Lady Katerine Serrano Mujica - repositorio.ufsm.br

1

UNIVERSIDADE FEDERAL DE SANTA MARIA

CENTRO DE CIÊNCIAS DA SAÚDE

PROGRAMA DE PÓS-GRADUAÇÃO EM FARMACOLOGIA

EFEITOS DO USO DO ACETATO DE LEUPROLIDE NAS CARATERÍSTICAS

REPRODUTIVAS DE ROEDORES SUBMETIDOS AO TRATAMENTO COM

TESTOSTERONA PROPIONATO PRÉ E PÓS-NATAL

DISSERTAÇÃO DE MESTRADO

Lady Katerine Serrano Mujica

Santa Maria, RS, Brasil.

2016



TESTOSTERONA PROPIONATO PRÉ E PÓS-NATAL.

Por


Dissertação apresentada ao Curso de Mestrado do Programa de

Pós-Graduação em Farmacologia da Universidade Federal de Santa Maria

(UFSM, RS), como requisito parcial para obtenção do grau de.

Mestre em Farmacologia.

Orientador: Prof. Dr. Fabio Vasconcellos Comim

Coorientador: Prof. Dra. Melissa Orlandin Premaor

Santa Maria, RS, Brasil.

2016

UNIVERSIDADE FEDERAL DE SANTA MARIA

CENTRO DE CIÊNCIAS DA SAÚDE

PROGRAMA DE PÓS-GRADUAÇÃO FARMACOLOGIA

A Comissão Examinadora, abaixo assinada,

Aprova a Dissertação de Mestrado



TESTOSTERONA PROPIONATO PRÉ E PÓS-NATAL

Elaborada por


Como requisito parcial para obtenção do grau de

Mestre em Farmacologia

COMISSÃO EXAMINADORA:

______________________________________

Fabio Vasconcellos Comim PhD (UFSM)

(Presidente/Orientador)

______________________________________

Melissa Orlandin Premaor PhD (UFSM)

(Coorientador)

______________________________________

Edison Capp PhD (UFRGS)

______________________________________

Carlos Fernando de Mello PhD (UFSM)

Santa Maria, 30 de julho de 2016

5

AGRADECIMENTOS

Ao Criador por me acompanhar sempre.

A minha mãe Magdalena e meu pai Luís, os melhores pdo mundo, obrigada por

sempre caminharem de meu lado, por fazer de meus sonhos sempre realidade, ao meu

irmão de coração Raul pela cumplicidade, por sempre cuidar de mim da forma em que só

um irmão consegue fazer.

À minha família pelo apoio constante e incondicional, mesmo estando longe,

sempre senti sua presença a cada dia.

Aos Orientadores, Fabio Vasconcellos Comim e Melissa Orlandin por acreditar em mim,

pela confiança e sinceridade sempre.

Aos Professores, Paulo Bayard Dias Gonçalves, Alfredo Antoniazi e João Francisco

Coelho de Oliveira (in memoriam), pelo acolhimento na família BioRep.

Aos biorepianos da pós-graduação em especial aos colegas Vitor, Alessandra,

Mariana e Andressa pelo constante auxílio nos experimentos realizados; pela amizade que

será para sempre. Obrigada por cada um dos momentos vividos.

Aos biorepianos da graduação, com os quais pude contar com constante auxílio à

qualquer hora do dia.

À Karina Gutierrez e Werner Glanzner, obrigada pela amizade sincera, por cada

conselho e por serem as pessoas maravilhosas, pela luz que vocês têm e que sempre me

acompanhou nessa aventura.

Às minha família Brasileira, ao longo destes anos longe de minha família e de meus

pais, tive a oportunidade de conhecer pessoas maravilhosas que agora fazem parte da minha

vida, tios Domnina e Segefredo, nada seria possível sem vocês ao meu lado.

Aos amigos que deixei na Colômbia agradeço por que mesmo longe ficaram tão

perto, aos novos amigos que fiz de todas as partes do mundo, vocês fizeram meus dias mais

felizes. Muito obrigada por cruzar e estar sempre em meu caminho.

A CAPES, FAPERGS e ao CNPq pelo apoio financeiro para realização dos

experimentos.

É necessário abrir os olhos e perceber que as coisas boas estão dentro de nós, onde os

sentimentos não precisam de motivos nem os desejos de razão. O importante é aproveitar o

momento e aprender sua duração, pois a vida está nos olhos de quem saber ver.

Gabriel Garcia Márquez

7

RESUMO

Dissertação de Mestrado

Programa de Pós-Graduação em Farmacologia

Universidade Federal de Santa Maria



TESTOSTERONA PROPIONATO PRÉ E PÓS-NATAL.

AUTOR: LADY KATERINE SERRANO MUJICA

ORIENTADOR: FABIO VASCONCELLOS COMIM

Data e Local da Defesa: Santa Maria 30 de julho de 2016.

A exposição a uma grande quantidade de androgênios pode induzir perturbações na função

reprodutiva e metabólica em ratas fêmeas que se assemelham a síndrome dos ovários policísticos

(SOP) em mulheres. Nestes animais, o grau de alteração na esteroidogênese e foliculogênese pode

variar de acordo com o período de intervenção, o que sugere diferentes mecanismos de atuação no

eixo hipotalâmico-pituitário, antes e após o nascimento. Neste estudo, utilizou-se um agonista de

GnRH, acetato de leuprolide, administrado por uma única injeção de depósito até 48h de vida em

ratas Wistar submetidos ao pré-natal e pós-natal protocolos androgenização à procura de seu

impacto reprodutivos. Androgenização pré-natal consistiu na administração de 2,5 mg de

testosterona propionato s.c. às mães nos dias 16, 17 e 18 (grupo pré-natal ou PreN), enquanto

androgenização pós-natal foi realizada através da injeção de 1,25 mg de testosterona propionato s.c

aos animais em 5 dias de vida (Grupo pós-natal ou PostN). Entre 90 e 110 dias de vida, estes

animais foram avaliados para os ciclos de estro (definida por citologia de série vaginal e a presença

do corpo lúteo), a produção de esteroides (níveis séricos de testosterona e androstenediona medida

por HPLC-MS / MS), morfologia dos ovários (histologia) e da expressão gênica hipotalâmica de

Kiss1, Gnrhr e GnRH. Observamos que no grupo PostN, caracterizado por anovulação e aumento

do número combinado de cistos e folículos atrésicos, que uma única injeção de acetato de leuprolide

depot (usualmente com duração de quatro semanas) foi capaz de aumentar no animal adulto as taxas

de ovulação estimadas por esfregaço vaginal. O tratamento com este agonista do GnRH também

reduziu os níveis de testosterona no soro e o número de cistos e folículos atréticos em PostN L em

contraste com os animais do grupo PostN (p = 0,04), ratos pré-natal androgenizadas (PreN)

exibiram alterações significativas nos genes hipotalâmicos, tais como uma redução de Kiss1 e

aumento da Gnrh, em comparação com grupos de controle e PostN. Em nosso conhecimento, este é

o primeiro estudo a mostrar que a administração de agonista de GnRH (acetato de leuprolide) em

dose única pode preservar com sucesso ciclos regulares, reduzir os níveis de androgênios e o

número de cistos / folículos atrésicos em ratas após o nascimento androgenizadas. Além disso, os

resultados obtidos neste modelo animal de SOP sugerem uma clara participação de anormalidades

no GnRH levando a anovulação e formação de cistos.

Palavras chave: síndrome do ovário policístico; programação de desenvolvimento; acetato de

leuprolide.

ABSTRACT

Master Course Dissertation

Professional Graduation Program in Pharmacology

Universidade Federal de Santa Maria

The Impact of Postnatal Leuprolide Acetate Treatment on Reproductive

Characteristics in a Rodent Model of Polycystic Ovary Syndrome

AUTHOR: LADY KATERINE SERRANO MUJICA

ADVISER: FABIO VASCONCELLOS COMIM

Defense Place and Date: Santa Maria, July 30nd

, 2016

Androgen excess induces in female rats reproductive and metabolic disturbances that are similar to

polycystic ovary syndrome in women. In these animals, the degree of changes may vary according

to the timeline intervention, suggesting that the hypothalamic and pituitary axis may present

different actions at pituitary-hypothalamic level before and after birth. The present study employed

an agonist GnRH, leuprolide acetate, administrated as a single dose upto 48h of life in Wistar rats

under prenatal or postnatal androgenisation protocols, looking for its effects on reproductive

endpoints. Prenatal androgenisation (PreN) consisted in the administration of testosterone

propionate 2.5 mg s.c. to mothers at the days 16,17 and 18, while postnatal androgenisation (PostN)

was performed through the injection of 1.25 mg s.c. to animals within 5 day of life. Between 90 -

100 days of life, these rats were evaluated to the present of estral cycles (defined by vaginal smears

and the presence of corpus luteum (CL), steroid levels (serum testosterone and androstenedione

measured by liquid chromatography (HLPC MS/MS), ovarian morphology (histology), and the

expression of mRNA for hypothalamic Kiss1, Gnrhr, and Gnrh and ovarian genes (Cyp17a1,

Cyp19a1, CYp11a1,and Gnrhr).We observed that in PostN group, characterized by anovulation and

increased number of cysts/atretic follicles), a single injection of a leuprolide acetate depot (lasting 4

weeks) (PostN L)was able to increase ovulatory rates, as defined by vaginal smears. The treatment

with this GnRH agonist in PostN L also reduced testosterone serum levels as well the number of

cysts/atretic follicles in contrast with PostN group (p=0.04). Prenatally androgenized rats (PreN)

exhibited significant abnormalities at hypothalamic genes, such as a reduction of Kiss1 and

increased of Gnrh,in comparison with control and PostM groups. To the best of our knowledge,

this is the first study to show that previous administration of a single dose of GnRH agonist

(leuprolide acetate) could successfully preserve regular cycles, reduce androgen levels and the

number of cysts/atretic follicles in rats submitted to androgen excess postnatally. Indeed, the results

obtained with this model of PCOS suggest a clear participation of GnRH disruption to the progress

to anovulation and cysts development.

Key words: polycystic ovary syndrome; developmental programming; leuprolide acetate

9

LISTA DE FIGURA

Figura. 1 Esquema da organização morfológica dos folículos no ovário. ......................................... 17

Figura. 2 Hormônios liberados pela hipófise. ................................................................................... 18

Figura. 3 Ciclo menstrual da mulher ................................................................................................. 19

Figura. 4 Ciclo estral da rata. ............................................................................................................ 21

ARTIGO I

Figure 1. Timeline of treatments. ......................................................................................... 53

Figure 2. Proportion of estrus cycles in female rats. ............................................................ 54

Figure 3. Follicle development. ............................................................................................ 55

Figure 4. Testosterone and androstenedione serum levels ................................................... 56

Figure 5. Expression of steroidogenic enzymes and GNRHR in the ovary. ........................ 57

Figure 6. Expression of Kiss, Gnrh, and Gnrhr in the hypothalamus................................... 58

LISTA DE TABELAS

Tabela 1. Prevalência de SOP em diferentes países. ............................................................ 22

Tabela 2. Características reprodutivas e metabólicas em mulheres com SOP. .................... 23

Tabela 3. Características reprodutivas em modelos animais para estudo de SOP. .............. 32

Tabela 4. Características reprodutivas em modelos Wistar para estudo de SOP. ................ 33

Tabela 5. Características reprodutivas em modelos Sprague-Dawley para estudo de SOP. 34

11

LISTA DE SUPLEMENTOS

Supplementary 1.Estrus cycles in female rats PreN. ............................................................ 59

Supplementary 2. Estrus cycles in female rats PreN L. ........................................................ 60

Supplementary 3. Estrus cycles in female rats PosN............................................................ 61

Supplementary 4. Estrus cycles in female rats PosN L. ....................................................... 62

Supplementary 5. Estrus cycles in female rats Control L..................................................... 63

Supplementary 6. Estrus cycles in female rats PreN Control. .............................................. 64

Supplementary 7.Estrus cycles in female rats PostN Control. ............................................. 65

Supplementary 8. List of primers. ....................................................................................... 66

LISTA DE ABREVIATURA

AR Receptor de androgênio

Ar Gene do receptor de androgênio não humano

ACTH Hormônio Adrenocorticotrófico

AVT Vasopressina

cDNA Ácido desoxirribonucléico

Cyp17a1 Gene do citrocromo P450c17

DHT Diidrotestosterona

DNA Ácido desoxirribonucleico

FSH Hormônio estimulante folicular

GH Hormônio do crescimento

GnRH Hormônio liberador de gonadotrofinas

GNRH Gene do hormônio liberador de gonadotrofinas

humano

Gnrh Gene do hormônio liberador de gonadotrofinas não

humano

Gnrhr Gene do receptor do hormônio liberador de

gonadotrofinas não humano

Kiss1 Gene da kisspeptina não humana

KISS1R Gene do receptor de Kiss humano

Kiss1r Gene do receptor de Kiss não humano

LH Hormônio luteinizante

OT Ocitocina

PCR Reação em cadeia da polimerase

RT-PCR PCR quantitativo em tempo real

Real RNA Ácido ribonucleico

SOP Síndrome dos ovários policísticos

T Testosterona

13

SUMÁRIO

1. INTRODUÇÃO .................................................................................. 10

2. REVISÃO BIBLIOGRÁFICA ............................................................... 14

2.1. EIXO HIPOTÁLAMO-HIPOFISÁRIO E OVÁRIO .......................... 14

2.2. CICLO REPRODUTIVO DOS HUMANOS E ROEDORES ............. 19

2.3. SÍNDROME DE OVÁRIO POLICÍSTICO (SOP) .............................. 21

2.4. MODELOS ANIMAIS PARA SOP .................................................... 28

ARTIGO I......................................................................................................... 35

ABSTRACT .................................................................................................. 36

INTRODUCTION......................................................................................... 37

MATERIALS AND METHODS .................................................................. 38

RESULTS ..................................................................................................... 42

DISCUSSION ............................................................................................... 44

REFERENCES .............................................................................................. 47

3. DISCUSSÃO ............................................................................................. 67

4. CONCLUSÃO .......................................................................................... 69

REFERÉNCIAS ............................................................................................. 70

1. INTRODUÇÃO

A síndrome dos ovários policísticos (SOP) é o distúrbio endócrino mais frequente em

mulheres em idade reprodutiva. Sua etiologia é desconhecida, mas recentemente, fatores

ambientais, como o excesso esteroides sexuais em fases precoces da vida, têm sido

implicados na origem da SOP (FRANKS, 2012), predisposição genética e insultos

ambientais, tais como maternal obesidade, dieta e exposição a várias substâncias, incluindo

esteróides sexuais. Em ratas, o excesso de androgênios ou estrogênios na vida neonatal

altera a função do eixo hipotálamo-hipófise-gonadal e induz alterações reprodutiva e

metabólica similar às observadas na SOP em humanos (MARCONDES et al., 2015).

No entanto, um grande grau de heterogeneidade existe nas características clínicas e

metabólicas da SOP e as razões para esta heterogeneidade são desconhecidas. Vários

modelos têm sido desenvolvidos na tentativa de compreendera contribuição potencial de

exposição a esteroides excessivos em anovulação crônica e produção anormal de

reprodução hormonas, como a exposição aos andrógenos (testosterona, a di-

hidrotestosterona, sulfato de dehidroepiandrosterona), estrogênios e inibidores aromatase,

entre outros (PADMANABHAN & VEIGA-LOPEZ, 2011; PADMANABHAN & VEIGA-

LOPEZ, 2013a), Estudos anteriores têm demonstrado que interfere com androgénio o

processo de ovulação e pode ter um efeito direto sobre o ovário (SARMA et al., 2005).

2. REVISÃO BIBLIOGRÁFICA

2.1. EIXO HIPOTÁLAMO-HIPOFISÁRIO E OVÁRIO

A reprodução feminina depende da atuação coordenada do hipotálamo, da hipófise e

dos ovários. Em cada um destes sistemas, ocorre a produção e liberação de hormônios

fundamentais neste intrincado processo (SILVERTHORN, 2003).

15

O hipotálamo é uma parte do diencéfalo. Ele está delimitado anteriormente pelo

quiasma ótico, posteriormente pelos corpos mamilares e circundado pelo terceiro ventrículo

(MACHADO, 2006). É formado por vários núcleos neurais, muitos com capacidade de

secreção. Destacam-se aqueles localizados na região tuberal por serem especializados na

produção de hormônios que atuam na adenohipófise através do sistema porta hipofisário

(YEN, 2004).

A adenohipófise é uma glândula que compõe a porção anterior da hipófise,

situando-se no osso esfenoide. A glândula está dividida em três regiões: parte proximal,

parte intermédia e distal. A parte distal contem cinco tipos de células com atividade de

secreção hormonal, dentre elas os gonadotrofos, que são os responsáveis pela produção de

gonadotrofinas, sendo este último o hormônio que vai atuar a nível ovariano (STEVENS A,

2002).

O ovário é a gônada feminina. Essa gônada é constituída por duas regiões ou zonas: a

cortical e a medular. A região cortical ovariana a zona onde se encontram os folículos

envoltos em tecido estromal, sendo esta revestida externamente por um epitélio germinativo

e logo abaixo da mesma encontra-se uma camada de tecido conjuntivo denso conhecido

como túnica albugínea. A região medular é a camada mais profunda e mais interna do

ovário, sendo formada por tecido conjuntivo, células intersticiais e elementos vasculares

(KIERSZENBAUM, 2008)

2.1.1. Foliculogênese

No ovário, os folículos estão presentes em diferentes estágios de desenvolvimento,

sofrendo processos de crescimento, proliferação, diferenciação e apoptose. A estrutura do

folículo ovariano é composta por um oócito envolto por células da granulosa e, com o seu

posterior desenvolvimento, de células da teca. Antes do nascimento um grupo de folículos

primordiais é recrutado para desenvolverem-se ao longo da vida, sofrendo alterações tanto

nos oócitos como nas células da granulosa (KIERSZENBAUM, 2008).

