem controlar sua temperatura corporal, mas podem nadar para áreas com
temperaturas mais adequadas ao seu metabolismo (López-Olmeda e Sánchez-
Vázquez 2011). Ainda assim, os peixes podem se deparar com uma série de
variações diárias e sazonais na temperatura da água devido a variações rápidas na
irradiação solar, movimentos anormais na coluna d’água e ocorrência de
precipitações rápidas (Long et al. 2012; 2013). Em decorrência disso, as espécies
fazem uso de diversas estratégias adaptativas para superar esse estresse ambiental
(Ficke et al. 2007; Long et al. 2012).
A capacidade de se adaptar às variações de temperatura do ambiente é
dependente da alteração de diversos processos metabólicos e bioquímicos, à fim de
manter a homeostase celular e garantir a sobrevivência do organismo (Pörtner e
Farrell 2008; Clark et al. 2010; Logan e Buckley 2015). As taxas metabólicas de
animais ectotérmicos normalmente aumentam com o incremento na temperatura
ambiental, o que leva ao aumento nas exigências de combustíveis metabólicos
preciosos (Iftikar e Hickey 2013). Porém, se o aumento na taxa metabólica for
insuficiente, as reservas metabólicas devem ser direcionadas para a geração de
energia, comprometendo, consequentemente, o equilíbrio de processos fisiológicos
vitais como crescimento, reprodução, alimentação e, em última instância, a
sobrevivência do organismo (Iftikar e Hickey 2013; Strobel et al. 2013)
Em situações de estresse térmico, os peixes podem enfrentar também
modificações nas propriedades e no funcionamento de biomoléculas, alterações em
componentes estruturais das células, como o funcionamento, dobramento e
estabilidade de proteínas, modificações na composição, permeabilidade e fluidez
das membranas celulares (Hazel e Williams 1990; Los e Murata 2004; Long et al.
2012). Adicionalmente, devido a água aquecida possuir menor capacidade de
retenção de oxigênio dissolvido, os peixes podem enfrentar um estresse adicional
provocado pela hipóxia que, consequentemente, gera uma série de modificações
como aumento na taxa respiratória para lidar com esse novo desafio (Jeppesen et
al. 2012).
122
As consequências geradas pelas mudanças climáticas, especialmente
aumento na temperatura e na concentração de CO2, ameaçam todos os níveis da
organização biológica, desde o comportamental até o molecular (Podrabsky e
Somero 2004; Hofmann 2005). As estratégias utilizadas pelos organismos para
superar as modificações ambientais têm início a partir de alterações na expressão
de genes, passando por modificações pós-transcricionais até chegar à síntese de
proteínas (Sterky e Lundeberg 2000; Oshlack et al. 2010). Diversos estudos
mostram que o estresse térmico gerado pelo aumento na temperatura resulta em
severas modificações nos padrões considerados normais de expressão gênica em
diversos peixes como zebrafish (Long et al. 2013), truta (Oncorhynchus mykiss
gairdneri) (Narum e Campbell 2015), bagre de canal (Ictalurus punctatus) (Liu et al.
2013), Pagothenia borchgrevinki (Bilyk e Cheng 2014), truta do ártico (Salvelinus
alpinus) (Quinn et al. 2011) e bacalhau do Atlântico (Gadus morhua) (Hori et al.
2010). Embora a expressão de vários genes seja alterada devido ao estresse
desencadeado pelo aumento na temperatura ambiental, poucos estudos têm
conseguido estabelecer uma correlação segura entre o nível de expressão gênica,
obtido a partir de diferentes abordagens de análise de transcriptomas, como RNA-
Seq, e os processos metabólicos celulares e proteínas resultantes da regulação
positiva ou negativa desses genes (Narum e Campbell 2015).
Contudo, o correto funcionamento das proteínas é dependente do seu
formato, ou seja, apenas as proteínas que tenham sido devidamente dobradas
podem manter-se estáveis para atuar em processos biológicos fundamentais ao
organismo (Basu et al. 2002; Hofmann 2005; Long et al. 2013). O dobramento das
proteínas, tanto aquelas recém-sintetizadas pelos ribossomos quanto a estabilidade
funcional das que foram sintetizadas há mais tempo, é um processo especializado e
altamente dependente da temperatura, tendo em vista que esse processo é
realizado, principalmente, por proteínas termossensíveis como as chaperonas,
também conhecidas como HSPs (heat shock proteins) (Basu et al. 2002; Liu et al.
2013; Narum e Campbell 2015).
A espécie escolhida para esse estudo foi o tambaqui, Colossoma
macropomum, um peixe nativo da bacia Amazônica que habita rios, lagos e áreas
alagáveis (Junk et al. 2007), onde se alimenta de frutos e sementes na idade adulta
(Araújo-Lima e Goulding 1998). É amplamente criado em diferentes regiões do Brasil
devido ao seu alto valor comercial e facilidade no cultivo (Araújo-Lima e Goulding
123
1998; Brasil 2012). O tambaqui apresenta estratégias fisiológicas, morfológicas,
comportamentais e genéticas que lhe permite sobreviver em ambientes que seriam
desfavoráveis para muitas espécies devido a variações nas propriedades físicas e
químicas como a baixa concentração de oxigênio dissolvido e pH (Val e Almeida-Val
1995; Wood et al. 1998; Val e Kapoor 2003; Aride et al. 2007).
Considerando o crescente aumento na temperatura média do planeta e na
concentração de gases do efeito estufa, é importante compreender como o tambaqui
pode lidar com esse novo desafio ambiental e quais os principais impactos
resultantes dessa exposição. Assim, o objetivo do presente estudo foi realizar uma
análise integrativa envolvendo o perfil de expressão gênica e informações obtidas a
partir da análise de diversas variáveis fisiológicas para compreender como o
tambaqui poderá reagir à exposição aos principais cenários de mudanças climáticas
previstos pelo IPCC para o ano 2100.
Materiais e métodos
As variáveis fisiológicas analisadas foram: avaliação de danos ao DNA de
eritrócitos, análise de parâmetros hematológicos, concentração de íons plasmáticos
e atividade enzimática da Na+/K+-ATPase e H+-ATPase após exposição do tambaqui
durante 150 dias aos cenários climáticos B1, A1B e A2. Os métodos utilizados para
essas análises encontram-se descritos detalhadamente no Capítulo 1 desta tese.
Para investigar alterações no transcriptoma do tambaqui e identificar genes
diferencialmente expressos após 5 e 15 dias de exposição aos cenários climáticos
B1, A1B e A2, foi utilizado o sequenciamento de RNA (RNA-Seq). Os métodos
utilizados encontram-se descritos detalhadamente no Capítulo 2 desta tese.
Resultados
A partir da análise funcional e da ontologia de todos os genes
diferencialmente expressos identificados após a exposição do tambaqui aos
cenários climáticos B1, A1B e A2, foram selecionados os genes com rotas
metabólicas diretamente relacionadas às variáveis fisiológicas investigadas no
Capítulo 1. Esses genes foram agrupados na Tabela 1, que é composta
principalmente por vários tipos de chaperonas como Hsp90, DnaJ e Pfdn2 e genes
que estão envolvidos em modificações na composição e no funcionamento da
membrana plasmática como Citocromo oxidase, Calmodulina e Solute carrier.
124
Tabela 1: Principais genes diferencialmente expressos que responderam a exposição do tambaqui aos cenários climáticos B1, A1B e A2.
SÍMBOLO GENE ONTOLOGIA1 Bibloteca RNA-seq2
Atp2a1 ATPase, Ca++
Transporting, Cardiac Muscle, Fast Twitch 1
Calcium-transporting ATPase activity Calcium ion binding Nucleotide binding Protein binding
5 dias
Atp2a2b ATPase, Ca++
Transporting, Cardiac Muscle, Slow Twitch 2
Calcium-transporting ATPase activity Calcium ion binding Nucleotide binding Protein binding
5 dias
Calm2a Calmodulin 2
(Phosphorylase Kinase, Delta)
Calcium ion binding Membrane organization Detection of calcium ion Ion channel binding
15 dias
Calm3a Calmodulin 3
(Phosphorylase Kinase, Delta)
Calcium ion binding Membrane organization Detection of calcium ion Ion channel binding
15 dias
Cox4i2 Cytochrome C Oxidase Subunit IV Isoform 2 (Lung)
Cytochrome-c oxidase activity Cellular respiration Oxidation-reduction process Hydrogen ion transmembrane transport
5 dias
Cox5b2 Cytochrome C Oxidase Subunit Vb
Cytochrome-c oxidase activity Hydrogen ion transmembrane transport Metal ion binding Protein binding
15 dias
Cox7c Cytochrome C Oxidase Subunit VIIc
Cytochrome-c oxidase activity Hydrogen ion transmembrane transport Integral component of membrane Respiratory electron transport chain
5 dias
Cox8b Cytochrome C Oxidase Subunit VIIIB, Pseudogene
Cytochrome-c oxidase activity Integral component of membrane Respiratory electron transport chain Transmembrane transport
5 dias
Dnaja2 DnaJ (Hsp40) Homolog, Subfamily A, Member 2
Cellular response to heat Hsp70 protein binding Heat shock protein binding Protein binding
5 dias
Dnajc7 DnaJ (Hsp40) Homolog, Subfamily C, Member 7
Cellular response to heat Heat shock protein binding Protein binding Regulation of cellular response to heat
5 dias
125
Hmgb1a High Mobility Group Box 1
Chromatin remodeling DNA ligation involved in DNA repair Negative regulation of transcription from RNA polymerase II promoter Transcriptional repressor complex
5 dias 15 dias
Hsp90aa1.1 Heat Shock Protein 90kDa Alpha (Cytosolic), Class A
Member 1
Chaperone-mediated protein complex assembly Protein binding Response to heat Regulation of cellular response to heat
5 dias
Hsp90aa1.2 Heat Shock Protein 90kDa Alpha (Cytosolic), Class A
Member 1
Chaperone-mediated protein complex assembly Protein binding Response to heat Regulation of cellular response to heat
15 dias
Pfdn2 Prefoldin Subunit 2
Protein folding Protein binding involved in protein folding Positive regulation of cytoskeleton organization Unfolded protein binding
5 dias 15 dias
Slc4a4b Solute Carrier Family 4 (Sodium Bicarbonate
Cotransporter), Member 4
Inorganic anion exchanger activity Regulation of intracellular pH Sodium ion transmembrane transport Sodium: bicarbonate symporter activity
15 dias
1 Anotação funcional obtida a partir da base de dados do Gene Ontology (http://www.geneontology.org/), que inclui as categorias: processo biológico, função molecular e componente celular. 2 Gene diferencialmente expresso identificado após 5 e/ou 15 dias de exposição aos cenários climáticos.
