UNIVERSIDADE DE LISBOArepositorio.ul.pt › bitstream › 10451 › 2032 › 1 ›...

UNIVERSIDADE DE LISBOA

FACULDADE DE CIÊNCIAS

DEPARTAMENTO DE QUÍMICA E BIOQUÍMICA

Methylglyoxal Metabolism in Leishmania infantum

Lídia Isabel Sebastião Barata

Doutoramento em Bioquímica

(Regulação Bioquímica)

2010

Tese orientada pelo Doutor Carlos Alberto Alves Cordeiro e

pela Doutora Marta Filomena Sousa Silva

DDeeccllaarraaççããoo

De acordo com o disposto no artigo nº. 40 do Regulamento de Estudos Pós-Graduados da

Universidade de Lisboa, Deliberação nº 961/2003, publicada no Diário da República – II Série nº.

153 – 5 de Julho de 2003, foram incluídos nesta dissertação os resultados dos seguintes artigos:

Trincão J‡, Sousa Silva M‡, Barata L, Bonifácio C., Carvalho S., Tomás A. M., Ferreira A. E. N., Cordeiro C.,

Ponces Freire A., Romão M. J. (2006) Purification, Crystallization and Preliminary X-ray Diffraction Analysis

of the Glyoxalase II from Leishmania infantum, Acta Crystallographica Section F 62, 805-807. (‡ both authors

contributed equally for the present work)

Sousa Silva M.‡, Barata L.‡, Ferreira A. E. N., Romão S., Tomás A. M., Ponces Freire A., Cordeiro C.

(2008) Catalysis and Structural Properties of Leishmania infantum Glyoxalase II: Trypanothione

Specificity and Phylogeny, Biochemistry 47, 195-204. (‡ both authors contributed equally for the

present work)

Barata L., Sousa Silva M., Schuldt L., Costa G., Tomás A. M., Ferreira A. E. N., Weiss M. S., Ponces

Freire A., Cordeiro C. (2010) Cloning, expression, purification, crystallization and preliminary X-ray

diffraction analysis of Glyoxalase I from Leishmania infantum, Acta Crystallographica Section F 66,

571–574.

No cumprimento do disposto na referida deliberação, esclarece-se serem da minha

responsabilidade a execução das experiências que estiveram na base dos resultados apresentados

(excepto quando referido em contrário), assim como a interpretação e discussão dos mesmos.

Lisboa, 14 de Julho de 2010

Lídia Isabel Sebastião Barata

Audere est facere.

AAcckknnoowwlleeddggmmeennttss// AAggrraaddeecciimmeennttooss

vviiii

AAcckknnoowwlleeddggeemmeennttss// AAggrraaddeecciimmeennttooss

As minhas palavras nunca serão suficientes para agradecer a todos os que, respeitando sempre o que

eu era me tornaram naquilo que sou, e que será inevitavelmente perpetuado no que serei. Naturalmente, esta

tese é o refexo de quatro longos anos de trabalho individual. No entanto, muitas foram as contribuições

directas e indirectas para os bons resultados apresentados, as quais não posso deixar de agradecer. Estando

inserida em dois grupos científicos únicos, e tendo ambos criado um ambiente acolhedor entre muitas

amizades, serão inúmeras as memórias, tanto a nível científico como pessoal, que levarei comigo pela vida.

Em primeiríssimo lugar, gostaria de agradecer aos meus orientadores de doutoramento. À Doutora

Marta Sousa Silva, por ter acompanhado o meu trabalho de muito, muito perto, por ter assistido aos meus

primeiros passos no laboratório, pela sua contribuição especialmente nas primeiras clonagens e purificações

(realizadas na FCUL e no IBMC), pelo incentivo a concorrer a bolsas, congressos e cursos, e sobretudo pela

motivação à minha ida para Hamburgo, por ter tornardo o laboratório cor-de-rosa, e ainda pela amizade que

espero que se perpetue. Ao Doutor Carlos Cordeiro, que supervisionou todo o projecto, pela sua calma,

ponderação e optimismo, por me ter deixado decidir o meu caminho sempre com o seu apoio.

Um muito especial agradecimento à Professora Doutora Ana Ponces Freire, por me ter recebido no

seu grupo, por todo o apoio em situações dificeis, por ser justa, compreensiva e prática, e sobretudo por

representar um exemplo de vida.