Os folículos primordiais (mais simples) são compostos por um oócito e apenas uma

camada de células da granulosa e, a medida que o folículo se desenvolve, vão ocorrendo

modificações das células da granulosa (que deixam de ser achatadas e tornam-se

cuboidais), formando um folículo maior chamado de primário (ERICKSON, 1986). Após

essa fase, as células da granulosa continuam a se dividir através de mitoses e formam entre

duas a dez camadas de células; nesse momento, os folículos são denominados folículos

secundários. As células da granulosa ao se proliferarem produzem um liquido folicular que

resulta na formação de cavidades conhecidas como antro e que levam a denominação de

folículos antrais (ERICKSON, 1986).

Durante a progressão do crescimento do folículo, ocorre o desenvolvimento das

células da teca a partir de células intersticiais do estroma. Essas células irão compor as

camadas do folículo e são divididas arbitrariamente em teca interna e teca externa. As

células da teca são as principais produtoras de androgênios ovarianos, que, por sua vez, são

liberados na circulação, podendo, inclusive, sofrer conversão em estrogênios pelas células

da granulosa (FORTUNE, 1994).

No processo de crescimento do folículo antral, as células da granulosa adquirem

receptores de gonadotrofinas (especialmente FSHR). Além disso, há um aumento na

produção de androgênios e estrogênios permitindo que este folículo se torne dominante.

Quando este folículo atinge o volume máximo, ele é denominado maturo e está pronto

para a ovulação, após o rompimento da superfície folicular (STEVENS A, 2002). Após a

ovulação as estruturas do folículo, composto pelas células da teca e da granulosa, se

reorganizam funcional e morfologicamente para formarem o corpo lúteo. O corpo lúteo

produz predominantemente o hormônio progesterona, sob estímulo do LH, e gonadotrofina

coriônica humana (hCG) (DEVOTO et al., 2009). O tempo médio de vida do corpo lúteo

em humanos é de 14 dias e, depois do período de atividade, essa estrutura e se transforma

em corpo albicans (ERICKSON, 1986), a partir da regressão fisiológica do corpo lúteo. A

Figura 1 representa um esquema da morfologia ovariana dos folículos. Estão representados:

o crescimento folicular, a ovulação e a formação do corpo lúteo.

17

Figura. 1 Esquema da organização morfológica dos folículos no ovário.

2.1.2. Hormônio liberador de gonadotrofina

O eixo hipotálamo-hipófise-gônada (HHG) exerce o controle hormonal sobre os

processos fisiológicos do organismo (Figura 2), bem como os processos reprodutivos. O

controle sobre a reprodução acontece através da produção e secreção de hormônios

específicos relacionados as atividades reprodutivas. Os principais mediadores do eixo

HGG, no contexto da reprodução, são o GnRH, as gonadotrofinas e o estradiol, apesar de

vários outros hormônios e peptídios (como por exemplo, inibinas, activinas, adiponectina,

hormônio anti-mulleriano, etc.) também apresentarem um papel considerável na regulação

do sistema reprodutivo.

Figura. 2 Hormônios liberados pela hipófise.

O GnRH é um decapeptídeo produzido no núcleo arqueado da área pré-ótica e

transportado pelos axônios até a eminência mediana, onde é liberado de forma pulsátil. Esta

liberação, que ocorre de maneira coordenada, irá determinar a secreção dos hormônios

folículo estimulante (FSH) e luteinizante (LH) pela hipófise. Ademais, os padrões de

frequência e amplitude da liberação do GnRH regulam o desenvolvimento folicular em

todas as fases do ciclo estral (GORE et al., 2011).

O FSH atua sobre as células da granulosa levando ao estimulo de crescimento e

diferenciação do folículo. Ele tem ação na síntese de LH e aumenta atividade da enzima

aromatase. O FSH é um dos elementos chaves na secreção de estradiol pelas células da

granulosa (SPEROFF L, 2005). Já o LH atua nas células da teca interna estimulado a

produção de andrógenos via indução das enzimas CYP11A1 e CYP17A1 (MILLER &

AUCHUS, 2011).

Os androgênios são esteróides sexuais fundamentais para a reprodução feminina uma

vez que são o substrato primário para a produção de estrogênios. Na mulher os principais

sítios de produção de androgênios, representados principalmente pela testosterona, são a

glândula suprarrenal e o ovário. Embora potente a testosterona pode ser convertida em

19

outro hormônio ainda mais potente, a dihidrotestosterona (DHT). Essa conversão ocorre a

nível tecidual e é realizada pela enzima 5 α-redutase. A DHT é sabidamente um androgênio

biologicamente ativo e não aromatizável que se associa a ligantes e receptores nucleares de

androgênios desencadeando uma resposta biológica. Um excesso de androgênios pode levar

a diferentes consequências clínicas e metabólicas que envolvem a ciclicidade e qualidade

dos oócitos (ALEXANDERSON et al., 2007).

2.2. CICLO REPRODUTIVO DOS HUMANOS E ROEDORES

A duração do ciclo reprodutivo feminino humano é de aproximadamente 28 dias

Figura 3. A normalidade e a periodicidade desse ciclo dependem da sincronia de diferentes

processos biológicos (YEN, 1977; ROJAS et al., 2015; AYOOLA et al., 2016). O ciclo

menstrual é dividido em duas fases. Na primeira fase ocorre o predomínio do hormônio

estradiol sintetizado sob estímulo do FSH, estimulando o crescimento folicular. Por sua

vez, os níveis de estradiol aumentam paralelamente a esse crescimento chegando aos seus

níveis mais altos quando o folículo sofre maturação. Ao final desse período de maturação,

pouco antes da ovulação, ocorre o pico da secreção de LH, evento esse que desencadeia o

processo de ovulação (GARZO et al., 1988; ROJAS et al., 2015).

Figura. 3 Ciclo menstrual da mulher.

Após a ovulação se inicia a fase lúteal onde o conteúdo folicular não expelido com

o oócito, denominado como corpo lúteo, passa a produzir e secretar a progesterona. A

progesterona possui ação sobre o endométrio uterino e prepara o mesmo para uma possível

gestação, sendo o hormônio predominante da fase lútea. O corpo lúteo possui uma vida

média de 13 a 15 dias e, ao passar deste período, entra em processo de senescência e atresia

cessando a sua produção de esteroide o que provoca uma queda drástica nos níveis de

progesterona. Com a diminuição dos níveis de progesterona ocorre a perda de sustentação

da matriz extracelular do endométrio e sua subsequente descamação, o que precipita a

menstruação. O ciclo menstrual possui uma duração média de 28 dias. Consequentemente,

a menstruação foi definida como o primeiro dia do ciclo menstrual (GARZO et al., 1988).

Nas ratas, o ciclo estral dura 4 dias e é composto por quatro fases: proestro, estro,

metaestro e diestro (Figura 4). Cada uma dessas fases se caracteriza pela predominância de

células epiteliais, células queratinizadas e leucócitos no esfregaço vaginal (MARCONDES

et al., 2002). O proestro é caraterizado por células epiteliais nucleadas. Nessa fase, os

hormônios FSH, LH e estradiol alcançam seu pico. Durante o inicio do proestro e o fim do

estro ocorre a ovulação. No estro, há uma maior quantidade de células queratinizadas e o

estradiol esta nos níveis basais; no metaestro as quantidades de células epiteliais,

queratinizadas e leucócitos são iguais; enquanto que, no diestro há uma maior quantidade

de leucócitos e muco (MARCONDES et al., 2002).

21

Figura. 4 Ciclo estral da rata.

2.3. SÍNDROME DO OVÁRIOS POLICÍSTICO (SOP)

A síndrome dos ovários policísticos (SOP) é um dos distúrbios endócrino mais

frequente em mulheres em idade reprodutiva, tendo sido relatada pela primeira vez em

1935 por Stein e Leventhal (NORMAN et al., 2007). A SOP afeta 6 a 8% da população

feminina em idade reprodutiva, de acordo com o consenso NIH e Rotterdam (AZZIZ ET

AL., 2006; GOODARZI & AZZIZ, 2006) (Tabela 1). A SOP engloba um amplo espectro

de sinais de disfunção ovariana, provavelmente de origem genética influenciada por fatores

ambientais. A heterogeneidade genética e as diversas manifestações clínicas têm suscitado

cada vez mais interesse por parte dos investigadores sendo usado como modelo clínico da

relação entre funções endócrinas (MASON et al., 2008).

Tabela 1. Prevalência de SOP em diferentes países.

Pais População

Idade

Prevalência

(%)

Autor

USA 18-45 anos 4,7 (AZZIZ et al., 2004)

Grécia 17-45 anos 6,8 (DIAMANTI-KANDARAKIS et al., 1999)

Inglaterra 1825 anos 8,0 (MICHELMORE et al., 1999)

China 20-43 anos 2,2 (CHEN et al., 2008)

Austrália 27-34 anos 11,9 (MARCH et al., 2010)

Iran 18-42 anos 15,2 (MEHRABIAN et al., 2011)

Atualmente, o diagnóstico de SOP tem sido estabelecido segundo os critérios do

The Rotterdam Consensus (2003), que incluem pelo menos dois dos três elementos que

seguem: 1) hiperandrogenismo clínico (presença de hirsutismo, acne ou alopecia) ou

laboratorial (aumento de androgênios séricos); 2) oligo-anovulação (menos de 8 ciclos por

ano ou amenorreia); 3) alterações ultrassonográficas do ovário (aumento de volume ou mais

de 12 folículos antrais entre 3-9 mm de diâmetro). O critério anterior da SOP, proposto pelo

NIH (1990) diferia do descrito acima pela ausência do critério ultrassonográfico sendo

determinado apenas pela presença de hiperandrogenismo (hiperandrogenemia) e alterações

menstruais características. Em ambos os casos, o diagnóstico de SOP só se estabelece após

a exclusão de outras patologias tais como a síndrome de Cushing, hiperplasia adrenal

congênita (forma não clássica, usualmente por deficiência de 21-hidroxilase),

hipotireoidismo, hiperprolactinemia, tumores virilizantes, uso exógeno de anabolizantes

esteroides, entre outras. Uma condição comum e não patológica que aparece como

diagnóstico diferencial da SOP é o hirsutismo periférico (antigamente denominado

idiopático), onde a função ovariana é completamente normal.

23

Tabela 2. Características reprodutivas e metabólicas em mulheres com SOP.

Diversos mecanismos implicados no desenvolvimento da SOP têm sido descritos

nas últimas décadas. A fisiopatologia do hiperandrogenismo, que é a principal característica

da SOP, envolve disfunções nos compartimentos hipotalâmico-hipofisário e gonadal. Em

uma parcela das mulheres com SOP foi identificado um padrão anormal de pulsatilidade

com liberação acelerada do GnRH, além de uma resposta reduzida ao feedback negativo ao

progestogênio. Ademais, um aumento de frequência e amplitude na secreção de LH em

mulheres com SOP tem sido descrita. O LH é sabidamente um estimulador da produção de

androgênios pelas células da teca ovariana e também responsável pela luteinização das

células da granulosa (LEVI-SETTI et al., 2004). Embora não exista uma deficiência de

FSH, a ação desta gonadotrofina é limitada e incapaz de induzir a ovulação.

A hiperandrogenemia da SOP está diretamente ligada ao aumento de estimulação

do LH nas células da teca ovariana onde são sintetizadas a androstenediona, a DHEA e a

testosterona (ABBOTT et al., 2008). A falta de ciclicidade e o aumento numérico de

folículos antrais (com células da granulosa luteinizadas e com menor atividade da

Características reprodutivas e metabólicas em mulheres com SOP

Características reprodutivas

Referências

Androgênios aumentados em soro Sim (ROSENFIELD, 1997; ABBOTT et al., 2005;

CARMINA et al., 2005)

LH (aumento frequência)

Sim (ROSENFIELD, 1997; DUMESIC et al.,

2007)

Anovulação

Sim (ROSENFIELD, 1997; DUMESIC et al.,

2007)

Aumento do número de Folículos

Antrais

Sim (ROSENFIELD, 1997)

Características Metabólicas

Referências

Intolerância Sim (DUNAIF, 1997; PASQUALI & FILICORI,

1998)

Obesidade Sim (PASQUALI & FILICORI, 1998;

GAMBINERI et al., 2002)

Dislipidemia Sim (WILD, 2012; KIM & CHOI, 2013)

aromatase) acabam também favorecendo um maior acumulo de androgênios. Um

interessante estudo in vitro mostrou que, mesmo após diversas passagens, as células da teca

de mulheres com SOP persistiam com uma maior capacidade de produzir androgênios

quando cultivadas nas mesmas condições de cultivo que o grupo controle (MACIEL et al.,

2004; ABBOTT et al., 2008). Além disso, os níveis de androgênios na SOP estão

significativamente aumentados devido á hiperatividade enzimática da 5α-redutase, que

limita a ação da aromatase atuando como um inibidor competitivo impedindo a seleção

folicular (WALTERS et al., 2008).

Outras condições comumente presentes nessas pacientes favorecem um aumento de

produção dos androgênios. A obesidade, observada em até 50% dos casos, pode estar

associada a níveis elevados de insulina, que, semelhantemente ao LH, é estimulador da

secreção de androgênios pela teca (WALTERS et al., 2008). Na presença de resistência à

ação da insulina a produção da globulina carreadora de hormônios sexuais (SHBG) pode

estar reduzida gerando uma consequente elevação da testosterona livre, o que, por sua vez,

significa uma maior biodisponibilidade da testosterona nos tecidos-alvos e agravamento da

hiperandrogenemia.

Na SOP, as adrenais, participam da produção excessiva de androgênios. Essa

condição ocorre em 20 a 60% das pacientes com SOP (MORAN et al., 1999; KUMAR et

al., 2005) e se manifesta através de níveis elevados dos seguintes hormônios: sulfato de

deidroepiandrosterona (DHEAS), 11β-hidroxiandrostenediona (11β-OHA),

deidroepiandrosterona (DHEA), Androstenediol e Androstenediona (LOUGHLIN et al.,

1986). Os mecanismos do hiperandrogenismo adrenal na SOP não estão totalmente

esclarecidos sendo que o maior catabolismo do cortisol e/ou a resposta amplificada dos

androgênios adrenais a níveis normais de ACTH têm sido propostos (LOUGHLIN et al.,

1986).

25

2.3.1. Fisiopatologenia

Diversos mecanismos implicados no desenvolvimento da SOP têm sido descritos

nas últimas décadas. A fisiopatogenia do hiperandrogenismo, que é a principal

característica da SOP, envolve disfunções nos compartimentos hipotalâmico-hipofisário e

gonadal.

Em uma parcela das mulheres com SOP foi identificado um padrão anormal de

pulsatilidade com liberação acelerada do GnRH, além de uma resposta reduzida ao

feedback negativo ao progestogênio. Ademais, um aumento de frequência e amplitude na

secreção de LH em mulheres com SOP tem sido descrita. O LH é sabidamente um

estimulador da produção de androgênios pelas células da teca ovariana e também

responsável pela luteinização das células da granulosa (LEVI-SETTI et al., 2004). Embora

não exista uma deficiência de FSH, a ação desta gonadotrofina é limitada e incapaz de

induzir a ovulação.

2.3.2. Hiperprodução de androgênios pelo ovário e adrenal.

A hiperandrogenemia da SOP está diretamente ligada ao aumento de estimulação do

LH nas células da teca ovariana onde são sintetizadas a androstenediona, a DHEA e a

testosterona (ABBOTT et al., 2008). A falta de ciclicidade e o aumento numérico de

folículos antrais (com células da granulosa luteinizadas e com menor atividade da

aromatase) acabam também favorecendo um maior acumulo de androgênios. Um

interessante estudo in vitro mostrou que, mesmo após diversas passagens, as células da teca

de mulheres com SOP persistiam com uma maior capacidade de produzir androgênios

quando cultivadas nas mesmas condições de cultivo que o grupo controle (MACIEL et al.,

2004). Além disso, os níveis de androgênios na SOP estão significativamente aumentados

devido a hiperatividade enzimática da5α-redutase e esta limita a ação da aromatase atuando

como um inibidor competitivo impedindo a seleção folicular (SAM & EHRMANN, 2015).

Outras condições comumente presentes nestas pacientes favorecem um aumento de

produção dos androgênios. A obesidade, observada em até 50% dos casos, pode estar

associada a níveis elevados de insulina, que semelhantemente ao LH, é estimulador da

secreção de androgênios pela teca (WALTERS et al., 2008). Na presença de resistência à

ação da insulina a produção da globulina carreadora de hormônios sexuais (SHBG) pode

estar reduzida gerando uma consequente elevação da testosterona livre, o que por sua vez,

significa uma maior biodisponibilidade da testosterona nos tecidos-alvos e agravamento da

hiperandrogenemia.

Na SOP as adrenais participam da produção excessiva de androgênios. Essa ocorre

em 20 a 60% das pacientes com SOP (MORAN et al., 1999; KUMAR et al., 2005) e se

manifesta através de níveis elevados dos seguintes: sulfato de deidroepiandrosterona

(DHEAS), 11β-hidroxiandrostenediona (11β-OHA), deidroepiandrosterona (DHEA),

Androstenediol e Androstenediona (LOUGHLIN et al., 1986). Os mecanismos do

hiperandrogenismo adrenal na SOP não estão totalmente esclarecidos sendo que o maior

catabolismo do cortisol e/ou a resposta amplificada dos androgênios adrenais a níveis

normais de ACTH têm sido propostos (LOUGHLIN et al., 1986).