Discussão
Entre os genes diferencialmente expressos identificados no tambaqui após
exposição aos cenários climáticos B1, A1B e A2, destacam-se genes ou famílias
gênicas (Tabela 1) que atuam individualmente ou em grupo para garantir a
homeostase celular. Nesse sentido, esses genes sintetizam enzimas e proteínas que
desempenham importantes funções no dobramento de proteínas, na regulação da
transcrição, como canais iônicos e reguladores do potencial da membrana
plasmática.
126
São genes como Atp2a1 e Atp2a2b que atuam no armazenamento e controle
dos níveis intracelulares de cálcio a partir da ação coordenada de diversos
mecanismos de armazenamento de cálcio no retículo endoplasmático e ligação de
íons Ca2+ no citoplasma (Korosec et al. 2006; Pegoraro et al. 2011). A manutenção
dos níveis de cálcio e sua mobilização a partir do retículo endoplasmático para o
citoplasma celular é um fator fundamental para o controle de diversos padrões de
sinalização celular que são responsáveis, dentre outras funções, pela proliferação e
diferenciação celular, assim como pela apoptose, a morte programada da célula
(Korosec et al. 2008). O cálcio desempenha muitas funções fisiológicas
fundamentais para a sobrevivência dos organismos, como a coagulação sanguínea,
batimento cardíaco, contração muscular e transmissão de impulso nervoso (Heyen
et al. 2000; Korosec et al. 2008).
A concentração dos níveis plasmáticos de Ca2+ é regulada por diversos
receptores de membrana e bombas de cálcio (Ca2+-ATPase) (Varga-Szabo et al.
2009). Devido a atividade da Ca2+-ATPase, localizada na membrana plasmática da
célula e em organelas intracelulares como as mitocôndrias, os níveis de cálcio são
mantidos baixos dentro da célula na ausência de sinalização celular (Pegoraro et al.
2011). A Ca2+-ATPase atua no controle da homeostase celular de cálcio por meio da
hidrólise de um ATP que possibilita a captura de dois íons Ca2+ para dentro do
retículo endoplasmático (Periasamy e Kalyanasundaram 2007). Dentro da célula
podem estar ligadas ao retículo endoplasmático ou sarcoplasmático, (Atp2a /
SERCA) sendo transportadores de cálcio altamente conservados, encontrados
desde leveduras até mamíferos, e codificados por três genes: Atp2a1 (SERCA1),
Atp2a2 (SERCA 2) e Atp2a3 (SERCA3) (Korosec et al. 2008).
A estrutura molecular da família de genes Atp2a tem sido estudada em
abelhas (Magyar et al. 1995), galinhas (Machuca et al. 1999), mamíferos (Schleef et
al. 1996) e peixes (Lai et al. 2011). Em zebrafish (Danio rerio), peixe onde a família
gênica foi mais estudada, são conhecidas até o momento quatro formas
relacionadas a Atp2a: atp2a1, atp2a2a, atp2a2b e atp2a3 (Hirata et al. 2004; Ebert
et al. 2005). No tambaqui os genes da família Atp2a foram expressos negativamente
após 5 dias de exposição (Tabela S1 do Cap. 2), sendo Atp2a1 (B1: -3,825, A1B: -
1,1 e A2: -1,265) e Atp2a2b (B1: -4,553, A1B: 1,79 e A2: -1,161). Analisando os
níveis de Ca2+ detectados durante os 150 dias de exposição (Tabela 3 do Cap. 1),
fica evidente uma redução de Ca2+ plasmático já a partir de 5 dias de exposição em
127
todos os cenários experimentais (B1, A1B e A2), indicando uma correlação entre a
expressão negativa dos genes Atp2a1 e Atp2a2b e os níveis de Ca2+ no plasma de
tambaqui.
Outra família gênica que tem seu mecanismo de ação relacionado aos níveis
celulares de Ca2+ é a Calmodulina (CaM). A pequena proteína acídica sintetizada
por essa família de genes é conservada estrutural e funcionalmente, sendo
encontrada nas células de todos os eucariotos (Friedberg e Taliaferro 2005). A CaM
é considerada o principal sensor dos níveis de cálcio dentro da célula e seu
mecanismo de ação está diretamente relacionado à disponibilidade de Ca2+, atuando
principalmente em mecanismos de divisão celular, sobrevivência e apoptose, sendo
fundamental para viabilidade de células e tecidos, assim como para o sistema
nervoso central (Simão e Gomes 2001; Huo e Wong 2009). Quando a CaM se liga
aos íons Ca2+ torna-se ativa e, consequentemente, ativa muitas outras enzimas,
sendo considerada o ponto central de uma grande variedade de proteínas cálcio-
dependentes (Shimoda et al. 2002). Diversos estudos mostram que o complexo
CaM-Ca2+ atua de forma marcante na homeostase iônica e na modulação de
diversas proteínas celulares que incluem fosfodiesterase, Ca2+-ATPase,
calcineurina, óxido nítrico sintase, Ser/Tre quinases e fosfatases (Simão e Gomes
2001).
Nos vertebrados a estrutura molecular da CaM é conservada durante o
processo evolutivo, sendo 100% idêntica em todos os vertebrados, inclusive nos
peixes (Friedberg e Taliaferro 2005, Huo e Wong 2009). Enquanto nos invertebrados
foi encontrado apenas um gene, entre os vertebrados e mamíferos são encontrados
três genes (Calm1, Calm2 e Calm3) que codificam proteínas homólogas (Mototani et
al. 2010). No tambaqui duas das três formas gênicas foram identificadas após 15
dias de exposição aos cenários climáticos analisados (B1, A1B e A2). Os genes
Calm2a (B1: -1,418, A1B: -2,376 e A2: -2,507) e Calm3a (B1: -1,919, A1B: -2,874 e
A2: -1,567) tiveram sua expressão reduzida quando comparados a sala controle
(Tabela S2 do Cap. 2). Da mesma forma como ocorreu com o gene Atp2a, fica
evidente uma relação entre a expressão dos genes Calm2a e Calm3a e os níveis de
Ca2+ no plasma de tambaqui, pois tanto a expressão gênica quanto os níveis de
Ca2+ foram reduzidos nos três cenários climáticos analisados desde o início do
experimento até 150 dias de exposição.
128
Além dos genes relatados acima, a Citocromo C oxidase (Cox) foi identificada
no tambaqui entre os genes diferencialmente expressos após 5 e 15 dias de
exposição aos cenários climáticos. Em eucariotos os genes da Cox sintetizam um
complexo enzimático que está localizado na membrana interna das mitocôndrias, o
principal local onde ocorre a fosforilação oxidativa, fundamental para geração de
ATP (Zaslavsky e Gennis 2000; Popovic 2013). A Cox compreende uma família de
genes que sintetiza enzimas que atuam na etapa final da cadeia de transporte de
elétrons, onde catalisa a transferência de elétrons do Citocromo C para o oxigênio,
desempenhando, também, funções relacionadas a apoptose (Diaz 2010; Abumourad
2011). A Cox é composta por 13 subunidades, sendo as três maiores codificadas
pelo genoma mitocondrial (Cox1, Cox2 e Cox3) e dez pequenas subunidades
codificadas pelo genoma nuclear (Cox4, Cox5a, Cox5b, Cox6a, Cox6b, Cox6c,
Cox7a, Cox7b, Cox7c e Cox8). Além disso, qualquer limitação na síntese ou
atividade desse complexo enzimático implica na produção de espécies reativas de
oxigênio (ROS) sob condições de estresse oxidativo (Diaz 2010; Grim et al. 2010).
De uma maneira geral, os organismos aeróbicos enfrentam desafios
relacionados com a formação de ROS, incluindo superóxido (O2•–), radicais hidroxil
(–OH) e radicais peroxil (ROO•), que são capazes de danificar moléculas biológicas,
incluindo lipídios, proteínas e DNA (Dröge 2002). As células são protegidas dos
danos causados pela ROS utilizando dois mecanismos de defesa antioxidantes: não
enzimáticos, onde destacam-se a glutationa e as vitaminas E e C, e enzimáticos,
principalmente, superóxido dismutase e catalase. Em condições fisiológicas normais
a produção de ROS é similar à das defesas antioxidantes, mas devido à
interferência de agentes estressores diversos, os organismos podem se deparar
com situações de estresse oxidativo (Grim et al. 2010).