2.3.3. Alterações morfológicas do ovário e etiologia

A característica morfológica dos ovários nas mulheres com SOP é o maior número

de folículos antrais, geralmente projetados na área subcortical por causa do aumento

importante da área do estroma. A falta da presença do corpo lúteo é habitual nos casos de

anovulação crônica (MACIEL et al., 2004).

Estudos indicam que o aumento de folículos antrais sem a seleção de um folículo

dominante, como veste na SOP, está acompanhado de um recrutamento precoce de

pequenos folículos primordiais, causando um acúmulo de folículos em crescimento

denominado “stockpilling” (MACIEL et al., 2004).

A etiologia que envolve a SOP é desconhecida, muita pesquisa tem sido feita

procurando descobrir a causa desta síndrome considerada um dos principais problemas que

levam a infertilidade nas mulheres.

Acredita-se numa origem genética influenciada por fatores epigenéticos na gestação.

A exposição estrogênica durante a fase fetal pode ser alterada pela reprogramação e

diferenciação das células alvo por meio de modificações da metilição do DNA durante o

desenvolvimento (PRINS et al., 2007). Os genes mais frequentes investigados na SOP são

27

aqueles relacionados com a ação e a regulação dos androgênios e os envolvidos na insulino

resistência.

Pode existir exposição estrogênico-androgênica devido a fatores ambientais externos

(DASGUPTA & REDDY, 2008) além de outros mecanismos ambientais. A obesidade,

muitas vezes presente na SOP, é o principal fator ambiental influenciado pelo estilo de vida

das mulheres. Aproximadamente 50% das mulheres que têm SOP são obesas ou têm sobre

peso. Cabe ressaltar que a obesidade tem um papel crucial no desenvolvimento e na

manutenção da SOP (ESCOBAR-MORREALE et al., 2005; DIAMANTI-KANDARAKIS

et al., 2006).

2.3.4. Fatores genéticos e ambientais

Existe uma forte associação familiar de SOP. O papel genético no desenvolvimento do

SOP foi avaliado de diferentes maneiras: genes candidatos, linkage, GWAS, etc.. A maioria

dos estudos foi focada em mecanismos como disfunção da esteroidogenese, resistência

insulina, obesidade e função gonadotrópica, etc.. , sem, contudo identificar um padrão claro

de transmissão (DIAMANTI-KANDARAKIS et al., 2006) da síndrome. Acredita-se que

um padrão de herança poligênica possa explicar melhor este transtorno. Fatores ambientais

também podem predispor mulheres geneticamente susceptíveis ao desenvolvimento da SOP

(AZZIZ et al., 2009). Um estilo de vida que inclua hábitos de alimentação rica em gorduras

e hidratos de carbono, pouco exercício físico e sedentarismo, estresse peri-puberal e/ou

exposição a hormônios exógenos pode influenciar no aparecimento dessa síndrome. Os

processos envolvidos na fisiopatologia da SOP são múltiplos sendo a desregulação

endócrina por substâncias químicas um dos mais estudados dentre as principais causas que

contribuem na fisiopatogenese desse transtorno (DIAMANTI-KANDARAKIS et al.,

2009). Nos últimos anos os estudos têm identificado moléculas que podem estar envolvidos

na SOP. O bisfenol A é um composto sintético que é amplamente empregado na indústria

de plásticos. É um disruptor endócrino relacionado com a atividade estrogênica e pode se

unir tanto aos receptores de andrógenos quanto aos receptores de estrogênio (DIAMANTI-

KANDARAKIS et al., 2009). Em alguns estudos, o bisfenol A foi relacionado com os

seguintes transtornos: obesidade, diabetes tipo 2 e doenças cardiovasculares (LANG et al.,

2008; MELZER et al., 2012). Em estudos experimentais o bisfenol A foi associado a

esteroidogênese e foliculogênese debilitadas e morfologia ovariana alterada (NEWBOLD et

al., 2007). No momento há poucos estudos referentes à bisfenol relação a SOP em

mulheres adultas (TARANTINO et al., 2013). A exposição de androgênios gera alterações

do ambiente do útero que pode implicar na fisiopatologia da síndrome. Outros estudos

relacionaram o atraso do crescimento e o baixo peso ao nascer a resistêcia à insulina na

vida adulta (DASGUPTA & REDDY, 2008). A hiperplasia adrenal congênita é uma

doença autossômica recessiva na qual ocorre uma deficiência enzimática na cascata da

esteroidogênese adrenal levando à falta de produção dos hormônios diretamente

dependentes da enzima para a sua produção. Pelo mecanismo de feedback negativo, a falta

desses hormônios leva à hipersecreção de ACTH (Hormônio adrenocorticotrófico) pela

hipófise, resultando em hiperestimulação das glândulas adrenais, com consequente aumento

de tamanho das mesmas resultando em hipersecreção de androgênios (VAN DER KAMP

et al., 2001).

2.4. MODELOS ANIMAIS PARA SOP

A evolução humana e das demais espécies de animais está relacionada a uma

relação predatória e de simbioses (LYONS, 1987). No ano de 1965 Claude Bernard

realizou os seus primeiros estudos de fisiologia e iniciou a utilização de animais como

modelo de estudo e experimentação. Claude Bernard provocou alterações semelhante á

das doenças humanas através e alterações físicas e químicas nesses animais (BERNARD,

1965). Atualmente, os animais são utilizados em todos os campos da pesquisa biológica

(RUSSELL, 2001). Além do que, a relação entre animais e humanos tornou-se cada vez

mais forte existindo um entrelaçamento entre a sobrevivência de ambos. Ou seja, a

sobrevivência de um depende da sobrevivência de todos e isto faz parte de um conjunto

interligado (VIEIRA S, 1998).

Baseados na hipótese que os níveis de androgênios elevados durante o período fetal

ou após o nascimento podem estar associados a este transtorno endócrinos muitos pesquisas

sobre SOP tem sido feitas com o objetivo de entender sua origem (BRIDGES et al., 1993;

DUMESIC et al., 2005; PADMANABHAN et al., 2006). Dados experimentais em animais

mostram que androgenizaçao pré-natal resulta em muitas das caraterísticas do SOP. Além

29

disso, a exposição do eixo fetal hipotalâmico-hipofisário-ovário influencia na dinâmica

folicular prematura levando a uma serie de eventos que resultam nas consequências

metabólicas e reprodutivas da SOP (ESCOBAR-MORREALE et al., 2005). Varias espécies

animais tem sido empregada para o estudo da SOP, entre estas se incluem primatas,

ruminantes e roedores.

2.4.1. Modelos em Primatas

Primatas da espécie Rhesus foram submetidos à administração pré-natal de

androgênios (testosterona) em doses elevadas, reproduzindo na vida adulta caraterísticas

metabólicas e reprodutivas típicas de pacientes com SOP (FOSTER, 1977; ZHOU et al.,

2005). Interessantemente, o sistema neuroendócrino dos primatas tem uma sensibilidade

reduzida ao feedback negativo dos hormônio esteroides, sendo esta limitada ao feedback

negativo de progesterona, muito semelhante aos pacientes com SOP.

Em primatas tratados com Testosterona pré-natal houve um aumento do LH. Outros

sim, esta é uma característica dos macacos Rhesus e de outros modelos animais

semelhantes às mulheres que apresentam SOP (ABBOTT et al., 2005). É importante

ressaltar que a maioria dos estudos avaliou apenas a competência oocitária enquanto que os

estudos em macacos avaliaram também o seu desenvolvimento (DUMESIC et al., 2002).

Embora mais próximos dos humanos existem alguns problemas para se estudar os

primatas. Esses problemas envolvem aspectos éticos, custo e o tempo para atingir a idade

reprodutiva. Nos primatas a menarca ocorre aos 2,5 anos, a idade e a competência

reprodutiva entre os 2,5 e os 3,5 anos (WILSON & GORDON, 1989).

2.4.2. Modelos em Ovelhas

O emprego de ovelhas como modelo de SOP tem sido bastante difundido pelas

características monovulatórias desta espécie (PADMANABHAN & VEIGA-LOPEZ,

2013b). Estudos de fertilidade foram realizados em ovinos tratados apenas com T pré-natal

(dias 60-90 de gestação) e eles demonstram que uma gravidez bem sucedida foi alcançada

em apenas 40% destas fêmeas (STECKLER et al., 2007).

O aumento na produção de LH foi também uma característica ovelhas tratadas com

T pré-natal, e esse aumento foi acompanhado da presença de androgênios (SHARMA et

al., 2002; ABI SALLOUM et al., 2013) muito semelhante aos modelos animais realizados

em macacos. Da mesma forma que os modelos descritos anteriormente com primatas o

mecanismo de retroalimentação negativa foi limitado ao feedback negativo à progesterona

(ROBINSON et al., 1999; VEIGA-LOPEZ et al., 2008). Além do que, houve prejuízo em

todos os três mecanismos de feedbacks neuroendócrino (estradiol positivo, estradiol

negativo, e progesterona negativo) em animais tratados com T (SHARMA et al., 2002;

SARMA et al., 2005; UNSWORTH et al., 2005).

A morfologia do folículo em ovelhas também já foi estudada em ovinos. A persistência

folicular foi descrita em animais que receberam T pré-natal (ABI SALLOUM et al., 2013).

2.4.3. Modelos em Roedores.

Uma das opções mais utilizadas para a realização de modelos animais da SOP são

os roedores. Algumas vantagens destas espécies se baseiam no conhecimento amplo de sua

genética, no curto tempo para aquisição de idade reprodutiva e nas grandes facilidades de

manipulação e alojamento (WALTERS et al., 2008)

Os primeiros estudos nessas espécies foram realizados se injetando testosterona

propionato no quinto dia de vida (período pré-natal). Esses modelos resultaram em

anovulação na vida adulta e infertilidade (BARRACLOUGH, 1961).

Um trabalho realizado em ratas demonstrou que a injeção neonatal de propionato de

testosterona reproduziu, na vida adulta desses animais, distúrbios metabólicos tais como a

hiperinsulinemia. Nesse mesmo estudo, notou-se que a injeção neonatal de outro composto

a base de DHT também induziu a resistência à insulina, porém de modo mais significativo

(ALEXANDERSON et al., 2007). Em conclusão a DHT e a testosterona quando injetadas

em ratas nos primeiros cinco dias de vida induzem a anovulação com estro persistente.

Outros modelos foram realizados a partir da ideia que o excesso de estrogênios tem

efeitos similares ao efeito do excesso androgênios em ovários de animais (ABBOTT et al.,

2006; VEIGA-LOPEZ et al., 2008), Pode-se afirmar que alguns dos efeitos da testosterona

sejam mediados pela sua conversão ao estradiol (SINGH, 2005). Utilizando-se então o

31

estradiol foram induzidos modelos de ratas com ovários policísticos. Esses modelos

também demonstraram que ratas expostas ao estradiol precocemente apresentavam níveis

elevados de testosterona e dislipidemia, achados estes muito similares aos encontrados na

SOP em humanos (ALEXANDERSON et al., 2007).

Com base na literatura atual, é possível inferir que tanto os androgênios quanto os

estrogênios podem estar relacionados com a origem da SOP, já que o excesso desses

compostos em fases precoces da vida induz características reprodutivas e metabólicas

semelhantes à de pacientes com esta síndrome em animais.

Tabela 3. Características reprodutivas em modelos animais para estudo de SOP.

Desfechos Primatas Ovelhas Camundongos

Modelos Pré-natal Pós-natal Pré-natal Pós-natal Pré-natal Pós-natal

Desfechos Reprodutivos

Androgênios aumentados

em soro

Sim (EISNER et al., 2002;

ABBOTT et al., 2005;

DUMESIC et al., 2007)

Sim (BILLIAR et al., 1985)

Sim (ROBINSON et al.,

1999; SHARMA et al.,

2002)

Sim (MANIKKAM et al.,

2008)

Sim (ROLAND et al.,

2010)

(WALTERS et al., 2008)

Sim (WALTERS et al.,

2008)

Morfologia similar a SOP

Sim (DUMESIC et al., 2007)



1999; SHARMA et al., 2002)


2008)

Sim (ROLAND et al.,

2010) (WALTERS et al.,

2008)


2008)

LH (aumento frequência)

Sim (EISNER et al., 2002;

ABBOTT et al., 2005;

DUMESIC et al., 2007)



1999; SHARMA et al.,

2002)

Não

Sim (ROLAND et al.,

2010)

(WALTERS et al.,

2008)

Não

Anovulação

Sim (DUMESIC et al., 2007)


Não Sim (MANIKKAM et al.,

2004)

Não Não

Aumento do numero de

Folículos Antrais

Sim (DUMESIC et al., 2007; ABBOTT et al., 2013)

(EISNER et al., 2002)


Sim (WEST et al., 2001)


2004)

Sim (ROLAND et al.,

2010)

(WALTERS et al.,

2008)


2008)

33

Tabela 4. Características reprodutivas em modelos Wistar para estudo de SOP.

Wistar

DHT T LETROZOLE

Pré-natal Pós-natal Pré-natal Pós-natal Pré-natal Pós-natal


Androgênios aumento no

soro

Sim (MCDONALD &

DOUGHTY, 1972)

Sim (MANNERAS et al.,

2007)

Sim (SLOB et al., 1983)

Sim (TEHRANI et al.,

2014)

(PINILLA et al.,

1993)

Sim (CALDWELL et

al., 2014)


2007)


Sim (MCDONALD &

DOUGHTY, 1972)


2007)



2014)

(PINILLA et al., 1993)

Sim (CALDWELL et

al., 2014)


2007)

LH aumento na frequência

- - Sim (SLOB et al., 1983)


2014)

- Sim (KAFALI et al., 2004)

Aciclicidade

Não Não Sim (SLOB et al., 1983)

Não Não Sim (MANNERAS et al.,

2007)

Aumento do número de

folículos antrais

Sim (MCDONALD &

DOUGHTY, 1972)


2007)



2014)

(PINILLA et al.,

1993)

Sim (CALDWELL et

al., 2014)


2007)

Tabela 5. Características reprodutivas em modelos Sprague-Dawley para estudo de SOP.

Sprague–Dawley

DHT T LETROZOLE

Pré-natal Pós-natal Pré-natal Pós-natal Pré-natal Pós-natal


Androgênios aumento no soro

Sim

(WU et al., 2010)

(FOECKING et al., 2005)


2008)

Sim (WU et al., 2010)

(TYNDALL et al., 2012)

Sim (SWANSON &

WERFFTENBOSCH, 1964)

Sim (XU et al., 2015)

Sim (KAFALI et al., 2004)


Sim

(WU et al., 2010)


2008)


(TYNDALL et al., 2012)

Sim (SWANSON &

WERFFTENBOSCH, 1964)

(TYNDALL et al.,

2012)



2007)

LH aumento frequência

Sim

(WU et al., 2010)

- Sim (WU et al., 2010)

(TYNDALL et al.,

2012)

Sim (SWANSON &

WERFFTENBOSCH,

1964)



Aciclicidade

Não Não Sim

(WU et al., 2010)

Não Não Sim (KAFALI et al., 2004)

Aumento do número de folículos

antrais


(FOECKING et al.,

2005)


2008)

Sim (WU et al., 2010) (TYNDALL et al.,

2012)



35

ARTIGO I

TRABALHO SUBMETIDO PARA PUBLICAÇÃO:

The Impact of Postnatal Leuprolide Acetate Treatment on

Reproductive Characteristics in a Rodent Model of Polycystic

Ovary Syndrome

Lady Katerine Serrano Mujica, Kalyne Bertolin, Alessandra Bridi, Werner Giehl

Glanzner, Vitor Braga Rissi, Flávia de los Santos de camargo, Alfredo Quites

Antoniazzi, Paulo Bayard Dias Gonçalves, Melissa Orlandin Premaor, Fabio

Vasconcellos Comim.

MOLECULAR AND CELLULAR ENDOCRINOLOGY

“The Impact of Postnatal Leuprolide Acetate Treatment on Reproductive 1

Characteristics in a Rodent Model of Polycystic Ovary Syndrome” 2

Lady Katerine Serrano-Mujicaa, Kalyne Bertolin

a, Alessandra Bridi

a, Werner Giehl-3

Glanznera ,

Vitor Braga-Rissia, Flávia de los Santos-de Camargo

a, Alfredo Quites-4

Antoniazzia, Paulo Bayard Dias-Gonçalves

a, Renato Zanella

c, Melissa Orlandin-Premaor

b, 5

Fabio Vasconcellos-Comimab

*. 6

aLaboratory of Biotechnology and Animal Reproduction - BioRep, Federal University of Santa Maria 7

(UFSM), Santa Maria, RS, Brazil. 8

bDepartment of Clinical Medicine, Federal University of Santa Maria (UFSM), Santa Maria, RS, 9

Brazil. 10

cLaboratoryof pesticide residue analysis, Federal University of Santa Maria (UFSM), Santa Maria, 11

RS, Brazil. 12

*Corresponding author. Email: [email protected] phone: 555532208752, Av.Roraima 1000, 13

Santa Maria RS;, Brasil. 14

15

ABSTRACT 16

Androgen exposure can induce disruptions in reproductive and metabolic function in female 17

rats that resemble polycystic ovary syndrome (PCOS) in women. Disordered steroidogenesis 18

and folliculogenesis in these animals may vary according to the period of intervention, 19

suggesting different possible mechanisms operating changes in the hypothalamic-pituitary 20

axis before and after birth. In this study, we utilized a GnRH agonist, leuprolide acetate, given 21

as a single depot injection up to 48h of life in Wistar female rats submitted to prenatal and 22

postnatal androgenization protocols, looking for its impact on reproductive endpoints. 23

Prenatal androgenization consisted of the administration of 2.5mg of testosterone propionate 24

s.c. to the mothers at Embryonic Days 16, 17, and 18 (Prenatal group or PreN), while 25

postnatal androgenization was performed through the injection of 1.25mg testosterone 26

propionate s.c to animals at 5 Days of life (Postnatal Group or PostN). Controls were 27

constituted for each androgenized group. Between 90 and 110 days of life, these animals were 28

evaluated for their estrus cycles (defined by serial vaginal cytology and the presence of corpus 29

luteum), steroid production (serum testosterone and androstenedione measured by HPLC-30

MS/MS), ovary morphology (histology), and hypothalamic gene expression of Kiss1, 31

GnRHR, and GnRH. Remarkably, a single injection of leuprolide acetate depot (lasting three 32

to four weeks) was able to increase ovulation rates estimated by serial vaginal smears from 33

0% of estrus cycles in the postnatal group (PostN) to 25% of estrus cycles in the postnatal 34

mailto:[email protected]

37

leuprolide-treated group (PostN L). Leuprolide also reduced the serum testosterone levels and 35

the number of cysts and atretic follicles in PostN L in contrast with animals from the PostN 36

group (p=0.04). Prenatally androgenized rats (PreN) exhibited significant modifications in the 37

hypothalamic genes, such as a reduction of Kiss1 and an increase in Gnrh in comparison to 38

PostN and control groups. However, the leuprolide treatment increased the gene expression of 39

hypothalamic Kiss1 in the prenatally androgenized rat (PreN L) compared with animals not 40

treated with leuprolide (PreN). To the best of our knowledge, this is the first study to show 41

that the administration of GnRH agonist (leuprolide acetate) as a single dose can successfully 42

preserve regular cycles and reduce androgen levels and the number of cysts/atretic follicles in 43

postnatally androgenized female rats. Besides, the results obtained indicate that in the rodent 44

model employed, a GnRH axis disruption has a potential role in the progress of anovulation 45

and the development of cysts. 46

Keywords: polycystic ovary syndrome; developmental programing; leuprolide acetate, 47

48

INTRODUCTION 49

50

Polycystic ovary syndrome (PCOS) is one of the most frequent causes of anovulatory 51

infertility, affecting 5%–10% of women of reproductive age worldwide. PCOS is an 52

endocrine disorder characterized by hyperandrogenism and ovarian abnormalities related to a 53

disruption in the hypothalamic–pituitary–ovarian axis (Baptiste et al. 2010; Davies et al. 54

2011; Franks 2012; Glintborg 2016). Growing evidence in the literature has suggested that 55

changes occurring during gestation or even early after birth could be related to many 56

reproductive conditions that replicate PCOS features in adult life (Barker 1990; Franks 2012). 57

Indeed, rhesus monkeys, sheep, and rodents submitted to exposure to high levels of androgens 58

or aromatase inhibitors demonstrate biochemical hyperandrogenism or chronic anovulation in 59

adult life (Abbott et al. 2005; Birch et al. 2003; Chinnathambi et al. 2012; Franks 2012; 60

Manneras et al. 2007; Ortega et al. 2009; Padmanabhan and Veiga-Lopez 2013; Walters et al. 61

2012; West et al. 2001). In rats, distinct phenotypes are observed after prenatal or postnatal 62

androgenization protocols. In most of the studies, the exposure to androgens during the 63

prenatal period is associated with an increased level of testosterone in adulthood 64

(Chinnathambi et al. 2012; Daneshian et al. 2015; Tehrani et al. 2014; Wu et al. 2010). 65

Nevertheless, not frequently identified are other features suggestive of PCOS: rats submitted 66

to fetal programming (prenatal protocols) usually demonstrated the persistence of estrus 67

cycles (Tehrani et al. 2014; Tyndall et al. 2012; Wu et al. 2010) and almost invariably showed 68

normal ovary size (Tyndall et al. 2012; Wu et al. 2010). As a rule, the appearance of ovaries 69

from rats treated with androgens prenatally is not significantly different than that of controls; 70

just a few studies have reported the multicystic appearance of ovaries (Fels and Bosch 1971; 71

Slob, et al. 1983; Tyndall et al. 2012; Wu et al. 2010). In contrast to fetal programming, 72

postnatal rodent models of PCOS are usually characterized by disrupted ovulation (Anderson, 73

et al. 1992; Huffman and Hendricks 1981; Lee, et al. 1991; Tyndall et al. 2012; Weisz and 74

Lloyd 1965), development of cysts, decrease or absence of corpus luteum ovulation 75

(Anderson et al. 1992; Huffman and Hendricks 1981; Lee et al. 1991; Tyndall et al. 2012; 76

Weisz and Lloyd 1965), and increase of androgen levels (Lee et al. 1991; Marcondes, et al. 77

2015; Weisz and Lloyd 1965). In this hypothesis-generating study, we investigated the effects 78

of GnRH agonist (acetate leuprorelin) in rats submitted to an androgen excess before and after 79

birth. As shown below, the treatment before 48h of life with a single injection of Leuprolide 80

acetate depot (lasting 3-4 weeks) was able to increase ovulatory rates and reduce the cysts and 81

atretic follicles in postnatal androgenized rat model. Even so, it did not change androgen 82

levels or hypothalamic (Kiss1, GnRH) or ovarian (CYP17a1, CYP11a1, and STAR) 83

expression of key genes. These results contrasted with the prenatal model of treatment with 84

leuprolide (PreN L), which exhibited a small improvement in estrus cycles (not affecting the 85

corpus luteum or atretic follicle number), associated with a significant modification of the 86

expression of Kiss1 and GnRH genes in the hypothalamus. 87

MATERIALS AND METHODS 88

Animals 89

This study was approved by the Ethics Committee on Animal Use (CEUA) the Federal 90

University of Santa Maria (UFSM), Brazil, under protocol number 100/14. Overall, thirty 91

females and twenty males Wistar rats (Rattus norvegicus albinus) aged between 70 days were 92

used in this study and were housed at the Laboratory Animal Reproduction (BioRep) the 93

Federal University of Santa Maria (UFSM). The animals were maintained at a temperature of 94

220C, 55 – 65% humidity under artificial illumination on a light–dark cycle of 12:12 h, with 95

daylight from 7 a.m. to 7 p.m. Food and water were given ad libitum. 96

Synchronization of estrus and Treatment Protocols 97

39

Thirty female rats were submitted to the protocol for synchronization of estrus. They received 98

an i.p. injection of 10 IU of equine chorionic gonadotropin (eCG; Folligon™, Intervet, 99

Brazil), followed 48 h later by 10 IU of human chorionic gonadotropin (hCG; Pregnyl™, 100

Organon, Brazil), and were placed with a male for 24 hours (Agca, et al. 2013). Female rat 101

pups were divided into four groups for treatment of testosterone propionate androgenization 102

and three control groups. Dams were maintained with their pups until weaning (21 days). 103

Prenatal hormone exposure was accomplished by treatment of pregnant dams from 104

Embryonic Days 16, 17, and 18 injection s.c. of 2.5mg testosterone propionate 105

(Androgenol™, Hertape Calier, Brazil) (PreN group), while vehicle control exposures were 106

accomplished by treatment of pregnant dams from Embryonic Days 16, 17, and 18 injection 107

s.c. 2.5 mg corn oil (Control PreN). Postnatal hormone exposures were performed by the 108

treatment of 5-day-old animals through a subcutaneous injection of 1.25 mg testosterone 109

propionate (PostN group), while vehicle control postnatal 5-day-old animals received a 110

subcutaneous injection of 1.25 mg corn oil (Control PostN). The treatment with leuprolide 111

acetate was realized in 2-day-old animals through an intermuscular injection of 0.40 mg 112

leuprolide acetate depot (Lectrum™, Sandoz, Brazil) in prenatal androgenized (PreN L) and 113

postnatal androgenized (PostN L) (Fig. 1). A dose of leuprolide was based on its use for 114

infants with precocious puberty, i.e., 0.3 mg/kg (usually doses of attack may be higher). A 115

vehicle control was given to 2-day-old animals through an intermuscular injection of 0.40 mg 116

corn oil (Control L). Prenatal androgenization was obtained through a previous protocol, 117

including the administration of 2.5 mg of testosterone propionate on days 16–18 of gestation 118

(Wu et al. 2010), while postnatal androgenization was treated with 1.25 mg of testosterone 119

propionate s.c. 5-day-old female pups (Swanson and Werfftenbosch 1964). Groups at the end 120

of the study were prenatal (PreN n = 8), postnatal (PostN n = 7), control prenatal 121

(ControlPreN n =4), control postnatal (ControlPostN =4), prenatal-leuprolide (PreN L n = 4), 122

postnatal-leuprolide (PostN L n = 8), and control leuprolide (Control L n = 8). For analysis of 123

gene expression of the ovary and hypothalamus, all control groups were included as a one. 124

Estrus cycle 125

Vaginal smears were collected on glass slides to evaluate the animal’s estrus cycles from 90 126

days to 100 days of age. Panótico™ (Laborclin, Brazil) staining was used to analyze the 127

vaginal cytology. Cytology was examined by a "blind" examiner (K.B.) with experience in 128

this procedure. A normal estrus cycle was defined as exhibiting all phases (proestrus, estrus, 129

metestrus, and diestrus) over a period of 4–5 days, as previously characterized in the 130

literature. In proestrus, oval nucleated epithelial cells, occasionally with a small number of 131

keratinocytes, were detected. In estrus, epithelial keratinocytes with irregular shapes were 132

detected; they resembled deciduous leaves or were interconnected into pieces, among which 133

there was a small number of nuclear epithelial cells. In metestrus, irregular epithelial 134

keratinocytes, nucleated epithelial cells, and leukocytes were detected. In diestrus, a large 135

number of leukocytes and a small number of nuclear epithelial cells were detected. 136

Euthanasia 137

At 110 days of age, the animals were transferred and then anesthetized with isoflurane plus 138

administration of tramadol chloride (Tramadol™, Pfizer, Brazil) i.m. (20-40 mg/kg). The 139

minimum alveolar concentration (MAC) of isoflurane used for anesthesia of the rats was 140

estimated at 5%, at a laboratory temperature established artificially between 20 and 25C (or 141

about 31.7 kPa or 238 mm Hg to 39.3 kPa 295 mm Hg). Between 9:00 a.m. and 13:00 p.m., 142

blood samples were collected, and the ovaries were removed before the animals were finally 143

euthanized with cardiac puncture under deep anesthesia in the absence of pedal and corneal 144

reflexes. 145

Hormonal dosage through UHPLC-MS/MS 146

The identification and quantification of androstenedione and testosterone were also performed 147

by a blind examiner using Ultra High-Performance Liquid Chromatography Tandem Mass 148

Spectrometry (UHPLC-MS/MS), as detailed below. The UHPLC-MS/MS was from Waters 149

(USA), equipped with Acquity UPLC™ liquid chromatography; a Xevo TQ™ MS/MS triple 150

quadrupole detector; an autosampler, a binary pump, and a column temperature controller; 151

and a nitrogen generator, model NM30L-MS (Peak Scientific, Scotland), with argon gas 6.0 152

used as collision gas. Data acquisition was realized employing the software MassLynx V4.1. 153

For chromatographic separation, an analytical column Acquity UPLC™ BEH C18 (100×2.1 154

mm, 1.7-μm particle size), maintained at 40°C, was used. For extract preparation, 200µL 155

samples were diluted in acetonitrile until reaching 800µL. This mixture was homogenized by 156

30 seconds vortexing and injected in the UHPLCMS/MS system. After that, an analytical 157

solution (internal pattern) for androstenedione and testosterone was added to the mixture to 158

reach a final concentration of 50ng L-1. This new mixture was once again injected into the 159

system. The linearity and the detection limits of each analytic were verified through analytic 160

solutions with concentrations ranging from 50 to 5000ng L-1 injected in the UHPLC-MS/MS. 161

41

Using the data obtained with dilutions, the calibration curves were obtained. The 162

spectrophotometer was operated in the selected reaction monitoring (SRM) mode, with two 163

transitions for each analytic, one for quantification and the second for confirmation. The 164

higher intensity transition corresponds to analytic quantification and the second higher 165

transition corresponds to confirmation. The ionization mode used was Electrospray Ionization 166

(ESI) in positive mode for androstenedione and testosterone, with column oven temperature at 167

40°C, the pressure of 15000psi, capillary of 2.8kV, desolvation temperature at 500°C, gas 168

flow 800L h-1, collision gas flow (argon) of 0.15mL min-1 and source temperature about 169

150°C. The mobile phase used was composed of aqueous solution (solvent A), 0.05% of 170

ammonium hydroxide and methanol (solvent B). A boiling gradient was used with 0.150mL 171

min-1 flow and an injection volume of 10µL and total running time of 5min (Rigo, et al., 172

2015). 173

Morphological and morphometric analyses of the ovaries 174

The ovaries were fixed in 4% paraformaldehyde for 24h. They were then submitted to the 175

following steps: ethyl alcohol dehydration, diaphanization in xylene, liquid Paraplast™ 176

(Sigma, Brazil), impregnation in a drying stove at 60°C, and Paraplast™ inclusion at room 177

temperature. The Paraplast blocks containing the tissues were sectioned using a microtome 178

(RM2335, Leica Biosystems), adjusted for sections of 5 µm thickness on glass slides. 179

Afterward, each slide was stained with hematoxylin and eosin, as previously published 180

(Comim F et al. 2015). The morphological and morphometric analyses (follicle and corpora 181

lutea counting) were realized independently by two blind examiners (F.V.C and F.C.D.), 182

using as tools for identification (Dixon, et al. 2014; Kang, et al. 2015) an optical microscope 183

(Leica, DMI4000B) coupled with a digital camera system. In the case of discordance, a third 184

research (LEM) was called to define the final result. Overall, the Cohen´s kappa index 185

(agreement between the examiners) was superior to 0.9. 186

RNA extraction and cDNA synthesis 187

Ovarian and hypothalamic total RNA extraction was performed using organic extraction 188

methods Trizol® (Life Technologies, Foster City, CA, United States), following the 189

manufacturer’s instructions. The samples were treated with DNase I™ (Life Technologies, 190

United States). The RNA samples were quantified in a spectrophotometer NanoDrop (ND 191

1000, Thermo Scientific) with a wavelength of 260nm. Total RNA (1μg) was treated with 192

DNase™ (DNAse Amplification Grade I - Invitrogen) at 37oC within 5 minutes to digest any 193

contaminating DNA. The reverse transcription reaction to cDNA was performed using the 194

iScript cDNA Synthesis Kit™ (Bio-Rad) according to the manufacturer's instructions. cDNAs 195

were kept in a –20°C freezer until the gene expression was checked. Its efficiency was 196

verified via a quantitative real-time polymerase chain reaction (qRT-PCR) when the gene 197

expression was evaluated. β-actin (NM_031144.2) and cyclophilin-A (NM_017101.1) 198

specific for Rattus norvegicus were used as possible endogenous controls. The genes of 199

interest were CYP11a1 (NM_007264.2), CYP17a1 (NM_012753.1), CYP19a1 200

(NM_007810.3), and Gnrhr (NM_031038.3) in ovarian tissue and Gnrh (NM_012767.2), 201

Gnrhr (NM_031038.3), and Kiss1 (NM_181692.1) in hypothalamic tissue. Details of primers 202

used in this study are disposed in (Fig. S1). The qRT-PCR reactions were performed in 203

duplicate in a total volume of 20 µL (including 10 ng of cDNA, 10 µL of TaqMan Universal 204

PCR Master Mix, and 1 lµ of the assays) and were carried out on CFX384 real-time PCR 205

systems (Bio-Rap) (Hercules, CA). The cycle conditions were as follows: 50°C for 2 min, 206

95°C for 10 min, 45 cycles of 95°C for 10 s, and 60°C for 1 min. The data were analyzed 207

using Bio-rap CFX Manager Software (version 3.0), and Ct values were transformed to 208

quantities using the comparative Ct method (DDCt, Life Technologies). 209

Statistical analysis 210

The statistical analysis was performed using the software GraphPad Prism 6.03 (GraphPad 211

Software Inc., San Diego, CA). Comparisons among the groups were performed, using 212

ANOVA and, then, followed by post hoc comparisons, using the Bonferroni test. In the 213

absence of a normal distribution, the data were analyzed, using a Kruskal–Wallis test, 214

followed by Dunn’s post hoc test. Proportion among groups was compared, using the Fisher´s 215

test. Significance was assumed at P<0.05. 216

RESULTS 217

Estrus cycle 218

Control, Control L, PreN, and PostN L began to present estrus cycles on the 60th day, which 219

became regular only on the 70th day. In the prenatal group (PreN), exposure to testosterone 220

in the uterus led to a partial closure of the vagina; however, it still allowed the collection of 221

material for cytology analysis. A proportion of the animals' estrus cycles improved (from 12 222

to 25%) after treatment with leuprolide acetate (Fig. 2). As expected, all control groups had 223

43

normal estrus cycles (4–5 days). The postnatally androgenized group (PostN) did not exhibit 224

any estrus cycle and remained at the metestrus and diestrus phases most of the time (Fig. S1- 225

S6). Nevertheless, the treatment of leuprolide acetate in the post-natal group preserved a 226

regular cycle capacity as shown in (Fig. 2). 227

Ovarian morphology 228

The rat ovaries were analyzed for the presence of corpus luteum, healthy antral follicles, and 229

cysts/atretic follicles. As shown in (Fig. 3D), a significant reduction in the number of corpus 230

luteum (per animal) was identified in the Post N group in comparison to the PreN and Control 231

groups. In the group treated with leuprolide (PostN L), the presence of corpus luteum was 232

identified, but it did not reach significance (p=0.056) (Fig. 3B). No differences in the number 233

of corpus luteum were noted between PreN rats in comparison to controls, or PreN L (Fig. 3D 234

and 3H). Cysts were significantly more detected in PostN animals than PreN or controls (Fig 235