Modificações na temperatura ambiental onde vivem animais ectotérmicos
podem provocar uma reestruturação das membranas biológicas e modificações em
vários processos metabólicos que impactam as membranas biológicas, tornando-as
suscetíveis a processos potencialmente danosos desencadeados pelas ROS (Dröge
2002), alterações na permeabilidade da membrana a diversos íons como os prótons
(H+) (Hazel e Williams 1990; Zaslavsky e Gennis 2000) e até resultar em uma
completa perda de funcionamento da mitocôndria (Lee 2004). Em temperaturas mais
elevadas os organismos aumentam a demanda por oxigênio para a cadeia de
transporte de elétrons, com o objetivo de aumentar a produção de ATP (Strobel et al.
129
2013). Por isso em animais ectotérmicos as mitocôndrias desempenham um papel
central nas respostas térmicas desencadeadas pelo metabolismo aeróbico (Blier e
Lemieux 2001).
Para compreender as propriedades das enzimas responsáveis pela utilização
do oxigênio em nível celular, especialmente aquelas relacionadas à cadeia de
transporte de elétrons e a Cox, diversos estudos têm utilizado os peixes como
modelo para investigar a expressão da Cox e de suas subunidades em várias
espécies (Bremer e Moyes 2011) como goldfish (Carassius auratus) (LeMoine et al.
2008), zebrafish (D. rerio) (McClelland et al. 2006), Gasterosteus aculeatus
(Orczewska et al. 2010) e tilápia do nilo (Oreochromis niloticus) (Abumourad 2011),
assim como a relação entre a Cox e taxa respiratória na truta do ártico (Salvelinus
alpinus) (Blier e Lemieux 2001).
No tambaqui foram identificadas quatro das 13 subunidades da Cox entre os
genes diferencialmente expressos, sendo Cox4i2, Cox7c e Cox8b após 5 dias
(Tabela S1 do Cap. 2) e Cox5b2 após 15 dias de exposição (Tabela S2 do Cap. 2)
aos cenários climáticos experimentais (B1, A1B e A2). Devido às limitações na
síntese de subunidades de Cox contribuírem de forma decisiva para a produção de
ROS, é possível que as quatro subunidades que tiveram sua expressão reduzida no
tambaqui tenham contribuído para o estresse oxidativo identificado no tambaqui. De
acordo com os resultados obtidos a partir do ensaio cometa, fica evidente que os
valores correspondentes ao índice de danos genéticos (GDI) começaram a
aumentar a partir de 5 dias, chegando aos valores mais elevados após 30 dias de
exposição (Tabela 3 do Cap. 1). Apesar dos resultados não mostrarem o nível de
expressão das subunidades de Cox a partir de 30 dias de exposição, os resultados
sugerem uma relação entre a redução dos níveis de expressão das subunidades de
Cox e o aumento de danos no DNA de eritrócitos de tambaqui, possivelmente em
decorrência do aumento na produção de ROS.
A família gênica mais frequente entre os genes diferencialmente foi, sem
dúvida, a das chaperonas, também conhecidas como heat shock proteins (Hsps).
Seus genes dão origem à síntese de proteínas altamente conservadas que já foram
encontradas em diversos organismos, inclusive em peixes. Nos vertebrados, a
expressão das Hsps é regulada pelos fatores de transcrição de choque térmico 1
(Hsf1), que se ligam às regiões promotoras das Hsps, chamadas de elementos de
choque térmico (Hse) (Adám et al. 2000). Com base em seu peso molecular, as
130
Hsps são divididas em três principais grupos: Hsp90 (com 85 a 90 kDa), Hsp70 (com
68 a 73 kDa), Hsps de baixo peso molecular (com 16 a 47 kDa) (Basu et al. 2002).
As Hsps desempenham importantes funções na fisiologia celular dos organismos,
tanto em células em condições normais (sem estresse), em que são expressas
constitutivamente para manter a forma e a função das proteínas sintetizadas pela
célula, quanto em situações de estresse físico e metabólico, incluindo estresse
oxidativo e, principalmente, estresse térmico (Tine et al. 2010; Oksala et al. 2014).
De uma maneira geral, as Hsps atuam no dobramento de polipeptídeos recém-
sintetizados, no reparo e degradação de proteínas alteradas ou desnaturadas, na
formação e manutenção de componentes do citoesqueleto e de receptores de
hormônios esteroides, na manutenção das membranas lipoproteicas das
mitocôndrias e do núcleo celular, no transporte de proteínas através da membrana e
no controle de mudanças no formato e na função de diversas proteínas (Kiang and
Tsokos 1998; Basu et al. 2002).
Estudos realizados em peixes e outros organismos mostram que cada uma
das três categorias de Hsps apresenta diferentes funções em situações de estresse
térmico (Basu et al. 2002). A Hsp90 atua na redução dos níveis de ROS e da
peroxidação lipídica, além de aumentar as defesas antioxidantes por meio da
indução de glutationa. Assim, a Hsp90, juntamente com os mecanismos de defesas
antioxidantes, atua no reparo de células danificadas pela exposição aguda ou
crônica a variações de temperatura, sendo considerada um importante mecanismo
que evita a apoptose (Cui et al. 2014; Oksala et al. 2014). Em larvas de zebrafish,
várias Hsps, incluindo Hsp90aa1 (heat shock protein 90-alpha 1) e Hsp90aa.2 (heat
shock protein 90-alpha 2), foram expressas após exposição ao calor e ao frio, porém
essa expressão foi mais rápida quando as larvas foram expostas ao calor do que ao
frio (Long et al. 2012). As Hsp90 são as únicas chaperonas moleculares que não
atuam no dobramento de proteínas recém-sintetizadas, porém são fundamentais em
processos de sinalização celular, devido seus principais substratos serem proteínas
de transdução de sinal como receptores de hormônios esteroides e diversas
enzimas kinases (Basu et al. 2002; Chen et al. 2005).
A Hsp70 compreende o maior e mais estudado grupo de Hsps, sua expressão
varia em diferentes condições fisiológicas. Existem três formas de Hsp70: a Hsc70
(heat shock cognate) que é expressa constitutivamente, a Hsp70 que é expressa em
condições de estresse resultante de um estímulo externo e algumas subunidades
131
que são expressas em ambas as condições (Jesus et al. 2013). Diversos padrões de
expressão da Hsp70 têm sido encontrados em vários peixes, incluindo zebrafish
(Malek et al. 2004), carpa (Ctenopharyngodon idellus) (Cui et al. 2014) e bacalhau
do Atlântico (Gadus morhua) (Hori et al. 2010). Um estudo recente comparou a
expressão da Hsp70 e da Hsc70 em duas espécies de peixe do gênero Squalius (S.
torgalensis e S. carolitertii) submetidos a diferentes temperaturas; os resultados
mostraram que apesar de serem evolutivamente próximas, o nível de expressão e a
tolerância térmica foram bastante diferentes entre as duas espécies do mesmo
gênero, pois enquanto S. torgalensis aumentou o nível de expressão de Hsp70 e
Hsc70 em temperaturas mais elevadas, S. carolitertii não evidenciou alterações na
expressão das Hsps, o que pode ter levado, de acordo com os autores, aos altos
níveis de mortalidade detectados em S. carolitertii quando submetido a temperaturas
mais elevadas (Jesus et al. 2013).
O terceiro e último grupo de Hsps, denominado de HSP40 ou DnaJ, atua de
forma muito semelhante a Hsp70, promovendo o dobramento, desdobramento, a
montagem, o transporte e a degradação de proteínas dentro da célula (Qiu et al.
2006; Li et al. 2011). A Hsp40 é capaz de regular o funcionamento da Hsp70
estimulando a atividade ATPase por meio do domínio J, normalmente localizado na
extremidade N-terminal da proteína (Li et al. 2011). Devido a hidrólise de ATP ser
essencial para a atividade da Hsp70, a Hsp40 consegue determinar a atividade da
Hsp70 promovendo a estabilização da sua interação com o substrato (Qiu et al.
2006; Liu et al. 2013). No bagre de canal diversas formas gênicas de Hsp40 foram
identificadas após construção de bibliotecas de RNA-seq de peixes submetidos a
diferentes níveis de estresse térmico (Liu et al. 2013).
Dois dos três grupos de Hsps foram identificados no tambaqui, sendo Hsp90
(Hsp90aa1.1 e Hsp90aa1.2) e Hsp40 (Dnaja3 e Dnajc7) (Tabelas S1 e S2 do Cap.
2). Com base na ontologia dos genes identificados e na amplitude da atividade das
Hsps, é possível que esses genes sejam os principais responsáveis pela
sobrevivência do tambaqui aos três cenários experimentais analisados (B1, A1B e
A2). A Hsp90, que é sintetizada apenas em situações de estresse, pode ter
contribuído para redução dos níveis de ROS e aumento das defesas antioxidantes
nos eritrócitos de tambaqui, particularmente após 30 dias de exposição. A Hsp40,
por atuar no controle do funcionamento da Hsp70 e na ligação a diversas enzimas
celulares, pode ter atuado no controle da atividade das principais enzimas de
132
regulação iônica, Na+/K+-ATPase e H+-ATPase, contribuindo assim para a
manutenção do pH celular e para a concentração de íons monovalentes como Na+,
K+ e Cl- do tambaqui nos três cenários experimentais investigados.
Outra chaperona identificada entre os genes diferencialmente expressos foi a
Prefoldin (Pfdn) que sintetiza uma proteína com o mesmo nome. A Pfdn é, assim
como as outras Hsps descritas acima, uma chaperona molecular presente em todos
os eucariontes, onde atua no dobramento de cadeias polipeptídicas recém-
sintetizadas por meio da ligação às proteínas sintetizadas pelos ribossomos e
também no transporte até outras chaperonas, como Hsp70 e Hsp40 (Abe et al.