3C- Remarkably, the treatment with leuprolide acetate reduced the number of cysts/atretic 236

follicles in the PostN L group (Fig. 3F). A trend to reduce healthy antral follicles (p=0.054) 237

was identified in controls treated with leuprolide acetate (Fig. 3J), although it did not affect 238

the number of corpus luteum or cysts/atretic follicles. 239

Androgen levels (testosterone and androstenedione) 240

Fig. 4. illustrated the hormonal profiles of female of experimental and control groups. The 241

serum testosterone and androstenedione levels in the groups PreN, PostN, and Control were 242

similar. Of note, testosterone levels significantly decreased only in the PostN L group 243

(p=0.04) (Fig. 4B). 244

Gene expression in ovary and hypothalamus 245

Ovary 246

CYP17a1 expression was higher in the PreN group against PostN or Control (p=0.01) (Fig 247

5H). No significant changes in CYP11a1 or CYP19a1 were noted regarding the type of 248

androgenization or treatment or not with leuprolide acetate (Fig. 5A-D and I-L). The 249

expression of Gnrhr was significantly higher in PreN than in the Control or PostN groups 250

(Fig. 5P). In the group treated (PreN L), an even greater increment of Gnrhr was observed 251

(Fig. 5N). 252

253

Hypothalamus 254

In the hypothalamus, Gnrh gene expression was significantly higher in the PreN group than in 255

the PostN or Control groups (p=0.01) (Fig. 6l). The expression of its receptor (Gnrhr) was 256

increased in PostN in comparison to PreN or Control (p=0.01) (Fig. 6H). Conversely, Kiss1 257

was decreased in PreN against Control (Fig. 6D), although an increase in expression of Kiss1 258

was demonstrated in the PreN L group (p=0.038) (Fig. 6B). The treatment with leuprolide 259

modified Gnrh in controls, increasing its gene expression (p=0.03) (Fig. 6I). No changes were 260

observed in PostN at any moment (Fig. 6C, G, and K). 261

DISCUSSION 262

The present study compared two protocols for androgenisation (pre and postnatal) in the 263

female Wistar rats looking for their reproductive impact at adult life. Also, it is evaluated 264

whether treatment with a GnRH agonist (Leuprolide acetate) at neonatal period could affect 265

the expected phenotype in these animal models of PCOS. Our results which replicated 266

previous findings in the literature (Walters et al. 2012), confirmed that androgen excess 267

exposition at a particular timeline might lead to different reproductive phenotypes. PreN 268

animals, submitted to androgen excess during gestation, exhibited ovulatory cycles, 269

comparable ovarian morphology to controls, but some degree of hyperandrogenism, as 270

defined by higher expression of cyp17a1 mRNA (androgen levels were not elevated). These 271

PreN group rats developed marked disruption of hypothalamic kiss1 and GnRH. However, 272

animals that were submitted to post-natal androgenisation (PostN) presented 100% of 273

anovulatory cycles and significant changes in ovarian morphology (decrease of corpus luteum 274

e increase of cysts/atretic follicles) with no evidence of hyperandrogenism. Data from this 275

study may suggest a role of GnRH in the development of ovarian and hypothalamic 276

abnormalities in PCOS, given the fact that blocking GnRH receptors through leuprolide 277

acetate during four weeks modified the development of anovulation and cysts and reduced 278

previous testosterone levels in PostN L group. In the elegant work of Tyndall et al. (2012), 279

different schemes of treatments with testosterone propionate (TP) were performed in Wistar 280

rat. Interestingly, the group late postnatal (TP from d15 to 24 of life), group fetal plus 281

postnatal TP (from fetal e15 to e21 and then d1 to 24 of life) and fetal (TP from d14.5 to 21.5) 282

were not capable to produce similar changes to those observed with full postnatal group (TP 283

from d1 to 24). These rats, like our PostN group, developed anovulation and lack of corpus 284

luteum and no evidence hyperandrogenism. Why earlier and full postnatal treatments with TP, 285

45

but not late postnatal treatments with TP could induce changes in the morphology of the ovary 286

and ovulatory rates, suggest the possibility of conditional timeline for reproductive changes. It 287

has been described in rats, during the 30 initial days of life, a physiological condition of 288

higher activation of GnRH axis, that would correspond to the mini puberty in humans. 289

Currently, the meaning of mini puberty in the development of PCOS is uncertain. The mini 290

puberty in boys is usually shorter (0-6 months) and shows LH levels higher than those of 291

girls, who have longer periods of activation of GnRH (up to two years) due to fluctuations of 292

estradiol and predominant FSH over LH (Anderson, et al. 1998; Kuiri-Hanninen et al. 2014; 293

Kuiri-Hanninen, et al. 2011). A study in sheep performed by Recabarreni et al. described that, 294

between 5-10 weeks, the pituitary secretion of LH in response to a short test with leuprolide 295

was higher (and not progressive) in prenatally androgenized ewes in comparison to controls. 296

At 20 and 30 weeks of age, the controls exhibited a significantly higher response to leuprolide 297

(Recabarren, et al. 2005). In female Sprague-Dawley rats, the responsivity of GnRH agonists 298

started to rise on day five of life, reached a peak on day 20, and decreased after the 30th day 299

(Wilkinson and Moger 1981). Another relevant point is that folliculogenesis in rodents, 300

differently from other mammals such ewes and human, is not complete before birth and 301

continues for few days after birth. Therefore, is more plausible that treating rats just after birth 302

may disrupt ovary development in progress. In our study, indirect evidence for 303

hyperandrogenism, a key manifestation of PCOS was manifest only in the PreN group. These 304

prenatally androgenized animals shown an affected gonadal axis identified by changes of 305

hypothalamic (GnRH, Kiss1, and Gnrhr) and ovarian genes (CYP17a1 and Gnrhr). Literature 306

has pointed out that prenatal T excess may reprogram hypothalamic secretion of GnRH and 307

its neuronal networking (Padmanabhan and Veiga-Lopez 2011). Prenatal androgen excess in 308

mice usually follows higher levels of LH associated with high GABAergic transmission 309

(Roland, et al. 2010; Sullivan and Moenter 2005); in ewes, prenatal androgenization leads to 310

an LH hypersecretion and modification of negative steroid feedback culminating with 311

anovulation at the second breed season (Cheng, et al. 2010; Robinson, et al. 1999; Unsworth, 312

et al. 2005; Veiga-Lopez, et al. 2009). Studies on sheep show that in KNDy neurons, the 313

expression of neurokinin B and the inhibitory dynorphin decrease in the ARC neurons while 314

Kiss remain in the same proportion of cells, leading to a higher secretion of Gnrh. In rats, 315

where a sexual dimorphism is present in KNDy neurons, the GnRH pulse frequency 316

determines LH but not FSH (McNeilly et al. 2003). Prenatal treatment (most of the time with 317

DHT or T at higher levels) leads to increased levels of LH associated with disrupted ovulation 318

(Walters et al. 2012). Nevertheless, why PreN rats exhibited great modifications in 319

hypothalamus without great disruption of estrus cycles should be clarified by further studies. 320

Our results show that treatment with leuprolide acetate had also led to changes in the control 321

group but that modifications were similar to those reported in mice. Similar to what is 322

described in this study, Singh and Krishna (2010) have shown that the use of a moderate dose 323

of GnRH agonist in healthy mice could lead to a reduction in late (healthy) antral follicles. 324

Another secondary hypothesis addressed in this study relies on the description of the disrupted 325

gene expression of Gnrhr in the ovary of prenatally androgenized rats. In the rat and mouse 326

ovary, Gnrhr mRNA are present in the granulosa, cumulus cells, and oocytes and suffer 327

effects from local GnRH production, exhibiting fluctuation during the estrus cycle (higher in 328

diestrus and proestrus phases) (Schirman-Hildesheim, et al. 2005; Torrealday, et al. 2013). 329

Whether treatment with leuprolide interfered with GnRHR and its actions on steroidogenesis 330

and folliculogenesis remains to be elucidated. We identify some limitations in our study. 331

Firstly, the phase of the estrus cycle was not addressed before euthanasia. It is known that the 332

expression of GnRH and its receptors (GnRHR) in the reproductive tissues of rats may vary 333

through the stages of the estrus cycle. GnRH usually peaks in the hypothalamus in proestrus, 334

while GnRHR is progressively higher during diestrus and suffers two consecutive peaks in 335

proestrus, reducing its expression in estrus. However, the histologic analysis demonstrated a 336

very similar and superposed ovulatory profile between controls and PreN rats, in respect of 337

the significant differences in the hypothalamic and ovary genes evaluated. Secondly, the 338

possible changes in the steroid receptor balance were not explored. It was not clear whether or 339

not the actions of androgens in the negative feedbacks of estradiol and progesterone were 340

affected by the treatment that used the GnRH agonist. Treating female mice with the 341

leuprolide acetate also modified the neurosteroid production of progesterone (Micevych et al., 342

2003). Thirdly, it was not possible to understand whether the effects of the leuprolide acetate 343

occurred directly at the hypothalamus or ovary or indirectly through the reduction of estradiol 344

levels. Similar doubts had been described in other studies that employed metformin in mice 345

(Roland et al., 2010) or rats (Liu et al., 2015). In spontaneously ovulating rodents, the 346

preovulatory LH surge is initiated on the day of proestrus; present studies explore whether or 347

not kisspeptin is part of the essential neural circuit that links to the GnRH system to stimulate 348

ovulation. In the gonadotropin-releasing hormone (GnRH), neurons stimulate the release of 349

peptide and activate the reproductive axis in mammals. Kisspeptin has pronounced pre- and 350

post-synaptic effects, with the latter dominating the excitability of the GnRH neurons (Clarke 351

et al., 2015; Ronnekleiv & Kelly, 2013), further suggesting that the direct activation of the 352

47

neurons is responsible for the release of the luteinizing hormone (LH) and the follicle-353

stimulating hormone (FSH) (IWASA et al., 2016). 354

To summarize, the present study adds, for the first time, new evidence of the actions of a 355

GnRH agonist depot in the androgenized model of rat pups (model of PCOS). Treatment with 356

a GnRH agonist up to 48h after birth demonstrates improvement of the estrus cycles, 357

reduction in cystic/atretic follicles, and decreased serum testosterone in the postnatally 358

androgenized rat. The impact in the prenatally androgenized rat was present but slight, 359

regarding ovulation. Therefore, we speculated that this period of life described as minipuberty 360

in humans and corresponding to the first month of life in rats could also be a suitable time for 361

target reproductive disruption. Further studies are necessary to elucidate the mechanisms 362

operating these changes, in particular regarding the negative feedback to steroids at the 363

hypothalamus under treatment with GnRH agonists. 364

365

REFERENCES 366

Abbott DH, Barnett DK, Bruns CM & Dumesic DA 2005 Androgen excess fetal programming of female 367 reproduction: a developmental aetiology for polycystic ovary syndrome? Hum Reprod Update 11 368 357-374. 369 370 Adewale HB, Jefferson WN, Newbold RR & Patisaul HB 2009 Neonatal bisphenol-a exposure alters rat 371 reproductive development and ovarian morphology without impairing activation of gonadotropin-372 releasing hormone neurons. Biol Reprod 81 690-699. 373 374 Agca C, Yakan A & Agca Y 2013 Estrus synchronization and ovarian hyper-stimulation treatments 375 have negligible effects on cumulus oocyte complex gene expression whereas induction of ovulation 376 causes major expression changes. Mol Reprod Dev 80 102-117. 377 378 Anderson E, Lee MT & Lee GY 1992 Cystogenesis of the ovarian antral follicle of the rat: 379 ultrastructural changes and hormonal profile following the administration of 380 dehydroepiandrosterone. Anat Rec 234 359-382. 381 382 Andersson AM, Toppari J, Haavisto AM, Petersen JH, Simell T, Simell O & Skakkebaek NE 1998 383 Longitudinal reproductive hormone profiles in infants: peak of inhibin B levels in infant boys exceeds 384 levels in adult men. J Clin Endocrinol Metab 83 675-681. 385 386 Baptiste CG, Battista MC, Trottier A & Baillargeon JP 2010 Insulin and hyperandrogenism in women 387 with polycystic ovary syndrome. J Steroid Biochem Mol Biol 122 42-52. 388 389 Barker DJ 1990 The fetal and infant origins of adult disease. BMJ 301 1111. Barraclough CA 1961 390 Production of anovulatory, sterile rats by single injections of testosterone propionate. Endocrinology 391 68 62-67. 392

Birch RA, Padmanabhan V, Foster DL, Unsworth WP & Robinson JE 2003 Prenatal programming of 393 reproductive neuroendocrine function: fetal androgen exposure produces progressive disruption of 394 reproductive cycles in sheep. Endocrinology 144 1426-1434. 395 396 Clarke H, Dhillo WS & Jayasena CN 2015 Comprehensive Review on Kisspeptin and Its Role in 397 Reproductive Disorders. Endocrinol Metab (Seoul) 30 124-141. 398 399 Comim FV, Hardy K, Robinson J & Franks S 2015 Disorders of follicle development and 400 steroidogenesis in ovaries of androgenised foetal sheep. J Endocrinol 225 39-46. 401 402 Cheng G, Coolen LM, Padmanabhan V, Goodman RL & Lehman MN 2010 The kisspeptin/neurokinin 403 B/dynorphin (KNDy) cell population of the arcuate nucleus: sex differences and effects of prenatal 404 testosterone in sheep. Endocrinology 151 301-311. 405 406 Chinnathambi V, Balakrishnan M, Yallampalli C & Sathishkumar K 2012 Prenatal testosterone 407 exposure leads to hypertension that is gonadal hormone-dependent in adult rat male and female 408 offspring. Biol Reprod 86 137, 131-137. 409 410 Daneshian Z, Ramezani Tehrani F, Zarkesh M, Norooz Zadeh M, Mahdian R & Zadeh Vakili A 2015 411 Antimullerian hormone and its receptor gene expression in prenatally androgenized female rats. Int J 412 Endocrinol Metab 13 e19511. 413 414 Davies MJ, Marino JL, Willson KJ, March WA & Moore VM 2011 Intergenerational associations of 415 chronic disease and polycystic ovary syndrome. PLoS One 6 e25947. 416 417 Dixon D, Alison R, Bach U, Colman K, Foley GL, Harleman JH, Haworth R, Herbert R, Heuser A, Long G, 418 et al. 2014 Nonproliferative and proliferative lesions of the rat and mouse female reproductive 419 system. J Toxicol Pathol 27 1S-107S. 420 421 Fels E & Bosch LR 1971 Effect of prenatal administration of testosterone on ovarian function in rats. 422 Am J Obstet Gynecol 111 964-969. 423 424 Foecking EM, McDevitt MA, Acosta-Martinez M, Horton TH & Levine JE 2008 Neuroendocrine 425 consequences of androgen excess in female rodents. Horm Behav 53 673-692. 426 Franks S 1995 Polycystic ovary syndrome. N Engl J Med 333 853-861. 427 428 Franks S 2006 Candidate genes in women with polycystic ovary syndrome. Fertil Steril 86 Suppl 1 S15. 429 Franks S 2012 Animal models and the developmental origins of polycystic ovary syndrome: increasing 430 evidence for the role of androgens in programming reproductive and metabolic dysfunction. 431 Endocrinology 153 2536-2538. 432 433 Glintborg D 2016 Endocrine and metabolic characteristics in polycystic ovary syndrome. Dan Med J 434 63. 435 Huffman L & Hendricks SE 1981 Prenatally injected testosterone propionate and sexual behavior of 436 female rats. Physiol Behav 26 773-778. 437 438 Iwasa T, Matsuzaki T, Tungalagsuvd A, Munkhzaya M, Yiliyasi M, Kato T, Kuwahara A & Irahara M 439 2016 Effects of chronic testosterone administration on body weight and food intake differ among 440 pre-pubertal, gonadal-intact, and ovariectomized female rats. Behav Brain Res 309 35-43. 441

Kafali H, Iriadam M, Ozardali I & Demir N 2004 Letrozole-induced polycystic ovaries in the rat: a new 442 model for cystic ovarian disease. Arch Med Res 35 103-108. 443

49

Kang X, Jia L & Shen X 2015 Manifestation of Hyperandrogenism in the Continuous Light Exposure-444 Induced PCOS Rat Model. Biomed Res Int 2015 943694. 445

Kuiri-Hanninen T, Sankilampi U & Dunkel L 2014 Activation of the hypothalamic-pituitary-gonadal 446 axis in infancy: minipuberty. Horm Res Paediatr 82 73-80. 447 448 Kuiri-Hanninen T, Seuri R, Tyrvainen E, Turpeinen U, Hamalainen E, Stenman UH, Dunkel L & 449 Sankilampi U 2011 Increased activity of the hypothalamic-pituitary-testicular axis in infancy results in 450 increased androgen action in premature boys. J Clin Endocrinol Metab 96 98-105. 451 452 Lee MT, Adams WC & Bruot BC 1991 Circulating hormone concentrations in hypothyroid rats with 453 induced polycystic ovaries. Proc Soc Exp Biol Med 198 737-741. 454 455 Liu W, Liu W, Fu Y, Wang Y & Zhang Y 2015 Bak Foong pills combined with metformin in the 456 treatment of a polycystic ovarian syndrome rat model. Oncol Lett 10 1819-1825. 457 458 Manneras L, Cajander S, Holmang A, Seleskovic Z, Lystig T, Lonn M & Stener-Victorin E 2007 A new 459 rat model exhibiting both ovarian and metabolic characteristics of polycystic ovary syndrome. 460 Endocrinology 148 3781-3791. 461 462 Marcondes RR, Carvalho KC, Duarte DC, Garcia N, Amaral VC, Simoes MJ, Lo Turco EG, Soares JM, Jr., 463 Baracat EC & Maciel GA 2015 Differences in neonatal exposure to estradiol or testosterone on 464 ovarian function and hormonal levels. Gen Comp Endocrinol 212 28-33. 465 466 McNeilly AS, Crawford JL, Taragnat C, Nicol L & McNeilly JR 2003 The differential secretion of FSH and 467 LH: regulation through genes, feedback and packaging. Reprod Suppl 61 463-476. 468 469 Micevych PE, Rissman EF, Gustafsson JA & Sinchak K 2003 Estrogen receptor-alpha is required for 470 estrogen-induced mu-opioid receptor internalization. J Neurosci Res 71 802-810. 471 472 Ortega HH, Salvetti NR & Padmanabhan V 2009 Developmental programming: prenatal androgen 473 excess disrupts ovarian steroid receptor balance. Reproduction 137 865-877. 474 475 Padmanabhan V, Salvetti NR, Matiller V & Ortega HH 2014 Developmental programming: prenatal 476 steroid excess disrupts key members of intraovarian steroidogenic pathway in sheep. Endocrinology 477 155 3649-3660. 478 479 Padmanabhan V & Veiga-Lopez A 2011 Developmental origin of reproductive and metabolic 480 dysfunctions: androgenic versus estrogenic reprogramming. Semin Reprod Med 29 173-186. 481 Padmanabhan V & Veiga-Lopez A 2013 Animal models of the polycystic ovary syndrome phenotype. 482 Steroids 78 734-740. 483 484 Pinilla L, Trimino E, Garnelo P, Bellido C, Aguilar R, Gaytan F & Aguilar E 1993 Changes in pituitary 485 secretion during the early postnatal period and anovulatory syndrome induced by neonatal 486 oestrogen or androgen in rats. J Reprod Fertil 97 13-20. 487 Plant TM & Ramaswamy S 2009 Kisspeptin and the regulation of the hypothalamic-pituitary-gonadal 488 axis in the rhesus monkey (Macaca mulatta). Peptides 30 67-75. 489 490 Recabarreni SE, Sir-Petermann T, Lobos A, Codner E, Rojas-Garcia PP & Reyes V 2005 Response to the 491 gonadotropin releasing hormone agonist leuprolide in immature female sheep androgenized in 492 utero. Biol Res 38 235-244. 493

Rigo ML, Dau AMP, Glanzner WG, Martins M, Zanella R, Rizzetti TM, Comim FV & Gonçalves PBD 494 2015 Steroidogenic enzymes mRNA expression profile and steroids production in bovine theca cells 495 cultured in vitro and stimulated with angiotensin II. Ciência Rural 45 704-710. 496 497 Robinson JE, Forsdike RA & Taylor JA 1999 In utero exposure of female lambs to testosterone 498 reduces the sensitivity of the gonadotropin-releasing hormone neuronal network to inhibition by 499 progesterone. Endocrinology 140 5797-5805. 500 501 Roland AV, Nunemaker CS, Keller SR & Moenter SM 2010 Prenatal androgen exposure programs 502 metabolic dysfunction in female mice. J Endocrinol 207 213-223. 503 504 Ronnekleiv OK & Kelly MJ 2013 Kisspeptin excitation of GnRH neurons. Adv Exp Med Biol 784 113-505 131. 506 507 Schirman-Hildesheim TD, Bar T, Ben-Aroya N & Koch Y 2005 Differential gonadotropin-releasing 508 hormone (GnRH) and GnRH receptor messenger ribonucleic acid expression patterns in different 509 tissues of the female rat across the estrous cycle. Endocrinology 146 3401-3408. 510 511 Singh P & Krishna A 2010 Effects of GnRH agonist treatment on steroidogenesis and folliculogenesis 512 in the ovary of cyclic mice. J Ovarian Res 3 26. 513 514 Skorupskaite K, George JT & Anderson RA 2014 The kisspeptin-GnRH pathway in human reproductive 515 health and disease. Hum Reprod Update 20 485-500. 516 517 Slob AK, den Hamer R, Woutersen PJ & van der Werff ten Bosch JJ 1983 Prenatal testosterone 518 propionate and postnatal ovarian activity in the rat. Acta Endocrinol (Copenh) 103 420-427. 519 520 Sullivan SD & Moenter SM 2005 GABAergic integration of progesterone and androgen feedback to 521 gonadotropin-releasing hormone neurons. Biol Reprod 72 33-41. 522 523 Swanson HE & Werfftenbosch JJ 1964 The "Early-Androgen" Syndrome; Differences in Response to 524 Pre-Natal and Post-Natal Administration of Various Doses of Testosterone Propionate in Female and 525 Male Rats. Acta Endocrinol (Copenh) 47 37-50. 526 527 Tehrani FR, Noroozzadeh M, Zahediasl S, Piryaei A & Azizi F 2014 Introducing a rat model of prenatal 528 androgen-induced polycystic ovary syndrome in adulthood. Exp Physiol 99 792-801. 529 530 Torrealday S, Lalioti MD, Guzeloglu-Kayisli O & Seli E 2013 Characterization of the gonadotropin 531 releasing hormone receptor (GnRHR) expression and activity in the female mouse ovary. 532 Endocrinology 154 3877-3887. 533 534 Tyndall V, Broyde M, Sharpe R, Welsh M, Drake AJ & McNeilly AS 2012 Effect of androgen treatment 535 during foetal and/or neonatal life on ovarian function in prepubertal and adult rats. Reproduction 536 143 21-33. 537 538 Unsworth WP, Taylor JA & Robinson JE 2005 Prenatal programming of reproductive neuroendocrine 539 function: the effect of prenatal androgens on the development of estrogen positive feedback and 540 ovarian cycles in the ewe. Biol Reprod 72 619-627. 541 542 Veiga-Lopez A, Astapova OI, Aizenberg EF, Lee JS & Padmanabhan V 2009 Developmental 543 programming: contribution of prenatal androgen and estrogen to estradiol feedback systems and 544 periovulatory hormonal dynamics in sheep. Biol Reprod 80 718-725. 545

51

546 Walters KA, Allan CM & Handelsman DJ 2008 Androgen actions and the ovary. Biol Reprod 78 380-547 389. 548 549 Walters KA, Allan CM & Handelsman DJ 2012 Rodent models for human polycystic ovary syndrome. 550 Biol Reprod 86 149, 141-112. 551 552 Weisz J & Lloyd CW 1965 Estrogen and androgen production in vitro from 7-3-H-progesterone by 553 normal and polycystic rat ovaries. Endocrinology 77 735-744. 554 555 West C, Foster DL, Evans NP, Robinson J & Padmanabhan V 2001 Intra-follicular activin availability is 556 altered in prenatally-androgenized lambs. Mol Cell Endocrinol 185 51-59. 557 558 Wilkinson M & Moger WH 1981 Development of a quotidian increase in pituitary responsiveness to 559 GnRH in prepubertal female rats. J Reprod Fertil 62 393-398. 560 561 Wu XY, Li ZL, Wu CY, Liu YM, Lin H, Wang SH & Xiao WF 2010 Endocrine traits of polycystic ovary 562 syndrome in prenatally androgenized female Sprague-Dawley rats. Endocr J 57 201-209. 563 564 Zurvarra FM, Salvetti NR, Mason JI, Velazquez MM, Alfaro NS & Ortega HH 2009 Disruption in the 565 expression and immunolocalisation of steroid receptors and steroidogenic enzymes in letrozole-566 induced polycystic ovaries in rat. Reprod Fertil Dev 21 827-839. 567

568

Figure 1. Timeline of treatments 569

570

Figure 2. Proportion of estrus cycles in female rats 571

The proportion of each one of the stages of the cycle, as defined by vaginal cytology is presented for 572

each group. Lupron treatment markedly improved estrus in PostN rats. In PreN rats, the 573

administration of leuprolide led to an increase in the estrus cycles (* = p <0.05 treated versus non-574

treated subgroups). Supplemental figure S1- S6 includes individual information on each animal. 575

576

Figure 3. Follicle development 577

Key ovarian structures (corpus luteum, cystic/atretic follicles, and healthy antral follicles) were 578

compared among the three main groups (Control, PostN, and PreN) (Fig D, H and L) and between 579

each subgroup regarding leuprolide acetate treatment (A-C; E-G; I-K). A significant reduction in the 580

number of corpus luteum in the PostN group (Fig 3D; p=0.001) and an increase in cysts/atretic 581

follicles (Fig 3H; p=0.0004) were observed in the PostN group in relation to other groups (Control and 582

PreN). The treatment with leuprolide significantly reduced the number of atretic/cystic follicles 583

(PostN L) (Fig 3G; p=0.04); there was a trend to increase corpus luteum in the same group (Fig 3C). 584

Control animals that were treated (Control L) experienced a trend to reduce healthy antral follicles 585

(Fig 3J). 586

587

588

Figure 4. Testosterone and androstenedione serum levels 589

Levels of testosterone (Fig 4D) and androstenedione (Fig 4H) in serum measured by liquid 590

chromatography (MS/MS) were compared among the three main groups (Control, PostN, and PreN) 591

and between each subgroup regarding leuprolide acetate treatment (A-C; E-G). The PostN L group 592

exhibited a significant reduction in testosterone after treatment with leuprolide acetate (Fig 4B; 593

p=0.04). 594

595

Figure 5. Expression of steroidogenic enzymes and Gnrhr in the ovary 596

A comparison of mRNA expression of CYP11a1, CYP17a1, CYP19a1, and Gnrhr was performed among 597

the three main groups (Control, PostN, and PreN) (Fig 5D, H, L, and P) and between each subgroup 598

regarding leuprolide acetate treatment (A-C; E-G; I-K; M-O). A significantly higher expression of 599

CYP17a1 (Fig 5H; p=0.016) and Gnrhr (Fig 5P; p=0.003) was observed in the PreN group. PreN L 600

animals exhibited a marked increase in Gnrhr expression versus PreN (Fig 5N; p=0.04). 601

602

Figure 6. Expression of Kiss, Gnrh, and Gnrhr in the hypothalamus 603 A comparison of mRNA expression of Kiss, Gnrh, and Gnrhr was performed among the three main 604 groups (Control, PostN, and PreN) (Fig 5D, H, and L) and between each subgroup regarding leuprolide 605 acetate treatment (A-C; E-G; I-K). PostN animals exhibited a higher expression of Gnrhr than Control 606 or PreN rats (Fig 6H; p= 0.001). PreN group demonstrated a significantly higher expression of Gnrh 607 (Fig 6L; p=0.01) and lower Kiss (Fig 6D; p=0.01). Treatment with leuprolide increased Kiss in this 608 group, as well as Gnrh in 609 610

611

612

613

614

615

616

617

618

619

620

621

622

623

624

53

Figure 1. Timeline of treatments. 625

626

627

628

Figure 2. Proportion of estrus cycles in female rats. 629

630

631

632

633

634

635

636

55

Figure 3. Follicle development. 637

638

639

640

641

Figure 4. Testosterone and androstenedione serum levels 642

643

644

645

646

647

648

57

Figure 5. Expression of steroidogenic enzymes and GNRHR in the ovary. 649

650

651

652

653

654

655

656

657

658

659

660

661

662

663

664

665

666

667

668

Figure 6. Expression of Kiss, Gnrh, and Gnrhr in the hypothalamus.

59

Supplementary 1.Estrus cycles in female rats PreN. 669

670

671

Supplementary 2. Estrus cycles in female rats PreN L. 672

673

674

61

675

Supplementary 3. Estrus cycles in female rats PosN. 676

677

678

679

Supplementary 4. Estrus cycles in female rats PosN L. 680

681

63

682

683

Supplementary 5. Estrus cycles in female rats Control L 684

685

Supplementary 6. Estrus cycles in female rats PreN Control. 686

687

688

689

65

690

691

Supplementary 7.Estrus cycles in female rats PostN Control. 692

693

694

Supplementary 8. List of primers. 695

Gene Forward primer (5’-3’) Reverse primer (5’-3’)

Gnrhr TCTAAACCCGTGCTTCGACC TGGACAAGGCTGCTAACCTG

Gnrh CCACAACATCCGAGTGTGAC TGCGGAAGCCCACACAATTA

Kiss1 GCAAAAATGGCACCTGTGGT AGGCATTAACGAGTTCCTGGG

Cyp19a1 AGAGACGTGGAGACCTGACA CCTCCGGATACTCTGCGATG

Cyp11a1 GTCTACCAGATGTTCCACACCA CCAGGAGGCTATAAAGGACACC

Cyp17a1 GGTGATCCCAAGGTAGTCTTTC GTACTGTGGGTGTTGAGGTATG

Actb ACAACCTTCTTGCAGCTCCTC CTGACCCATACCCACCATCAC

Ciclofilina A GAAAGAAGGCATGAGCATTGTG GCCCGCAAGTCAAAGAAATTAG

696

697

698

699

700

701

702

703

704

705

706

707

708

709

710

711

712

67

3. DISCUSSÃO

O presente estudo comparou dois modelos animais de SOP com uso de testosterona

propianato (pré- e pós-natal) com o objetivo de avaliar as diferenças entre ambos e o impacto

do tratamento com um agonista do GnRH durante o período neonatal nas características

destas fêmeas androgenizadas em idade adulta (acima de 90 dias). Os resultados obtidos

indicaram que estes tratamentos produziram diferentes fenótipos. No modelo pré-natal

(PreN) foi observado a presença de ciclos ovulatórios, morfologia ovariana semelhante aos

controles e alguma evidência de hiperandrogenismo (definida pela maior expressão ovariana

de RNAm para Cyp17a1, embora os androgênios séricos não tenham sido elevados). Estas

ratas do grupo PreN, possuíram, em contrapartida, mais alterações nos genes hipotalâmicos

Kiss1 e Gnrh que controles. Em contraste a este modelo, os animais que sofreram

androgenização pós-natal (PostN) apresentaram ciclos anovulatórios (100%), alterações

marcadas na morfologia ovariana (redução de corpo lúteo e aumento de cistos/folículos

atréticos) sem achados de hiperandrogenismo.

De acordo com as evidências obtidas, pode-se sugerir uma participação do eixo do

GnRH no desenvolvimento destas alterações reprodutivas, uma vez que o bloqueio dos

receptores do GnRH pelo uso de acetato de leuprolide por um período aproximado de 4

semanas evitou ou reduziu o desenvolvimento de características de SOP em animais

androgenizados após a gestação (PostN L). No recente estudo de (VEIGA-LOPEZ et al.,

2016) o tratamento pós-natal com flutamida, iniciando as 8 semanas de vida em ovelhas

androgenizadas na gestação foi capaz de melhorar as taxas de androgênio folicular durante a

realização de protocolo de estimulação ovariana. Similarmente, em modelo pós-natal com

roedores, o uso de metformina mostrou benefício na redução de folículos atréticos

(MAHAMED et al., 2011).

No elegante trabalho de (TYNDALL et al., 2012), os tratamentos com testosterona

propianato em diferentes esquemas - fetal (dia e14- e21 de gestação) ou fetal e pós-natal

tardio (incluindo o dia 15º ao 24ºdias de vida), ou ainda fetal e pós-natal pleno (incluindo o

dia 1º ao 24ºdias de vida) não foram capazes de levar às alterações fenotípicas características

de SOP identificadas somente no modelo pós-natal pleno (dia 1º ao 24ºdias de vida). Isto

sugere a possibilidade de existência de alguma condição ou janela na linha do tempo para o

desenvolvimento de características distintas da SOP. Embora a foliculogênese esteja

completamente concluída em mulheres, nos demais primatas e em ovelhas antes do final da

gestação, o mesmo não ocorre com roedores, onde este processo de formação folicular só

encerra nos primeiros dias de vida. Curiosamente, nos primeiros 30 dias de vida em ratas

ocorre um período fisiológico de grande ativação do eixo GnRH (que corresponderia à mini-

puberdade de humanos). O significado da minipuberdade no desenvolvimento de SOP ainda

é incerto.

Evidência na literatura tem sugerido que o excesso de T pré-natal pode reprogramar a

secreção hipotalâmica de GnRH e sua rede(PADMANABHAN & VEIGA-LOPEZ, 2011).

Níveis excessivos de androgênios no período pré-natal em ratas e camundongas geralmente

produz níveis mais elevados de LH associados a um aumento da transmissão GABAérgica

(SULLIVAN & MOENTER, 2005; ROLAND et al., 2010). Além disto, sabe-se que existe

em roedores, um dimorfismo sexual para neurônios do GnRH(MCNEILLY et al., 2003); o

tratamento pré-natal (a maioria das vezes com DHT ou T em níveis mais elevados) leva ao

aumento dos níveis “masculinos” de LH (mas não de FSH) o que pode afetar a ovulação e

produção de androgênios (MCNEILLY et al., 2003; SULLIVAN & MOENTER, 2005;

ROLAND et al., 2010) ). Ademais, níveis de RNAm de kisspeptina foram elevados no

hipotálamo de camundongas tratadas com letrazole (inibidor da aromatase) que está

associado a diversas alterações de ciclicidade e alteração dos níveis de GnRH (KAUFFMAN

et al., 2015)

Em ovelhas, a androgenização pré-natal pode levar a alterações dos neurônios

hipotalâmicos KNDy responsáveis pela modulação da pulsatilidade da secreção de GnRH,

quer seja pela diminuição da neurocinina B, dimorfina ou pela manutenção da expressão de

kisspeptina(CHENG et al., 2010). Apenas o emprego de DHEA e inibidores de aromatase

(como letrozole) após o nascimento rompeu os ciclos ovulatórios e aumento dos níveis de

LH (ZURVARRA et al., 2009).

69

4. CONCLUSÃO

Os resultados do estudo indicam que a androgenização com em ratas Wistar leva a

diferentes mudanças reprodutivas de acordo com o período de emprego do propianato de

testosterona. Comparativamente, o modelo pós-natal (PosN) reproduziu características

importantes da SOP como anovulação e aumento de cistos/folículos atréticos (mas não

hiperandrogenemia) após os 90 dias de vida. Com efeito, o tratamento neonatal com acetato

de leuprolide mostrou-se capaz de impedir o desenvolvimento deste fenótipo (grupo PosN L),

reduzindo os níveis de androgênios, número de cistos/folículos atrésicos. Em nosso estudo

(gerador de hipóteses), a minipuberdade (que termina com a supressão do eixo gonadal)

poderia ser considerada uma janela para estudo e possivelmente intervenções terapêuticas

para a síndrome dos ovários policísticos.