2013). Seu correto funcionamento nos eucariotos é influenciado por variações na
temperatura ambiental (Zako et al. 2010). Por não depender da hidrólise de ATP, ela
sozinha não teria condições de realizar o correto dobramento de proteínas
desnaturadas, por isso atua de forma acessória às outras chaperonas, contribuindo
assim para atribuições de forma e função às proteínas recém-sintetizadas pelos
ribossomos (Zako et al. 2010; Abe et al. 2013; Mirón-García et al. 2014). Além
dessas funções, a Pdfn, in vitro, também consegue se aderir à outras proteínas
celulares (não recém-sintetizadas) e transportá-las até as Hsps, porém in vivo essa
função ainda não foi comprovada (Zako et al. 2010).
A Pfdn é composta por seis subunidades (Pfdn1 a 6), sendo duas
subunidades alfa (pfdn3 e pfdn5) e quatro beta (Pfdn1, Pfdn2, Pfdn4, Pfdn6) (Abe et
al. 2013). No tambaqui apenas a subunidade 2 (Pfdn2) foi identificada, tanto após 5
dias (B1: -1,378, A1B: 1,621 e A2: 3,999) (Tabela S1 do Cap. 2), quanto após 15
dias (B1: -2,897, A1B: -9,682 e A2: -2,246) (Tabela S2 do Cap. 2) de exposição aos
cenários climáticos experimentais (B1, A1B e A2). Assim, acreditamos que a Pfdn2
seja responsável pela captura e transporte das proteínas recém-sintetizadas pelo
tambaqui para manter a homeostase celular. Porém, a expressão negativa da Pfdn2
no tambaqui pode indicar um comprometimento de suas funções devido a exposição
aos cenários climáticos, especialmente após 15 dias de exposição, podendo assim
dar início a uma cadeia de eventos que resultaria no incorreto dobramento de
proteínas recém-sintetizadas pelas células.
Outro gene identificado no tambaqui após 5 e 15 dias de exposição aos
cenários climáticos foi o Hmgb (High-Mobility Group Box), que sintetiza um grupo de
proteínas não histônicas que compõe a cromatina, atuando na montagem de
complexos nucleoproteicos de enhanceossomos (Stemmer et al. 2002; Xie et al.
133
2014). As Hmgbs são consideradas compensadoras gerais da transcrição,
auxiliando tanto no processo de transcrição em si, quanto na abertura da molécula
de DNA para possibilitar a atuação das polimerases (Stemmer et al. 2002).
As Hmgbs são altamente móveis, podendo ser encontradas no núcleo, no
citoplasma e até mesmo fora da célula, desempenhando uma grande variedade de
funções que incluem recombinação e reparo do DNA (Moleri et al. 2011; Xie et al.
2014). Em mamíferos e outros vertebrados, as Hmgbs compreendem três grupos
principais: Hmgb1, Hmgb2 e Hmgb3. Hmgb1 é uma proteína nuclear amplamente
distribuída que apresenta variações no padrão de expressão e localização dentro da
célula, sendo altamente expressa tanto na embriogênese, quanto em animais
adultos. O oposto ocorre com a Hmgb2, que apresenta uma distribuição mais restrita
e limitada a animais adultos. A Hmgb3 é considerada uma forma intermediária com
distribuição mais ampla que Hmgb2, porém muito frequente durante o
desenvolvimento embrionário (Moleri et al. 2011).
Uma das características marcantes da Hmgb1 é sua ação como modulador
compensatório em resposta a elevação da temperatura, sendo seu gene
considerado um sensor global de temperatura, inclusive em peixes (Podrabsky e
Somero 2004; Somero 2005; Logan e Buckley 2015). Diversos trabalhos mostram
que a abundância dos transcritos de Hmgb1 em peixes é reduzida quando são
expostos a temperaturas elevadas (Podrabsky e Somero 2004; Jayasundara et al.
2013; Logan e Buckley 2015). Podrabsky e Somero (2004) utilizando o teleósteo
killifish (Austrofundulus limnaeus), primeiramente aclimataram um grupo de
indivíduos a 20ºC (controle) e outro a 37ºC e, em seguida, fizeram alterações de
temperatura nos dois grupos para simular as variações diárias de temperatura que
ocorrem durante o dia e a noite. Os resultados mostraram que a expressão dos
transcritos de Hmgb1 foi elevada e mais estável em peixes aclimatados a 20ºC,
enquanto que a 37ºC a expressão foi negativa e bastante variável. Segundo os
autores, a expressão de Hmgb1 é negativamente correlacionada com aumento da
temperatura, influenciando a síntese de enzimas envolvidas em alterações na
composição lipídica da membrana e a expressão de genes característicos de
variações de temperatura, como as Hsps.
A Hmgb1 atua também por meio da ligação a importantes fatores de
transcrição, como p53, HoxD9 e receptores de hormônios esteroides através de
domínios específicos de interação. Além disso, a Hmgb1 permite a ligação a uma
134
grande variedade de outras proteínas, incluindo diversos elementos que formam o
citoesqueleto, proteínas da matriz extracelular, várias classes de lipídeos e proteínas
da membrana plasmática (Podrabsky e Somero 2004). Ela também eleva em pelo
menos 20 vezes a afinidade de várias proteínas à região TATA box, controlando
assim a transcrição de centenas de genes que possuem TATA box na região
promotora (Das e Scovell 2001). Adicionalmente, a estabilidade térmica e as
propriedades bioquímicas de Hmgb1 indicam que a proteína é muito sensível à
variações de temperatura in vivo, o que poderia interferir na afinidade de complexos
nucleoproteicos com fatores de iniciação da transcrição, resultando em mudanças
na taxa de expressão de genes, especialmente aqueles que possuem TATA box
(Podrabsky e Somero 2004).
Tendo em vista que a expressão de Hmgb1a no tambaqui foi negativa após 5
(B1: -1,722, A1B: -2,413 e A2: -1,931) (Tabela S1 do Cap. 2) e 15 dias (B1: -1,842,
A1B: -4,908 e A2: -1,181) (Tabela S2 do Cap. 2) de exposição aos cenários
climáticos, é possível que, assim como ocorreu em killifish, o Hmgb1a atue no
tambaqui como modulador compensatório da transcrição, controlando a síntese de
vários genes em resposta ao aumento na temperatura, especialmente genes que
codificam enzimas que atuam na membrana plasmática, como Na+/K+-ATPase e H+-
ATPase.
Com função marcante na regulação iônica e no equilíbrio ácido-base dos
peixes, a família gênica conhecida como solute carrier (SLC) compreende cerca de
338 genes já identificados em teleósteos, incluindo zebrafish, salmão do Atlântico
(Salmo salar), truta arco-íris (Oncorhynchus mykiss) e Anguilla japônica (Romano et
al. 2014). Os genes da família SLC são divididos em 12 grupos com base no tipo de
substrato que utilizam. Seus genes codificam proteínas que desempenham uma
variedade de funções nos peixes, principalmente transportadores de diversas
substâncias como aminoácidos, oligopeptídeos, cátions e ânions inorgânicos,
glicose e outros açúcares, íons metálicos e ureia (He et al. 2009; Romano et al.
2014). A ampla maioria dos estudos funcionais relacionados aos mecanismos de
ação dos genes da família SLC está relacionada aos mecanismos de transporte de
substâncias envolvendo peixes expostos a diferentes salinidades, temperaturas,
níveis de oxigênio e absorção de íons metálicos, com o objetivo de compreender
como esses desafios ambientais afetam a sobrevivência e o desenvolvimento dos
peixes desde a fase embrionária até a fase adulta (Romano et al. 2014).
135
Entre os membros da família SLC, o gene Slc4a4b é considerado decisivo na
determinação de padrões ionoregulatórios dos peixes, com atuação marcante nas
células da pele e do tecido branquial, agindo como principal transportador das
células basolaterais por meio da captação de Na+ e excreção de produtos acídicos
(H+), especialmente em situações de acidose ou hipercapnia (Parks et al. 2007; Lee
et al. 2011). Em zebrafish, o RNAm de Slc4a4b já foi sequenciado na pele e nas
brânquias, sempre associado à células ricas em H+-ATPase atuando como co-
transportador Na+/HCO3, por meio da captura de um Na+ e excreção de três HCO3-
(Lee et al. 2011). Utilizando anticorpos homólogos, o gene Slc4a4b foi encontrado
também associado a Na+/K+-ATPase em Tribolodon hakonensis, um ciprinídeo que
vive tanto na água doce quanto em água salgada (Hirata et al. 2003).
Em tambaqui o gene Slc4a4b foi identificado entre os genes diferencialmente
expressos após 15 dias de exposição (B1: -2,735, A1B: 1,476 e A2: -1,077) aos
cenários climáticos (Tabela S2 do Cap. 2). No entanto, as variações observadas na
atividade das enzimas Na+/K+-ATPase (Figura 3 do Cap. 1) e H+-ATPase (Figura 4
do Cap. 1) durante os 150 dias de exposição dificultam uma correlação direta com o
nível de expressão do gene nos três cenários experimentais (Tabela S2 do Cap. 2).
Apesar disso, com base na ontologia gênica e em resultados obtidos utilizando
outras espécies como modelo, é possível que o gene Slc4a4b exerça funções
importantes na regulação iônica e no controle do pH celular do tambaqui, tanto por
meio da captura de Na+ e excreção de HCO3-, quanto associado às enzimas Na+/K+-
ATPase e H+-ATPase. Mais estudos serão necessários para investigar a localização
do gene Slc4a4b no tambaqui e compreender melhor seu funcionamento.