REFERÉNCIA

ABBOTT, D. H., et al. Androgen excess fetal programming of female reproduction: a developmental aetiology for polycystic ovary syndrome? Hum Reprod Update, v.11, n.4, p.357-74. 2005. Disponível em: <http://www.ncbi.nlm.nih.gov/pubmed/15941725>. Acesso em: 15 abr. 2011. doi: 10.1093/humupd/dmi013.

ABBOTT, D. H., et al. Nonhuman primate models of polycystic ovary syndrome. Mol Cell Endocrinol, v.373, n.1-2, p.21-8. 2013. Disponível em: <http://www.ncbi.nlm.nih.gov/pubmed/23370180>. Acesso em: 15 abr. 2011. doi: 10.1016/j.mce.2013.01.013.

ABBOTT, D. H., et al. Contributions of androgen and estrogen to fetal programming of ovarian dysfunction. Reprod Biol Endocrinol, v.4, p.17. 2006. Disponível em: <http://www.ncbi.nlm.nih.gov/pubmed/16606451>. Acesso em: 15 abr. 2011. doi: 10.1186/1477-7827-4-17.

ABBOTT, D. H., et al. Fetal programming of adrenal androgen excess: lessons from a nonhuman primate model of polycystic ovary syndrome. Endocr Dev, v.13, p.145-58. 2008. Disponível em: <http://www.ncbi.nlm.nih.gov/pubmed/18493139>. Acesso em: 15 abr. 2011. doi: 10.1159/000134831.

ABI SALLOUM, B., et al. Developmental programming: impact of prenatal exposure to bisphenol-A and methoxychlor on steroid feedbacks in sheep. Toxicol Appl Pharmacol, v.268, n.3, p.300-8. 2013. Disponível em: <http://www.ncbi.nlm.nih.gov/pubmed/23454450>. Acesso em: 15 abr. 2011. doi: 10.1016/j.taap.2013.02.011.

ALEXANDERSON, C., et al. Postnatal testosterone exposure results in insulin resistance, enlarged mesenteric adipocytes, and an atherogenic lipid profile in adult female rats: comparisons with estradiol and dihydrotestosterone. Endocrinology, v.148, n.11, p.5369-76. 2007. Disponível em: <http://www.ncbi.nlm.nih.gov/pubmed/17656458>. Acesso em: 15 abr. 2011. doi: 10.1210/en.2007-0305.

AYOOLA, A. B., et al. Women's Knowledge of Ovulation, the Menstrual Cycle, and Its Associated Reproductive Changes. Birth. 2016. Disponível em: <http://www.ncbi.nlm.nih.gov/pubmed/27157718>. Acesso em: 15 abr. 2011. doi: 10.1111/birt.12237.

AZZIZ, R., et al. The Androgen Excess and PCOS Society criteria for the polycystic ovary syndrome: the complete task force report. Fertil Steril, v.91, n.2, p.456-88. 2009. Disponível em: <http://www.ncbi.nlm.nih.gov/pubmed/18950759>. Acesso em: 15 abr. 2011. doi: 10.1016/j.fertnstert.2008.06.035.

71

AZZIZ, R., et al. The prevalence and features of the polycystic ovary syndrome in an unselected population. J Clin Endocrinol Metab, v.89, n.6, p.2745-9. 2004. Disponível em: <http://www.ncbi.nlm.nih.gov/pubmed/15181052>. Acesso em: 15 abr. 2011. doi: 10.1210/jc.2003-032046.

BARRACLOUGH, C. A. Production of anovulatory, sterile rats by single injections of testosterone propionate. Endocrinology, v.68, p.62-7. 1961. Disponível em: <http://www.ncbi.nlm.nih.gov/pubmed/13687241>. Acesso em: 15 abr. 2011. doi: 10.1210/endo-68-1-62.

BERNARD, C. An introduction to the study of experimental medicine. 1965

BILLIAR, R. B., et al. The effect of chronic and acyclic elevation of circulating androstenedione or estrone concentrations on ovarian function in the rhesus monkey. Endocrinology, v.116, n.6, p.2209-20. 1985. Disponível em: <http://www.ncbi.nlm.nih.gov/pubmed/3922743>. Acesso em: 15 abr. 2011. doi: 10.1210/endo-116-6-2209.

BRIDGES, N. A., et al. Standards for ovarian volume in childhood and puberty. Fertil Steril, v.60, n.3, p.456-60. 1993. Disponível em: <http://www.ncbi.nlm.nih.gov/pubmed/8375526>. Acesso em: 15 abr. 2011. doi.

CALDWELL, A. S., et al. Characterization of reproductive, metabolic, and endocrine features of polycystic ovary syndrome in female hyperandrogenic mouse models. Endocrinology, v.155, n.8, p.3146-59. 2014. Disponível em: <http://www.ncbi.nlm.nih.gov/pubmed/24877633>. Acesso em: 15 abr. 2011. doi: 10.1210/en.2014-1196.

CARMINA, E., et al. Phenotypic variation in hyperandrogenic women influences the findings of abnormal metabolic and cardiovascular risk parameters. J Clin Endocrinol Metab, v.90, n.5, p.2545-9. 2005. Disponível em: <http://www.ncbi.nlm.nih.gov/pubmed/15728203>. Acesso em: 15 abr. 2011. doi: 10.1210/jc.2004-2279.

CHEN, X., et al. Prevalence of polycystic ovary syndrome in unselected women from southern China. Eur J Obstet Gynecol Reprod Biol, v.139, n.1, p.59-64. 2008. Disponível em: <http://www.ncbi.nlm.nih.gov/pubmed/18378061>. Acesso em: 15 abr. 2011. doi: 10.1016/j.ejogrb.2007.12.018.

CHENG, G., et al. The kisspeptin/neurokinin B/dynorphin (KNDy) cell population of the arcuate nucleus: sex differences and effects of prenatal testosterone in sheep. Endocrinology, v.151, n.1, p.301-11. 2010. Disponível em: <http://www.ncbi.nlm.nih.gov/pubmed/19880810>. Acesso em: 15 abr. 2011. doi: 10.1210/en.2009-0541.

DASGUPTA, S.; B. M. REDDY. Present status of understanding on the genetic etiology of polycystic ovary syndrome. J Postgrad Med, v.54, n.2, p.115-25. 2008. Disponível em: <http://www.ncbi.nlm.nih.gov/pubmed/18480528>. Acesso em: 15 abr. 2011. doi.

DEVOTO, L., et al. Human corpus luteum physiology and the luteal-phase dysfunction associated with ovarian stimulation. Reprod Biomed Online, v.18 Suppl 2, p.19-24. 2009. Disponível em: <http://www.ncbi.nlm.nih.gov/pubmed/19406027>. Acesso em: 15 abr. 2011. doi.

DIAMANTI-KANDARAKIS, E., et al. Endocrine-disrupting chemicals: an Endocrine Society scientific statement. Endocr Rev, v.30, n.4, p.293-342. 2009. Disponível em: <http://www.ncbi.nlm.nih.gov/pubmed/19502515>. Acesso em: 15 abr. 2011. doi: 10.1210/er.2009-0002.

DIAMANTI-KANDARAKIS, E., et al. A survey of the polycystic ovary syndrome in the Greek island of Lesbos: hormonal and metabolic profile. J Clin Endocrinol Metab, v.84, n.11, p.4006-11. 1999. Disponível em: <http://www.ncbi.nlm.nih.gov/pubmed/10566641>. Acesso em: 15 abr. 2011. doi: 10.1210/jcem.84.11.6148.

DIAMANTI-KANDARAKIS, E., et al. Polycystic ovary syndrome: the influence of environmental and genetic factors. Hormones (Athens), v.5, n.1, p.17-34. 2006. Disponível em: <http://www.ncbi.nlm.nih.gov/pubmed/16728382>. Acesso em: 15 abr. 2011. doi.

DUMESIC, D. A., et al. Polycystic ovary syndrome and its developmental origins. Rev Endocr Metab Disord, v.8, n.2, p.127-41. 2007. Disponível em: <http://www.ncbi.nlm.nih.gov/pubmed/17659447>. Acesso em: 15 abr. 2011. doi: 10.1007/s11154-007-9046-0.

DUMESIC, D. A., et al. Early origins of polycystic ovary syndrome. Reprod Fertil Dev, v.17, n.3, p.349-60. 2005. Disponível em: <http://www.ncbi.nlm.nih.gov/pubmed/15745643>. Acesso em: 15 abr. 2011. doi.

DUMESIC, D. A., et al. Impaired developmental competence of oocytes in adult prenatally androgenized female rhesus monkeys undergoing gonadotropin stimulation for in vitro fertilization. J Clin Endocrinol Metab, v.87, n.3, p.1111-9. 2002. Disponível em: <http://www.ncbi.nlm.nih.gov/pubmed/11889174>. Acesso em: 15 abr. 2011. doi: 10.1210/jcem.87.3.8287.

DUNAIF, A. Insulin resistance and the polycystic ovary syndrome: mechanism and implications for pathogenesis. Endocr Rev, v.18, n.6, p.774-800. 1997. Disponível em: <http://www.ncbi.nlm.nih.gov/pubmed/9408743>. Acesso em: 15 abr. 2011. doi: 10.1210/edrv.18.6.0318.

EISNER, J. R., et al. Ovarian hyperandrogenism in adult female rhesus monkeys exposed to prenatal androgen excess. Fertil Steril, v.77, n.1, p.167-72. 2002. Disponível em: <http://www.ncbi.nlm.nih.gov/pubmed/11779609>. Acesso em: 15 abr. 2011. doi.

ERICKSON, G. F. An analysis of follicle development and ovum maturation In: Seminars and reproductive endocrinology. San Diego, California. 1986. 233 - 254 p.

73

ESCOBAR-MORREALE, H. F., et al. The molecular-genetic basis of functional hyperandrogenism and the polycystic ovary syndrome. Endocr Rev, v.26, n.2, p.251-82. 2005. Disponível em: <http://www.ncbi.nlm.nih.gov/pubmed/15561799>. Acesso em: 15 abr. 2011. doi: 10.1210/er.2004-0004.

FOECKING, E. M., et al. Neuroendocrine consequences of prenatal androgen exposure in the female rat: absence of luteinizing hormone surges, suppression of progesterone receptor gene expression, and acceleration of the gonadotropin-releasing hormone pulse generator. Biol Reprod, v.72, n.6, p.1475-83. 2005. Disponível em: <http://www.ncbi.nlm.nih.gov/pubmed/15744016>. Acesso em: 15 abr. 2011. doi: 10.1095/biolreprod.105.039800.

FORTUNE, J. E. Ovarian follicular growth and development in mammals. Biol Reprod, v.50, n.2, p.225-32. 1994. Disponível em: <http://www.ncbi.nlm.nih.gov/pubmed/8142540>. Acesso em: 15 abr. 2011. doi.

FOSTER, D. L. Luteinizing hormone and progesterone secretion during sexual maturation of the rhesus monkey: short luteal phases during the initial menstrual cycles. Biol Reprod, v.17, n.4, p.584-90. 1977. Disponível em: <http://www.ncbi.nlm.nih.gov/pubmed/411527>. Acesso em: 15 abr. 2011. doi.

FRANKS, S. Animal models and the developmental origins of polycystic ovary syndrome: increasing evidence for the role of androgens in programming reproductive and metabolic dysfunction. Endocrinology, v.153, n.6, p.2536-8. 2012. Disponível em: <http://www.ncbi.nlm.nih.gov/pubmed/22610962>. Acesso em: 15 abr. 2011. doi: 10.1210/en.2012-1366.

GAMBINERI, A., et al. Obesity and the polycystic ovary syndrome. Int J Obes Relat Metab Disord, v.26, n.7, p.883-96. 2002. Disponível em: <http://www.ncbi.nlm.nih.gov/pubmed/12080440>. Acesso em: 15 abr. 2011. doi: 10.1038/sj.ijo.0801994.

GARZO, V. G., et al. Effects of an antiprogesterone (RU486) on the hypothalamic-hypophyseal-ovarian-endometrial axis during the luteal phase of the menstrual cycle. J Clin Endocrinol Metab, v.66, n.3, p.508-17. 1988. Disponível em: <http://www.ncbi.nlm.nih.gov/pubmed/2832438>. Acesso em: 15 abr. 2011. doi: 10.1210/jcem-66-3-508.

GORE, A. C., et al. Early life exposure to endocrine-disrupting chemicals causes lifelong molecular reprogramming of the hypothalamus and premature reproductive aging. Mol Endocrinol, v.25, n.12, p.2157-68. 2011. Disponível em: <http://www.ncbi.nlm.nih.gov/pubmed/22016562>. Acesso em: 15 abr. 2011. doi: 10.1210/me.2011-1210.

IWASA, T., et al. Effects of chronic testosterone administration on body weight and food intake differ among pre-pubertal, gonadal-intact, and ovariectomized female rats. Behav Brain Res, v.309, p.35-43. 2016. Disponível em: <http://www.ncbi.nlm.nih.gov/pubmed/27139935>. Acesso em: 15 abr. 2011. doi: 10.1016/j.bbr.2016.04.048.

KAFALI, H., et al. Letrozole-induced polycystic ovaries in the rat: a new model for cystic ovarian disease. Arch Med Res, v.35, n.2, p.103-8. 2004. Disponível em: <http://www.ncbi.nlm.nih.gov/pubmed/15010188>. Acesso em: 15 abr. 2011. doi: 10.1016/j.arcmed.2003.10.005.

KAUFFMAN, A. S., et al. A Novel Letrozole Model Recapitulates Both the Reproductive and Metabolic Phenotypes of Polycystic Ovary Syndrome in Female Mice. Biol Reprod, v.93, n.3, p.69. 2015. Disponível em: <http://www.ncbi.nlm.nih.gov/pubmed/26203175>. Acesso em: 15 abr. 2011. doi: 10.1095/biolreprod.115.131631.

KIERSZENBAUM, A. L. Histology and cell biology: an introduction to pathology. 2008. 445-7 p.

KIM, J. J.; Y. M. CHOI. Dyslipidemia in women with polycystic ovary syndrome. Obstet Gynecol Sci, v.56, n.3, p.137-42. 2013. Disponível em: <http://www.ncbi.nlm.nih.gov/pubmed/24327994>. Acesso em: 15 abr. 2011. doi: 10.5468/ogs.2013.56.3.137.

KUMAR, A., et al. Prevalence of adrenal androgen excess in patients with the polycystic ovary syndrome (PCOS). Clin Endocrinol (Oxf), v.62, n.6, p.644-9. 2005. Disponível em: <http://www.ncbi.nlm.nih.gov/pubmed/15943823>. Acesso em: 15 abr. 2011. doi: 10.1111/j.1365-2265.2005.02256.x.

LANG, I. A., et al. Association of urinary bisphenol A concentration with medical disorders and laboratory abnormalities in adults. JAMA, v.300, n.11, p.1303-10. 2008. Disponível em: <http://www.ncbi.nlm.nih.gov/pubmed/18799442>. Acesso em: 15 abr. 2011. doi: 10.1001/jama.300.11.1303.

LEVI-SETTI, P. E., et al. FSH and LH together in ovarian stimulation. Eur J Obstet Gynecol Reprod Biol, v.115 Suppl 1, p.S34-9. 2004. Disponível em: <http://www.ncbi.nlm.nih.gov/pubmed/15196714>. Acesso em: 15 abr. 2011. doi: 10.1016/j.ejogrb.2004.01.013.

LOUGHLIN, T., et al. Adrenal abnormalities in polycystic ovary syndrome. J Clin Endocrinol Metab, v.62, n.1, p.142-7. 1986. Disponível em: <http://www.ncbi.nlm.nih.gov/pubmed/3079598>. Acesso em: 15 abr. 2011. doi: 10.1210/jcem-62-1-142.

LYONS, A. Medicine: an illustrated history. New York. 1987

MACIEL, G. A., et al. Stockpiling of transitional and classic primary follicles in ovaries of women with polycystic ovary syndrome. J Clin Endocrinol Metab, v.89, n.11, p.5321-7. 2004. Disponível em: <http://www.ncbi.nlm.nih.gov/pubmed/15531477>. Acesso em: 15 abr. 2011. doi: 10.1210/jc.2004-0643.

MACHADO, A. Neuroanatomia functional. São Paulo. 2006

75

MAHAMED, R. R., et al. Effects of metformin on the reproductive system of androgenized female rats. Fertil Steril, v.95, n.4, p.1507-9. 2011. Disponível em: <http://www.ncbi.nlm.nih.gov/pubmed/20828684>. Acesso em: 15 abr. 2011. doi: 10.1016/j.fertnstert.2010.07.1093.

MANIKKAM, M., et al. Fetal programming: prenatal testosterone excess leads to fetal growth retardation and postnatal catch-up growth in sheep. Endocrinology, v.145, n.2, p.790-8. 2004. Disponível em: <http://www.ncbi.nlm.nih.gov/pubmed/14576190>. Acesso em: 15 abr. 2011. doi: 10.1210/en.2003-0478.

MANIKKAM, M., et al. Developmental programming: impact of prenatal testosterone excess on pre- and postnatal gonadotropin regulation in sheep. Biol Reprod, v.78, n.4, p.648-60. 2008. Disponível em: <http://www.ncbi.nlm.nih.gov/pubmed/18094361>. Acesso em: 15 abr. 2011. doi: 10.1095/biolreprod.107.063347.

MANNERAS, L., et al. A new rat model exhibiting both ovarian and metabolic characteristics of polycystic ovary syndrome. Endocrinology, v.148, n.8, p.3781-91. 2007. Disponível em: <http://www.ncbi.nlm.nih.gov/pubmed/17495003>. Acesso em: 15 abr. 2011. doi: 10.1210/en.2007-0168.

MARCONDES, F. K., et al. Determination of the estrous cycle phases of rats: some helpful considerations. Braz J Biol, v.62, n.4A, p.609-14. 2002. Disponível em: <http://www.ncbi.nlm.nih.gov/pubmed/12659010>. Acesso em: 15 abr. 2011. doi.

MARCONDES, R. R., et al. Differences in neonatal exposure to estradiol or testosterone on ovarian function and hormonal levels. Gen Comp Endocrinol, v.212, p.28-33. 2015. Disponível em: <http://www.ncbi.nlm.nih.gov/pubmed/25623143>. Acesso em: 15 abr. 2011. doi: 10.1016/j.ygcen.2015.01.006.

MARCH, W. A., et al. The prevalence of polycystic ovary syndrome in a community sample assessed under contrasting diagnostic criteria. Hum Reprod, v.25, n.2, p.544-51. 2010. Disponível em: <http://www.ncbi.nlm.nih.gov/pubmed/19910321>. Acesso em: 15 abr. 2011. doi: 10.1093/humrep/dep399.

MASON, H., et al. Polycystic ovary syndrome (PCOS) trilogy: a translational and clinical review. Clin Endocrinol (Oxf), v.69, n.6, p.831-44. 2008. Disponível em: <http://www.ncbi.nlm.nih.gov/pubmed/18616705>. Acesso em: 15 abr. 2011. doi: 10.1111/j.1365-2265.2008.03329.x.

MCDONALD, P. G.; C. DOUGHTY. Comparison of the effect of neonatal administration of testosterone and dihydrotestosterone in the female rat. J Reprod Fertil, v.30, n.1, p.55-62. 1972. Disponível em: <http://www.ncbi.nlm.nih.gov/pubmed/5064322>. Acesso em: 15 abr. 2011. doi.

MCNEILLY, A. S., et al. The differential secretion of FSH and LH: regulation through genes, feedback and packaging. Reprod Suppl, v.61, p.463-76. 2003. Disponível em: <http://www.ncbi.nlm.nih.gov/pubmed/14635955>. Acesso em: 15 abr. 2011. doi.

MEHRABIAN, F., et al. The prevalence of polycystic ovary syndrome in Iranian women based on different diagnostic criteria. Endokrynol Pol, v.62, n.3, p.238-42. 2011. Disponível em: <http://www.ncbi.nlm.nih.gov/pubmed/21717406>. Acesso em: 15 abr. 2011. doi.

MELZER, D., et al. Urinary bisphenol a concentration and angiography-defined coronary artery stenosis. PLoS One, v.7, n.8, p.e43378. 2012. Disponível em: <http://www.ncbi.nlm.nih.gov/pubmed/22916252>. Acesso em: 15 abr. 2011. doi: 10.1371/journal.pone.0043378.

MICHELMORE, K. F., et al. Polycystic ovaries and associated clinical and biochemical features in young women. Clin Endocrinol (Oxf), v.51, n.6, p.779-86. 1999. Disponível em: <http://www.ncbi.nlm.nih.gov/pubmed/10619984>. Acesso em: 15 abr. 2011. doi.

MILLER, W. L.; R. J. AUCHUS. The molecular biology, biochemistry, and physiology of human steroidogenesis and its disorders. Endocr Rev, v.32, n.1, p.81-151. 2011. Disponível em: <http://www.ncbi.nlm.nih.gov/pubmed/21051590>. Acesso em: 15 abr. 2011. doi: 10.1210/er.2010-0013.

MORAN, C., et al. Adrenal androgen excess in hyperandrogenism: relation to age and body mass. Fertil Steril, v.71, n.4, p.671-4. 1999. Disponível em: <http://www.ncbi.nlm.nih.gov/pubmed/10202877>. Acesso em: 15 abr. 2011. doi.

NEWBOLD, R. R., et al. Long-term adverse effects of neonatal exposure to bisphenol A on the murine female reproductive tract. Reprod Toxicol, v.24, n.2, p.253-8. 2007. Disponível em: <http://www.ncbi.nlm.nih.gov/pubmed/17804194>. Acesso em: 15 abr. 2011. doi: 10.1016/j.reprotox.2007.07.006.

NORMAN, R. J., et al. Polycystic ovary syndrome. The Lancet, v.370, n.9588, p.685-697. 2007. Disponível em: em: 15 abr. 2011. doi: 10.1016/s0140-6736(07)61345-2.

PADMANABHAN, V., et al. Prenatal testosterone excess programs reproductive and metabolic dysfunction in the female. Mol Cell Endocrinol, v.246, n.1-2, p.165-74. 2006. Disponível em: <http://www.ncbi.nlm.nih.gov/pubmed/16413112>. Acesso em: 15 abr. 2011. doi: 10.1016/j.mce.2005.11.016.

PADMANABHAN, V.; A. VEIGA-LOPEZ. Developmental origin of reproductive and metabolic dysfunctions: androgenic versus estrogenic reprogramming. Semin Reprod Med, v.29, n.3, p.173-86. 2011. Disponível em: <http://www.ncbi.nlm.nih.gov/pubmed/21710394>. Acesso em: 15 abr. 2011. doi: 10.1055/s-0031-1275519.

77

PADMANABHAN, V.; A. VEIGA-LOPEZ. Animal models of the polycystic ovary syndrome phenotype. Steroids, v.78, n.8, p.734-40. 2013a. Disponível em: <http://www.ncbi.nlm.nih.gov/pubmed/23701728>. Acesso em: 15 abr. 2011. doi: 10.1016/j.steroids.2013.05.004.

PADMANABHAN, V.; A. VEIGA-LOPEZ. Sheep models of polycystic ovary syndrome phenotype. Mol Cell Endocrinol, v.373, n.1-2, p.8-20. 2013b. Disponível em: <http://www.ncbi.nlm.nih.gov/pubmed/23084976>. Acesso em: 15 abr. 2011. doi: 10.1016/j.mce.2012.10.005.

PASQUALI, R.; M. FILICORI. Insulin sensitizing agents and polycystic ovary syndrome. Eur J Endocrinol, v.138, n.3, p.253-4. 1998. Disponível em: <http://www.ncbi.nlm.nih.gov/pubmed/9539295>. Acesso em: 15 abr. 2011. doi.

PINILLA, L., et al. Changes in pituitary secretion during the early postnatal period and anovulatory syndrome induced by neonatal oestrogen or androgen in rats. J Reprod Fertil, v.97, n.1, p.13-20. 1993. Disponível em: <http://www.ncbi.nlm.nih.gov/pubmed/8464003>. Acesso em: 15 abr. 2011. doi.

PRINS, G. S., et al. Developmental estrogen exposures predispose to prostate carcinogenesis with aging. Reprod Toxicol, v.23, n.3, p.374-82. 2007. Disponível em: <http://www.ncbi.nlm.nih.gov/pubmed/17123779>. Acesso em: 15 abr. 2011. doi: 10.1016/j.reprotox.2006.10.001.

ROBINSON, J. E., et al. In utero exposure of female lambs to testosterone reduces the sensitivity of the gonadotropin-releasing hormone neuronal network to inhibition by progesterone. Endocrinology, v.140, n.12, p.5797-805. 1999. Disponível em: <http://www.ncbi.nlm.nih.gov/pubmed/10579346>. Acesso em: 15 abr. 2011. doi: 10.1210/endo.140.12.7205.

ROJAS, J., et al. Physiologic Course of Female Reproductive Function: A Molecular Look into the Prologue of Life. J Pregnancy, v.2015, p.715735. 2015. Disponível em: <http://www.ncbi.nlm.nih.gov/pubmed/26697222>. Acesso em: 15 abr. 2011. doi: 10.1155/2015/715735.

ROLAND, A. V., et al. Prenatal androgen exposure programs metabolic dysfunction in female mice. J Endocrinol, v.207, n.2, p.213-23. 2010. Disponível em: <http://www.ncbi.nlm.nih.gov/pubmed/20713501>. Acesso em: 15 abr. 2011. doi: 10.1677/JOE-10-0217.

ROSENFIELD, R. L. Current concepts of polycystic ovary syndrome. Baillieres Clin Obstet Gynaecol, v.11, n.2, p.307-33. 1997. Disponível em: <http://www.ncbi.nlm.nih.gov/pubmed/9536213>. Acesso em: 15 abr. 2011. doi.

RUSSELL, B. História do pensamento ocidental. São Paulo. 2001

SAM, S.; D. A. EHRMANN. Hormonal Evaluation of Hyperandrogenism in Women. JAMA, v.314, n.23, p.2557-8. 2015. Disponível em: <http://www.ncbi.nlm.nih.gov/pubmed/26670974>. Acesso em: 15 abr. 2011. doi: 10.1001/jama.2015.11612.

SARMA, H. N., et al. Fetal programming: excess prenatal testosterone reduces postnatal luteinizing hormone, but not follicle-stimulating hormone responsiveness, to estradiol negative feedback in the female. Endocrinology, v.146, n.10, p.4281-91. 2005. Disponível em: <http://www.ncbi.nlm.nih.gov/pubmed/15976056>. Acesso em: 15 abr. 2011. doi: 10.1210/en.2005-0322.

SHARMA, T. P., et al. Fetal programming: prenatal androgen disrupts positive feedback actions of estradiol but does not affect timing of puberty in female sheep. Biol Reprod, v.66, n.4, p.924-33. 2002. Disponível em: <http://www.ncbi.nlm.nih.gov/pubmed/11906910>. Acesso em: 15 abr. 2011. doi.

SINGH, K. B. Persistent estrus rat models of polycystic ovary disease: an update. Fertil Steril, v.84 Suppl 2, p.1228-34. 2005. Disponível em: <http://www.ncbi.nlm.nih.gov/pubmed/16210015>. Acesso em: 15 abr. 2011. doi: 10.1016/j.fertnstert.2005.06.013.

SLOB, A. K., et al. Prenatal testosterone propionate and postnatal ovarian activity in the rat. Acta Endocrinol (Copenh), v.103, n.3, p.420-7. 1983. Disponível em: <http://www.ncbi.nlm.nih.gov/pubmed/6880571>. Acesso em: 15 abr. 2011. doi.

SPEROFF L, F. M. Clinical Endocrinology and infertility. Philadelphia. 2005

STECKLER, T. L., et al. Developmental programming in sheep: administration of testosterone during 60-90 days of pregnancy reduces breeding success and pregnancy outcome. Theriogenology, v.67, n.3, p.459-67. 2007. Disponível em: <http://www.ncbi.nlm.nih.gov/pubmed/17010414>. Acesso em: 15 abr. 2011. doi: 10.1016/j.theriogenology.2006.08.010.

STEVENS A, L. J. L. Macrophages and Dendritic Cells. In: Human Histology. 2002. 117-23 p.

SULLIVAN, S. D.; S. M. MOENTER. GABAergic integration of progesterone and androgen feedback to gonadotropin-releasing hormone neurons. Biol Reprod, v.72, n.1, p.33-41. 2005. Disponível em: <http://www.ncbi.nlm.nih.gov/pubmed/15342358>. Acesso em: 15 abr. 2011. doi: 10.1095/biolreprod.104.033126.

SWANSON, H. E.; J. J. WERFFTENBOSCH. The "Early-Androgen" Syndrome; Differences in Response to Pre-Natal and Post-Natal Administration of Various Doses of Testosterone Propionate in Female and Male Rats. Acta Endocrinol (Copenh), v.47, p.37-50. 1964. Disponível em: <http://www.ncbi.nlm.nih.gov/pubmed/14208150>. Acesso em: 15 abr. 2011. doi.

79

TARANTINO, G., et al. Bisphenol A in polycystic ovary syndrome and its association with liver-spleen axis. Clin Endocrinol (Oxf), v.78, n.3, p.447-53. 2013. Disponível em: <http://www.ncbi.nlm.nih.gov/pubmed/22805002>. Acesso em: 15 abr. 2011. doi: 10.1111/j.1365-2265.2012.04500.x.

TEHRANI, F. R., et al. Introducing a rat model of prenatal androgen-induced polycystic ovary syndrome in adulthood. Exp Physiol, v.99, n.5, p.792-801. 2014. Disponível em: <http://www.ncbi.nlm.nih.gov/pubmed/24532600>. Acesso em: 15 abr. 2011. doi: 10.1113/expphysiol.2014.078055.

TYNDALL, V., et al. Effect of androgen treatment during foetal and/or neonatal life on ovarian function in prepubertal and adult rats. Reproduction, v.143, n.1, p.21-33. 2012. Disponível em: <http://www.ncbi.nlm.nih.gov/pubmed/22016380>. Acesso em: 15 abr. 2011. doi: 10.1530/REP-11-0239.

UNSWORTH, W. P., et al. Prenatal programming of reproductive neuroendocrine function: the effect of prenatal androgens on the development of estrogen positive feedback and ovarian cycles in the ewe. Biol Reprod, v.72, n.3, p.619-27. 2005. Disponível em: <http://www.ncbi.nlm.nih.gov/pubmed/15509728>. Acesso em: 15 abr. 2011. doi: 10.1095/biolreprod.104.035691.

VAN DER KAMP, H. J., et al. Newborn screening for congenital adrenal hyperplasia in the Netherlands. Pediatrics, v.108, n.6, p.1320-4. 2001. Disponível em: <http://www.ncbi.nlm.nih.gov/pubmed/11731654>. Acesso em: 15 abr. 2011. doi.

VEIGA-LOPEZ, A., et al. Developmental programming: rescuing disruptions in preovulatory follicle growth and steroidogenesis from prenatal testosterone disruption. J Ovarian Res, v.9, n.1, p.39. 2016. Disponível em: <http://www.ncbi.nlm.nih.gov/pubmed/27357284>. Acesso em: 15 abr. 2011. doi: 10.1186/s13048-016-0250-y.

VEIGA-LOPEZ, A., et al. Developmental programming: deficits in reproductive hormone dynamics and ovulatory outcomes in prenatal, testosterone-treated sheep. Biol Reprod, v.78, n.4, p.636-47. 2008. Disponível em: <http://www.ncbi.nlm.nih.gov/pubmed/18094354>. Acesso em: 15 abr. 2011. doi: 10.1095/biolreprod.107.065904.

VIEIRA S, H. W. A ética e a metodologia. 1998

WALTERS, K. A., et al. Androgen actions and the ovary. Biol Reprod, v.78, n.3, p.380-9. 2008. Disponível em: <http://www.ncbi.nlm.nih.gov/pubmed/18003945>. Acesso em: 15 abr. 2011. doi: 10.1095/biolreprod.107.064089.

WEST, C., et al. Intra-follicular activin availability is altered in prenatally-androgenized lambs. Mol Cell Endocrinol, v.185, n.1-2, p.51-9. 2001. Disponível em: <http://www.ncbi.nlm.nih.gov/pubmed/11738794>. Acesso em: 15 abr. 2011. doi.

WILD, R. A. Dyslipidemia in PCOS. Steroids, v.77, n.4, p.295-9. 2012. Disponível em: <http://www.ncbi.nlm.nih.gov/pubmed/22197663>. Acesso em: 15 abr. 2011. doi: 10.1016/j.steroids.2011.12.002.

WILSON, M. E.; T. P. GORDON. Season determines timing of first ovulation in rhesus monkeys (Macaca mulatta) housed outdoors. J Reprod Fertil, v.85, n.2, p.583-91. 1989. Disponível em: <http://www.ncbi.nlm.nih.gov/pubmed/2703996>. Acesso em: 15 abr. 2011. doi.

WU, X. Y., et al. Endocrine traits of polycystic ovary syndrome in prenatally androgenized female Sprague-Dawley rats. Endocr J, v.57, n.3, p.201-9. 2010. Disponível em: <http://www.ncbi.nlm.nih.gov/pubmed/20057162>. Acesso em: 15 abr. 2011. doi.

XU, X. J., et al. Prenatal hyperandrogenic environment induced autistic-like behavior in rat offspring. Physiol Behav, v.138, p.13-20. 2015. Disponível em: <http://www.ncbi.nlm.nih.gov/pubmed/25455866>. Acesso em: 15 abr. 2011. doi: 10.1016/j.physbeh.2014.09.014.

YEN, J. Reproductive Endocrinology; Physiology, pathophysiology, and clinical management. Pennaylvania. 2004. 3-74 p.

YEN, S. S. Regulation of the hypothalamic--pituitary--ovarian axis in women. J Reprod Fertil, v.51, n.1, p.181-91. 1977. Disponível em: <http://www.ncbi.nlm.nih.gov/pubmed/335059>. Acesso em: 15 abr. 2011. doi.

ZHOU, R., et al. Adrenal hyperandrogenism is induced by fetal androgen excess in a rhesus monkey model of polycystic ovary syndrome. J Clin Endocrinol Metab, v.90, n.12, p.6630-7. 2005. Disponível em: <http://www.ncbi.nlm.nih.gov/pubmed/16174719>. Acesso em: 15 abr. 2011. doi: 10.1210/jc.2005-0691.

ZURVARRA, F. M., et al. Disruption in the expression and immunolocalisation of steroid receptors and steroidogenic enzymes in letrozole-induced polycystic ovaries in rat. Reprod Fertil Dev, v.21, n.7, p.827-39. 2009. Disponível em: <http://www.ncbi.nlm.nih.gov/pubmed/19698287>. Acesso em: 15 abr. 2011. doi: 10.1071/RD09026.

Lady Katerine Serrano Mujica - repositorio.ufsm.br

Documents

Transcript of Lady Katerine Serrano Mujica - repositorio.ufsm.br