O presente estudo confirma que numerosos genes estão envolvidos na
resposta do tambaqui aos cenários climáticos, especialmente Hsps e genes que
atuam no remodelamento das membranas celulares. A partir da análise integrativa
dos genes diferencialmente expressos com diversas variáveis fisiológicas
analisadas, fica evidente que a exposição do tambaqui aos principais cenários de
mudanças climáticas previstos pelo IPCC, pode comprometer processos biológicos e
vias de sinalização celular fundamentais para a sobrevivência do tambaqui,
particularmente a síntese, dobramento e transporte de proteínas recém-sintetizadas,
a biogênese mitocondrial, as defesas celulares antioxidantes, a osmoregulação, a
atividade de enzimas de regulação iônica e a manutenção de gradiente
eletroquímico das membranas celulares. Os resultados obtidos possibilitaram, por
136
meio da análise mais aprofundada de alterações no transcriptoma, conjuntamente
com a avaliação de características fisiológicas, a compreensão de importantes
mecanismos envolvidos em processos de adaptação do tambaqui às mudanças
climáticas globais.
Referências bibliográficas
Abe, A.; Takahashi-Niki, K.; Takekoshi, Y.; Shimizu, T.; Kitaura, H.; Maita, H.; Ariga,
H. 2013. Prefoldin plays a role as a clearance factor in preventing proteasome
inhibitor-induced protein aggregation. Journal of Biological Chemistry, 288(39):
27764–27776.
Abumourad, I.M.K. 2012. Cytochrome C oxidase subunit-1(COX1) gene in tilapia
(Oreochromis niloticus): its cloning and characterization. International Journal of
Genetic Engineering, 1(1): 1–5.
Adám, A.; Bártfai, R.; Lele, Z.; Krone, P.H.; Orbán, L. 2000. Heat-inducible
expression of a reporter gene detected by transient assay in zebrafish.
Experimental Cell Research, 256(1): 282–290.
Araújo-Lima, C.; Goulding. M. 1998. Os frutos do tambaqui: ecologia, conservação e
cultivo na Amazônia. Tefé: Sociedade Civil Mamirauá/CNPq, 187p.
Aride, P.H.: Roubach, R.; Val. A.L. 2007. Tolerance response of tambaqui
Colossoma macropomum (Cuvier) to water pH. Aquaculture Research, 38: 588–
94.
Basu, N.; Todgham, A.E.; Ackerman, P.A.; Bibeau, M.R.; Nakano, K.; Schulte, P.M.;
Iwama, G.K. 2002. Heat shock protein genes and their functional significance in
fish. Gene, 295(2): 173–183.
Bilyk, K.T.; Cheng, C.H.C. 2014. RNA-Seq analyses of cellular responses to elevated
body temperature in the high Antarctic cryopelagic nototheniid fish Pagothenia
borchgrevinki. Marine Genomics, 18: 163–171.
Blier, P.U.; Lemieux, H. 2001. The impact of the thermal sensitivity of cytochrome c
oxidase on the respiration rate of Arctic charr red muscle mitochondria. Journal
of Comparative Physiology - B Biochemical, Systemic, and Environmental
Physiology, 171(3): 247–253.
Brasil. Boletim estatístico da pesca e aquicultura: Brasil 2011. 2012.
(http://www.mpa.gov.br/files/docs/Boletim_MPA_2011_pub.pdf). Acesso em
08/02/2015
137
Bremer, K.: Moyes, C.D. 2011. Origins of variation in muscle cytochrome c oxidase
activity within and between fish species. The Journal of Experimental Biology,
214: 1888–1895.
Chen, B.; Piel, W.H.; Gui, L.; Bruford, E.; Monteiro, A. 2005. The HSP90 family of
genes in the human genome: insights into their divergence and evolution.
Genomics, 86(6): 627–637.
Clark, T.D.; Rummer, J.L.; Sepulveda, C.A.; Farrell, A.P.; Brauner, C.J. 2010.
Reduced and reversed temperature dependence of blood oxygenation in an
ectothermic scombrid fish: implications for the evolution of regional
heterothermy? Journal of Comparative Physiology B: Biochemical, Systemic,
and Environmental Physiology, 180(1): 73–82.
Cui, Y.; Liu, B.; Xie, J.; Xu, P.; Habte-Tsion, H.M.; Zhang, Y. 2014. Effect of heat
stress and recovery on viability, oxidative damage, and heat shock protein
expression in hepatic cells of grass carp (Ctenopharyngodon idellus). Fish
Physiology and Biochemistry, 40(3): 721–729.
Das, D.; Scovell, W.M. 2001. The binding interaction of HMG-1 with the TATA-
binding protein/TATA Complex. Journal of Biological Chemistry, 276(35):
32597–32605.
Diaz, F. 2010. Cytochrome c oxidase deficiency: patients and animal models.
Biochimica et Biophysica Acta, 1802(1): 100–110.
Dröge, W. 2002. Free radicals in the physiological control of cell function.
Physiological Reviews, 82(1): 47–95.
Ebert, A.M.; Hume, G.L.; Warren, K.S.; Cook, N.P.; Burns, C.G.; Mohideen, M. A.;
Garrity, D.M. 2005. Calcium extrusion is critical for cardiac morphogenesis and
rhythm in embryonic zebrafish hearts. Proceedings of the National Academy of
Sciences, 102(49): 17705–17710.
Ficke, A.D.; Myrick, C.A.; Hansen, L.J. 2007. Potential impacts of global climate
change on freshwater fisheries. Reviews in Fish Biology and Fisheries, 17(4):
581–613.
Friedberg, F.; Taliaferro, L. 2005. Calmodulin genes in zebrafish (revisited).
Molecular Biology Reports, 32(1): 55–60.
Grim, J.M.; Miles, D.R.B.; Crockett, E.L. 2010. Temperature acclimation alters
oxidative capacities and composition of membrane lipids without influencing
138
activities of enzymatic antioxidants or susceptibility to lipid peroxidation in fish
muscle. The Journal of Experimental Biology, 213(3): 445–452.
Hazel, J.; Williams, E. 1990. The role of alterations in membrane lipid composition in
enabling physiological adaptation of organisms to their physical environment.
Progress in Lipid Research, 29(3): 167–227.
He, L.; Vasiliou, K.; Nebert, D.W. 2009. Analysis and update of the human solute
carrier (SLC) gene superfamily. Human Genomics, 3(2): 195.
Heyen, M.V.; Reed, T.D.; Blough, R.I.; Baker, D.L.; Zilberman, A.; Loukianov, E.;
Wuytack, F. 2000. Structure and organization of the mouse Atp2a2 gene
encoding the sarco(endo)plasmic reticulum Ca2+-ATPase 2 (SERCA2) isoforms.
Mammalian Genome, 11(2): 159–163.
Hirata, H. 2004. Accordion, a zebrafish behavioral mutant, has a muscle relaxation
defect due to a mutation in the ATPase Ca2+ pump SERCA1. Development,
131(21): 5457–5468.
Hirata, T.; Kaneko, T.; Ono, T.; Nakazato, T.; Furukawa, N.; Hasegawa, S.; Hirose,
S. 2003. Mechanism of acid adaptation of a fish living in a pH 3.5 lake. American
Journal of Physiology - Regulatory, Integrative and Comparative Physiology,
284(5): R1199–R1212.
Hofmann, G.E. 2005. Patterns of Hsp gene expression in ectothermic marine
organisms on small to large biogeographic scales. Integrative and comparative
biology, 45(2): 247–255.
Hori, T.S.; Gamperl, A.K.; Afonso, L.O.; Johnson, S.C.; Hubert, S.; Kimball, J.; Rise,
M.L. 2010. Heat-shock responsive genes identified and validated in Atlantic cod
(Gadus morhua) liver, head kidney and skeletal muscle using genomic
techniques. BMC Genomics, 11: 72.
Huey, R.B; Kingsolver, J.G. 1993. Evolution of resistance to high temperature in
ectotherms. The American Naturalist, 142: S21-S46.
Huo, L.; Wong, A.O.L. 2009. Genomic structure and transcriptional regulation of
grass carp calmodulin gene. Biochemical and Biophysical Research
Communications, 390(3): 827–833.
Iftikar, F.I.; Hickey, A.J.R. 2013. Do mitochondria limit hot fish hearts? understanding
the role of mitochondrial function with heat stress in Notolabrus celidotus. PLoS
ONE, 8(5): e64120.
139
Jayasundara, N.; Gardner, L.D.; Block, B.A. 2013. Effects of temperature acclimation
on Pacific bluefin tuna (Thunnus orientalis) cardiac transcriptome. American
Journal of Physiology. Regulatory, Integrative and Comparative Physiology,
305(9): R1010–R1020.
Jeppesen, E.; Mehner, T.; Winfield, I.J.; Kangur, K.; Sarvala, J.; Gerdeaux, D.;
Meerhoff, M. 2012. Impacts of climate warming on the long-term dynamics of key
fish species in 24 European lakes. Hydrobiologia, 694(1): 1–39.
Jesus, T.F.; Inácio, Â.; Coelho, M.M. 2013. Different levels of hsp70 and hsc70
mRNA expression in Iberian fish exposed to distinct river conditions. Genetics
and Molecular Biology, 36(1): 61–69.
Junk, W.J.; Soares, M.G.M; Bayley, P.B. 2007. Freshwater fishes of the amazon
river basin: their biodiversity, fisheries, and habitats. Aquatic Ecosystem Health
& Management, 10(2): 153–173.
Kiang, J.: Tsokos, G.C. 1998. Heat shock protein 70 kDa molecular biology,
biochemistry, and physiology. Pharmacology & Therapeutics, 80(2): 183–201.
Korosec, B.; Glavac, D.; Rott, T.; Ravnik-Glavac, M. 2006. Alterations in the ATP2A2
gene in correlation with colon and lung cancer. Cancer Genetics and
Cytogenetics, 171(2): 105–111.
Korosec, B.; Glavac, D.; Volavsek, M.; Ravnik-Glavac, M. 2008. Alterations in genes
encoding sarcoplasmic-endoplasmic reticulum Ca2+ pumps in association with
head and neck squamous cell carcinoma. Cancer Genetics and Cytogenetics,
181(2): 112–118.
Lai, Y.Y.; Pai, C.W.; Tsai, I.T.; Chou, C.Y., Tsai, C.T., Chen, Y.H. 2011. Molecular
structure and developmental expression of zebrafish atp2a genes. Genes &
Genomics, 33(5): 541–548.
Lee, A.G. 2004. How lipids affect the activities of integral membrane proteins.
Biochimica et Biophysica Acta (BBA) - Biomembranes, 1666(1-2): 62–87.
Lee, Y.C.; Yan, J.J.; Cruz, S.A; Horng, J.L.; Hwang, P.P. 2011. Anion exchanger 1b,
but not sodium-bicarbonate cotransporter 1b, plays a role in transport functions
of zebrafish H+-ATPase-rich cells. American Journal of Physiology. Cell
Physiology, 300(2): C295–307.
LeMoine, C.M.R.; Genge, C.E.; Moyes, C.D. 2008. Role of the PGC-1 family in the
metabolic adaptation of goldfish to diet and temperature. Journal of Experimental
Biology, 211(9): 1448–1455.
140
Li, C.; Li, L.; Liu, F.; Ning, X.; Chen, A.; Zhang, L.; Zhao, J. 2011. Alternation of
Venerupis philippinarum Hsp40 gene expression in response to pathogen
challenge and heavy metal exposure. Fish and Shellfish Immunology, 30(1):
447–450.
Liu, S.; Wang, X.; Sun, F.; Zhang, J.; Feng, J.; Liu, H.; et al. 2013. RNA-Seq reveals
expression signatures of genes involved in oxygen transport, protein synthesis,
folding, and degradation in response to heat stress in catfish. Physiology
Genomics, 45: 462–476.
Logan, C.A.; Buckley, B.A. 2015. Transcriptomic responses to environmental
temperature in eurythermal and stenothermal fishes. Journal of Experimental
Biology, 218(12): 1915–1924.
Long, Y.; Li, L; Li, Q.; He, X.; Cui, Z. 2012. Transcriptomic characterization of
temperature stress responses in larval zebrafish. PLoS ONE, 7(5): e37209.
Long, Y.; Song, G.; Yan, J.; He, X.; Li, Q.; Cui, Z. 2013. Transcriptomic
characterization of cold acclimation in larval zebrafish. BMC Genomics, 14(1):
612.
López-Olmeda, J.F.; Sánchez-Vázquez, F.J. 2011. Thermal biology of zebrafish
(Danio rerio). Journal of Thermal Biology, 36(2): 91–104.
Los, D.; Murata, N. 2004. Membrane fluidity and its roles in the perception of
environmental signals. Biochimica et Biophysica Acta – Biomembranes, 1666:
142–157.
Machuca, I.; Domenget, C.; Jurdic, P. 1999. Identification of avian sarcoplasmic
reticulum Ca(2+)-ATPase (SERCA3) as a novel 1,25(OH)(2)D(3) target gene in the
monocytic lineage. Experimental Cell Research, 250: 364–375.
Magyar, A.; Bakos, E.; Váradi, A. 1995. Structure and tissue-specific expression of
the Drosophila melanogaster organellar-type Ca(2+)-ATPase gene. Biochemical
Journal, 310: 757–763.
Malek, R.L.; Sajadi, H.; Abraham, J.; Grundy, M.A.; Gerhard, G.S. 2004. The effects
of temperature reduction on gene expression and oxidative stress in skeletal
muscle from adult zebrafish. Comparative Biochemistry and Physiology - C
Toxicology and Pharmacology, 138(3): 363–373.
McClelland, G.B.; Craig, P.M.; Dhekney, K.; Dipardo, S. 2006. Temperature- and
exercise-induced gene expression and metabolic enzyme changes in skeletal
muscle of adult zebrafish (Danio rerio). J Physiol, 577: 739–751.
141
Mirón-García, M.C.; Garrido-Godino, A.I.; Martínez-Fernández, V.; Fernández-
Pevida, A.; Cuevas-Bermúdez, A.; Martín-Expósito, M.; Navarro, F. 2014. The
yeast prefoldin-like URI-orthologue Bud27 associates with the RSC nucleosome
remodeler and modulates transcription. Nucleic Acids Research, 42(15): 9666–
9676.
Moleri, S.; Cappellano, G.; Gaudenzi, G.; Cermenati, S.; Cotelli, F.; Horner, D.S.;
Beltrame, M. 2011. The HMGB protein gene family in zebrafish: Evolution and
embryonic expression patterns. Gene Expression Patterns, 11(1): 3–11.
Mototani, H.; Iida, A.; Nakamura, Y.; Ikegawa, S. 2010. Identification of sequence
polymorphisms in CALM2 and analysis of association with hip osteoarthritis in a
Japanese population. Journal of Bone and Mineral Metabolism, 28(5): 547–553.
Narum, S.R.; Campbell, N.R. 2015. Transcriptomic response to heat stress among
ecologically divergent populations of redband trout. BMC Genomics, 16: 103.
Oksala, N.K.J.; Ekmekci, F.G.; Ozsoy, E.; Kirankaya, S.; Kokkola, T.; Emecen, G.;
Atalay, M. 2014. Natural thermal adaptation increases heat shock protein levels
and decreases oxidative stress. Redox Biology, 3: 25–28.
Orczewska, J.I.; Hartleben, G.; O’Brien, K.M. 2010. The molecular basis of aerobic
metabolic remodeling differs between oxidative muscle and liver of three spine
sticklebacks in response to cold acclimation. AJP: Regulatory, Integrative and
Comparative Physiology, 299(1): R352–R364.
Oshlack, A.; Robinson, M.D., Young, M.D. 2010. From RNA-Seq reads to differential
expression results. Genome Biology, 11(12): 220.
Parks, S.K.; Tresguerres, M.; Goss, G.G. 2006. Interactions between Na+ channels
and Na+-HCO3- cotransporters in the freshwater fish gill MR cell: a model for
transepithelial Na+ uptake. AJP: Cell Physiology, 292(2): C935–C944.
Pegoraro, C.; Pollet, N.; Monsoro-Burq, A.H. 2011. Tissue-specific expression of
sarcoplasmic/endoplasmic reticulum calcium ATPases (ATP2A/SERCA) 1, 2, 3
during Xenopus laevis development. Gene Expression Patterns, 11(1-2): 122–
128.
Podrabsky, J. E.; Somero, G.N. 2004. Changes in gene expression associated with
acclimation to constant temperatures and fluctuating daily temperatures in an
annual killifish Austrofundulus Limnaeus. The Journal of experimental biology,
207: 2237–2254.
142
Popovic, D.M. 2013. Current advances in research of cytochrome c oxidase. Amino
Acids, 45(5): 1073–1087.
Portner, H.O.; Farrell, A.P. 2008. ECOLOGY: physiology and climate change.
Science, 322(5902): 690–692.
Qiu, X.B.; Shao, Y.M.; Miao, S.; Wang, L. 2006. The diversity of the DnaJ/Hsp40
family, the crucial partners for Hsp70 chaperones. Cellular and Molecular Life
Sciences, 63(22): 2560–2570.
Quinn, N.L.; McGowan, C.R.; Cooper, G.A.; Koop, B.F.; Davidson, W.S. 2011.
Ribosomal genes and heat shock proteins as putative markers for chronic,
sublethal heat stress in Arctic charr: applications for aquaculture and wild fish.
Physiological Genomics, 43(18): 1056–1064.
Romano, A.; Barca, A.; Storelli, C.; Verri, T. 2014. Teleost fish models in membrane
transport research: the PEPT1(SLC15A1) H+-oligopeptide transporter as a case
study. The Journal of Physiology, 592: 881–897.
Schleef, M.; Simon-Chazottes, D.; Lengeling, A.; Klocke, R.; Jockusch, H.; Yarden,
Y.; Guenet, J. 1996. The gene encoding sarcoplasmic reticulum calcium
ATPase-1 (Atp2a1) maps to distal mouse chromosome 7. Mammalian Genome,
7: 788.
Shimoda, K.; Miyake, T.; Kimura, J.; Maejima, K. 2002. Three synonymous genes
encode calmodulin in a reptile, the Japanese tortoise, Clemmys japonica.
Genetics and Molecular Biology, 25(1): 43–47.
Simao, R.C.; Gomes, S.L. 2001. Structure, expression, and functional analysis of the
gene coding for calmodulin in the chytridiomycete Blastocladiella emersonii. J
Bacteriol, 183(7): 2280–2288.
Somero, G.N. 2005. Linking biogeography to physiology: evolutionary and
acclimatory adjustments of thermal limits. Frontiers in Zoology, 2: 1.
Stemmer, C.; Schwander, A.; Bauw, G.; Fojan, P.; Grasser, K.D. 2002. Protein
kinase CK2 differentially phosphorylates maize chromosomal high mobility group
B (HMGB) proteins modulating their stability and DNA interactions. Journal of
Biological Chemistry, 277(2): 1092–1098.
Sterky, F.; Lundeberg, J. 2000. Sequence analysis of genes and genomes. Journal
of Biotechnology, 76(1): 1–31.
Strobel, A.; Graeve, M.; Poertner, H.O.; Mark, F.C. 2013. Mitochondrial acclimation
capacities to ocean warming and acidification are limited in the antarctic
143
nototheniid fish, Notothenia rossii and Lepidonotothen squamifrons. PLoS ONE,
8(7): e68865.
Tine, M.; Bonhomme, F.; McKenzie, D.J., Durand, J.D. 2010. Differential expression
of the heat shock protein Hsp70 in natural populations of the tilapia,
Sarotherodon melanotheron, acclimatized to a range of environmental salinities.
BMC Ecology, 10: 11.
Val, A.L.; Almeida-Val, V.M.F. 1995. Fishes of the Amazon and their environment:
physiological and biochemical features. Heidelberg: Springer-Verlag.
Val, A.L.; Kapoor, B.G. 2003. Fish adaptations. Enfield: Science Publishers, 418p.
Varga-Szabo, D.; Braun, A.; Nieswandt, B. 2009. Calcium signaling in platelets.
Journal of Thrombosis and Haemostasis, 7(7): 1057–1066.
Xie, J.; Hodgkinson, J.W.; Li, C.; Kovacevic, N.; Belosevic, M. 2014. Identification
and functional characterization of the goldfish (Carassius auratus L.) high
mobility group box 1 (HMGB1) chromatin-binding protein. Developmental and
Comparative Immunology, 44(1): 245–253.
Wood, C.M.; Wilson, R.W.; Gonzalez, R.J.; Patrick, M.L.; Bergman, H.L.; Narahara,
A.; Val, A.L. 1998. Responses of an Amazonian teleost, the tambaqui
(Colossoma macropomum) to low pH in extremely soft water. Physiological
Zoology, 71: 658-670.
Zako, T.; Banba, S.; Sahlan, M.; Sakono, M.; Terada, N.; Yohda, M.; Maeda, M.
2010. Hyperthermophilic archaeal prefoldin shows refolding activity at low
temperature. Biochemical and Biophysical Research Communications, 391(1):
467–470.
Zaslavsky, D.; Gennis, R.B. 2000. Proton pumping by cytochrome oxidase: progress,
problems and postulates. Biochimica et Biophysica Acta - Bioenergetics,
1458(1): 164–179.
144
4 – CONCLUSÕES GERAIS
A exposição do tambaqui aos cenários climáticos comprometeu as defesas
antioxidantes celulares, resultando em danos ao DNA de eritrócitos, especialmente
após 30 dias de exposição.
Foram identificadas alterações em parâmetros hematológicos do tambaqui,
especialmente relacionadas ao aumento no número de eritrócitos circulantes,
possivelmente para compensar o aumento na demanda de oxigênio para os tecidos.
Os cenários climáticos provocaram desequilíbrio em diversos processos de
regulação iônica, tanto em relação à concentração de íons plasmáticos, quanto à
atividade das principais enzimas responsáveis pela regulação iônica nas brânquias
de tambaqui.
O grande número de genes diferencialmente expressos identificados no
transcriptoma do tambaqui, indica que uma complexa interação de genes está
envolvida na adaptação às mudanças climáticas.
As variações observadas no transcriptoma do tambaqui sugerem que vários
processos básicos foram comprometidos para garantir a sobrevivência do tambaqui
frente ao estresse causado pelos cenários climáticos, especialmente a síntese de
proteínas, a biogênese mitocondrial, as defesas celulares antioxidantes, a
osmoregulação, a atividade de enzimas de regulação iônica e a manutenção do
gradiente eletroquímico das membranas celulares.
Dessa forma, concluímos que os três cenários de mudanças climáticas
avaliados provocaram, de acordo com suas intensidades, graves desequilíbrios em
processos metabólicos vitais que alteraram a homeostase celular do tambaqui e
podem colocar em risco a sobrevivência da espécie.
145
5 – PERSPECTIVAS
Os resultados obtidos no presente estudo contribuíram de forma marcante
para a elucidação dos principais impactos das mudanças climáticas sobre o
tambaqui, bem como indicaram possíveis impactos que podem ocorrer em outros
peixes da Amazônia. Porém, devido à robustez e complexidade dos resultados
obtidos, surgiram questionamentos que necessitam ser esclarecidos em estudos
posteriores:
· O perfil de expressão gênica identificado entre os indivíduos jovens seria
semelhante em animais adultos?
· As diversas estratégias adaptativas adquiridas pelo tambaqui durante o
processo evolutivo seriam suficientes para manter a homeostase do
organismo até quantos graus de aumento de temperatura? Qual possível
cenário climático?
· Quais consequências seriam causadas pelo silenciamento dos principais
genes que responderam a exposição do tambaqui às mudanças climáticas?
· Em períodos de exposição prolongados, os resultados das análises do
transcriptoma seriam semelhantes aos obtidos após 5 e 15 dias de
exposição?
· As alterações identificados no DNA de eritrócitos do tambaqui, nos
parâmetros hematológicos e nos processos de regulação iônica podem
contribuir para o comprometimento do sistema imune, facilitando assim o
surgimento de doenças como o câncer, por exemplo?
· Os cenários de mudanças climáticas utilizados no presente estudo poderiam
levar à morte outras espécies amazônicas mais sensíveis à modificações
ambientais?
146
6 – REFERÊNCIAS BIBLIOGRÁFICAS
Abrahams, M.V; Mangel, M.; Hedges, K. 2007. Predator-prey interactions and
changing environments: who benefits? Philosophical Transactions of the Royal
Society B: Biological Sciences, 362:2095–2104.
http://doi.org/10.1098/rstb.2007.2102
Araújo-Lima, C.; Goulding, M. 1998. Os frutos do tambaqui: ecologia, conservação e
cultivo na Amazônia. Sociedade Civil Mamirauá/CNPq, Tefé, 186p.
Basu, N.; Todgham, A.E.; Ackerman, P.A.; Bibeau, M.R.; Nakano, K.; Schulte, P.M.;
Iwama, G.K. 2002. Heat shock protein genes and their functional significance in
fish. Gene, 295(2): 173-183. http://doi.org/10.1016/S0378-1119(02)00687-X
Blair, J.M.; Ostrovsky, I.; Hicks, B.J.; Pitkethley, R.J.; Scholes, P. 2013. Growth of
rainbow trout (Oncorhynchus mykiss) in warm-temperate lakes: implications for
environmental change. Canadian Journal of Fisheries & Aquatic Sciences, 70:
815–823. http://doi.org/dx.doi.org/10.1139/cjfas-2012-0409
Booth, D.J.; Poulos, D.E.; Poole, J.; Feary, D. 2014. Growth and temperature
relationships for juvenile fish species in seagrass beds: Implications of climate
change. Journal of Fish Biology, 84: 231–236. http://doi.org/10.1111/jfb.12255
Brundtland, G.H.; Ehrlich, P.R.; Goldemberg, J.; Hansen, J.; Lovins, A.; Likens, G.E.;
Manabe, S.; May, B.; Mooney, H.A.; Robert, K-H.; Salim, E.; Sato, G.; Solomon,
S.; Stern, N.; Watson, B. 2012. Environment and Development Challenges: the
imperative to act. The Asahi Glass Foundation
(http://www.unep.org/pdf/pressreleases/Blue_Planet_synthesis_paper.pdf).
Acesso em 12/02/2016.
Canhos, V.P.; Siqueira, M.F.; Marino, A.; Canhos, D.A.L. 2008. Análise da
vulnerabilidade da biodiversidade brasileira frente às mudanças climáticas
globais. Parcerias Estratégicas, 27.
Castello, L.; Mcgrath, D.G.; Hess, L.L.; Coe, M.T.; Lefebvre, P.A.; Petry, P.; Macedo,
M.N; Renó, V.F.; Arantes, C.C. 2013. The vulnerability of Amazon freshwater
ecosystems. Conservation Letters, 6(4): 217–229.
http://doi.org/10.1111/conl.12008
Cheng, H.; Sinha, A.; Cruz, F.W.; Wang, X.; Edwards, R.L.; d’Horta, F.M.;Ribas, C.;
Vuille, M.; Stott, L.D.; Auler, A.S. 2013. Climate change patterns in Amazonia
and biodiversity. Nature Communications, 4: 1411.
147
http://doi.org/10.1038/ncomms2415
Chown, S.L.; Hoffmann, A.A.; Kristensen, T.N.; Angilletta, M.J.; Stenseth, N.C.;
Pertoldi, C. 2010. Adapting to climate change: a perspective from evolutionary
physiology. Climate Research, 43(1-2): 3-15. http://doi.org/10.3354/cr00879
Clark, M.S.; Thorne, M.A.S.; Toullec, J.Y.; Meng, Y.; Guan, L.L.; Peck, L.S.; Moore,
S. 2011. Antarctic krill 454 pyrosequencing reveals chaperone and stress
transcriptome. Plos One, 6(1): e15919.
http://doi.org/10.1371/journal.pone.0015919
Clarke, A. 2003. Costs and consequences of evolutionary temperature adaptation.
Trends in Ecology and Evolution, 18(11): 573–581.
http://doi.org/10.1016/j.tree.2003.08.007
Döll, P.; Zhang, J. 2010. Impact of climate change on freshwater ecosystems: a
global-scale analysis of ecologically relevant river flow alterations. Hydrology and
Earth System Sciences, 14(5): 783–799. http://doi.org/10.5194/hess-14-783-
2010
Del Toro-Silva, F.M.; Miller, J.M.; Taylor, J.C.; Ellis, T.A. 2008. Influence of oxygen
and temperature on growth and metabolic performance of Paralichthys
lethostigma (Pleuronectiformes: Paralichthyidae). Journal of Experimental
Marine Biology and Ecology, 358(2): 113–123.
http://doi.org/10.1016/j.jembe.2008.01.019
Ficke, A.D.; Myrick, C.A.; Hansen, L.J. 2007. Potential impacts of global climate
change on freshwater fisheries. Reviews in Fish Biology and Fisheries, 17(4):
581–613. http://doi.org/10.1007/s11160-007-9059-5
Gamito, R.; Teixeira, C.M.; Costa, M.J.; Cabral, H.N. 2013. Climate-induced changes
in fish landings of different fleet components of Portuguese fisheries. Regional
Environmental Change, 13(2): 413–421. http://doi.org/10.1007/s10113-012-
0358-6
Goulding, M. 1980. The fishes and the forest: explorations in Amazonian natural
history. University of California Press, Benkeley, 280pp.
Goulding, M. 1993. Flooded forests of the Amazon. Scientific America, 268(3): 113–
120.
Graef, E.W. 1996. As espécies de peixes com potencial para criação no Amazonas.
In Val,A.L.; Honczaryk,A. (Ed.). Criando Peixes na Amazônia. Editora do INPA,
Manaus, Amazonas, p.29–43
148
Grimm, A.M.; Natori, A.A. 2006. Impacts of climate change in South America: mean
fields and variability. Proceedings of 8o ICSHMO: 269–274.
Hirota, M.; Nobre, C.; Oyama, M.D.; Bustamante, M.M. 2010. The climatic sensitivity
of the forest, savanna and forest–savanna transition in tropical South
America,New physiologist, 187: 707–719.
Hirota, M.; Oyama, M.D.; Nobre, C. 2011. Concurrent climate impacts of tropical
South America land-cover change. Atmospheric Science Letters, 12(3): 261–
267. http://doi.org/10.1002/asl.329
Hofmann, G.E. 2005. Patterns of Hsp gene expression in ectothermic marine
organisms on small to large biogeographic scales. Integrative and Comparative
Biology, 45(2): 247–255. http://doi.org/10.1093/icb/45.2.247
IBAMA. 2003. Portaria no 65. Brasília: Ministério do Meio Ambiente. Instituto
Brasileiro de Meio Ambiente e Recursos Naturais Renováveis.
IPCC. 2007. Climate Change 2007: Synthesis report. Contribution of Working Groups
I, II and III to the Fourth Assessment Report of the Intergovernmental Panel on
Climate Change. Geneva, Switzerland.
IPCC. 2014. Climate Change 2014: Synthesis Report. Contribution of Working
Groups I, II and III to the Fifth Assessment Report of the Intergovernmental
Panel on Climate Change. Geneva, Switzerland.
Lapola, D.M.; Martinelli, L.A.; Peres, C.A.; Ometto, J.P.H.B.; Ferreira, M.E.; Nobre,
C.A.; et al. 2014. Pervasive transition of the Brazilian land-use system. Nature
Climate Change, 4(1): 27–35. http://doi.org/10.1038/nclimate2056
Liberato, A.M.; Brito, J.I.B. 2010. Influência de mudanças climáticas no balanço
hídrico da Amazônia ocidental. Revista Brasileira de Geografia Física, 03: 170–
180.
Lima, A.C.; Araujo-Lima, C. 2004. The distributions of larval and juvenile fishes in
Amazonian rivers of different nutrient status. Freshwater Biology, 49(6): 787–
800. http://doi.org/10.1111/j.1365-2427.2004.01228.x
Lima, R.C.C.; Cavalcante, A.M.B.; Marin, A.M.P. 2011. Desertificação e Mudanças
Climáticas no Semiárido Brasileiro. Instituto Nacional do Semiárido, Campina
Grande, 209p.
Long, Y.; Li, L.; Li, Q.; He, X.; Cui, Z. 2012. Transcriptomic characterization of
temperature stress responses in larval zebrafish. Plos One, 7(5): e37209.
http://doi.org/10.1371/journal.pone.0037209
149
Lopes, I.G. 2016. Mudanças climáticas previstas para o final do século afetam o
desempenho e o desenvolvimento esquelético de larvas de tambaqui
(Colossoma macropomum). Dissertação de Mestrado, Universidade Estadual
paulista Júlio de Mesquita Filho, Jaboticabal, São Paulo. 102p.
Marengo, J.A. 2007. Mudanças climáticas globais e seus efeitos sobre a
biodiversidade: caracterização do clima atual e definição de alterações
climáticas para o nterritório brasileiro ao longo do século XXI. 2ª Ed. Instituto
Brasileiro de Meio Ambiente e Recursos Naturais Renováveis, Brasília, 212p.
Moss, R.H.; Edmonds, J.A.; Hibbard, K.A.; Manning, M.R.; Rose, S.K.; van Vuuren,
D.P. et al. 2010. The next generation of scenarios for climate change research
and assessment. Nature, 463: 747–756. http://doi.org/10.1038/nature08823
Nobre, C.; Assad, E.D.; Oyama, M.D. 2005. Mudança ambiental no Brasil: em terra
na estufa. Scintific American, 12: 70–75.
Nobre, C.A.; Sampaio, G.; Salazar, L. 2007. Mudanças climáticas e Amazônia.
Ciência e Cultura, 59(3): 22–27.
Nowicki, J.P.; Miller, G.M.; Munday, P.L. 2012. Interactive effects of elevated
temperature and CO2 on foraging behavior of juvenile coral reef fish. Journal of
Experimental Marine Biology and Ecology, 412: 46–51.
http://doi.org/10.1016/j.jembe.2011.10.020
Oliveira, R.D. 2003. Efeitos da temperatura nas respostas cardio-respiratórias e na
respiração aérea acessória de jeju, Hoplerythrinus unitaeniatus (Erythrinidae)
aclimatação a 15, 20, 25 e 30°C e submetidos a variações de O2 ambiental.
Tese de doutorado, Universidade Federal de São Carlos, São Carlos, São
Paulo. 76p.
Perry, A.L.; Low, P.J.; Ellis, J.R.; Reynolds, J.D. 2005. Climate change and
distribution shifts in marine fishes. Science,308(5730): 1912–1915.
http://doi.org/10.1126/science.1111322
Portner, H.O.; Farrell, A.P. 2008. Physiology and climate change. Science,
322(5902): 690–692. http://doi.org/10.1126/science.1163156
Raskin, P.; Monks, F.; Ribeiro, T.;van Vuuren, D.; Zuerek, M. 2005. Global Scenarios
in Historical Perspective. In: Hassan, H.; Scholes, R.; Ash, N. (Ed.).Ecosystems
and human well-being: current state and trends. Island press, Washington,
DC,p.35–44.
Richardson, A.J.; Poloczanska, E.S. 2008. Ocean science: under-resourced, under
150
threat. Science, 320: 1294–1295.
Rockström, J.; Brasseur, G.; Hoskins, B.; Lucht, W.; Schellnhuber, J.; Nakicenovic,
N. et al.2014. Climate change: the necessary, the possible and the desirable
Earth League climate statement on the implications for climate policy from the
5th IPCC Assessment. Earth’s Future, 2: 606–611.
http://doi.org/10.1002/2014EF000280.Received
Saint-Paul, U. 1984. Ecological and physiological investigations of Colossoma
macropomum, a new species for fish culture in Amazonia. Memorias de La
Asociación Latinoamericana de Acuicultura, 5: 511–518.
Salati, E.; Vose, P.B. 1984. Amazon basin: a system in equilibrium. Science,
225(4658), 129–138. http://doi.org/10.1126/science.225.4658.129
Somero, G.N. 2010. The physiology of climate change: how potentials for
acclimatization and genetic adaptation will determine “winners” and “losers”.The
Journal of Experimental Biology, 213: 912–920.
http://doi.org/10.1242/jeb.037473
Stéfanon, M.; Martin-StPaul, N.K.; Leadley, P.; Bastin, S.; Dell’Aquila, A.; Drobinski,
P.; Gallardo, C. 2015. Testing climate models using an impact model: what are
the advantages? Climatic Change, 131(4): 649–661.
http://doi.org/10.1007/s10584-015-1412-4
Talling, J.F. 2001. Environmental controls on the functioning of shallow tropical lakes.
Hydrobiologia, 458(1): 1–8. http://doi.org/10.1023/A:1013121522321
Ter Hofstede, R.; Rijnsdorp, A.D. 2011. Comparing demersal fish assemblages
between periods of contrasting climate and fishing pressure. ICES Journal of
Marine Science, 68(6): 1189–1198. http://doi.org/10.1093/icesjms/fsr053
Val, A.L.; Almeida-Val, V.M.F. 1995. Fishes of the Amazon and their environment:
physiological and biochemical aspects. Springer-Verlag, Berlin, 224p.
Val, A.L.; Almeida-Val, V.M.F. 2008. Mudanças climáticas e biodiversidade na
Amazônia. Texto suplementar da conferência “Biodiversidade na Amazônia x
mudanças climáticas: causas e consequências.
(www.sbpcnet.org.br/livro/60ra/textos/CO-AdalbertoVal.pdf). Acesso em
23/11/2015.
Viner, D.; Hulme, M.; Raper, S.C.B. 1995. Climate change scenarios for the
assessments of the climate change on regional ecosystems. Journal of Thermal
Biology, 20(1-2): 175–190. http://doi.org/10.1016/0306-4565(94)00047-M
151
Walker, B.; Steffen, W. 1997.The terrestrial biosphere and global change:
implications for natural and maneged ecosystems.The international geosphere-
biosphere programme. International council of scientific unions. Stockholm,
Sweden. 36p.