Igualmente especial é o meu agradecimento ao Doutor Manfred Weiss... der mich das eine oder

andere Mal in seiner Gruppe empfangen hat, für seine ganze uterstützung, Strenge und Effizienz, sowie für

sein Abschiedsfeier und auch meine.

Não poderia deixar de prestar um enorme reconhecimento a todos os que participaram directamente

neste trabalho. À Professora Ana Tomás (IBMC/ ICBAS), pelo genoma de L. infantum e primers, sem os quais

este projecto não seria possível, e pelo apoio no decurso do trabalho. Do grupo de Enzimologia, FCUL: ao

Gonçalo da Costa, por ter realizado ensaios de espectroscopia de massa que muito contribuiram para este

trabalho, por toda a sua disponibilidade, motivação e companheirismo; e ao Professor António Ferreira pelo

apoio não só informático, como na determinação de parâmetros cinéticos, e pelo insentivo ao uso do

Chimera, o programa de representação de proteínas mais prático que conheço. Do EMBL-HH: meinen dank

an Linda Schuldt, für ihre Hilfe, bei der data collection die ganze Nacht hin durch, der Metallbesrechnung

des Glyoxalase I, aber auch für die stetige Sympathie; an Gerrit Langer, für das Programm der

Metalmengenberechnung des Glyoxalase I; an Xandra Kreplin, für die Kristallisierung versuche,

einschließlich die voll neu Techniken.

Agradeço, ainda, aos restantes elementos e ex-elementos do grupo de Enzimologia da FCUL,

destacando: o Nuno Lages, pelos longos anos de companheirismo, desde os nossos primeiros dias de caloiros

da licenciatura em bioquímica; o Luís Oliveira, por ser sempre amável; o Ricardo Gomes, por criar o bom

humor no laboratório; o Hugo Vicente Miranda, por ter sempre uma ideia para partilhar; a Rita Marques,

pela companhia, pelo mini-gel e pela visita a HH; o Bruno Oliveira, pela sua dor de cotovelo bem

AAcckknnoowwlleeddggmmeennttss//AAggrraaddeecciimmeennttooss

vviiiiii

intencionada que me fazia ter orgulho em mim mesma; o Flávio Figueira, pelo “pedestal”; e a todos eles pela

boa disposição permanente dentro e fora do laboratório.

Do mesmo modo, não posso deixar de agradecer a todas as pessoas que fizeram parte do meu dia-a-

dia em Hamburgo, tornando esta cidade mais quente e única aos meus olhos, e fazendo-me sentir em casa

longe de casa. Meinen dank, an Frank Lehmann, für seine ganze Freundschaft, in sowie auch auβerhalb des

Labors, für die Übergabe des MPD und dafür, dass er mir Gissela vorgestellt hat; an Hubert Mayerhofer für

seine Freundschaft und Sympathie und die Tischfuβballspiele. Merci, a Delphine Chesnel pour aller a la

facilité de cristallisation pour moi, pour les articles que je l’ai demandé de rechercher sous l’internet et pour

tout les drôles moments. Thanks, to Spyros Chatziefthimiou, for being a real gentleman, for the chocolates

and for all the times he said “welcome back”; to Georgios Hatzopoulos for letting me use his desk for a whole

year and for his friendship especially on my visit to Philly; to Elke Noens for her daily enthusiasm; to Chris

Williams, for all the jokes; to Justina Wojdyla and Joannis Manolaridis, for keeping always a contagious good

mood; to Manikandan Karuppasamy, for all the help on my first steps at the EMBL lab, for his kindness and

for the amazing indian cooking; to Matthias Ehebauer, for his extreme calm in a too busy lab; to Chanakya

Nugoor, for his never-ending questions; to Krisztian Fodor, for allowing me to use his thrombin-kit; to

Rositsa Jordanova and Matthew Groves for the help on the SLS data treatment; to Santosh Panjikar, for the

scientific conversations on the way to work; to Saravanan Panneerselvam and Yusuf Akhter for being nice

bench neighbours; to Anne Due, for letting me use her bench for so long; to Philipp Heuser, for all he taught

me about Germany; to Florian Sauer, for the trouble-shootings on the purifiers when no one else was at the

lab. Grazie, a Barbara Tizzano e Viviane Pogenberg, per tentare parlare portoghese; a Francesco Fersini per la

compagnia nella fermata di bus; a Marco Salomone Stagni per la consulenza di uso di filtri ultra-veloce per la

purificazione di tampone, i quali mi hanno salvato molto tempo. Gracias, al Doutor Iñaki de Diego, por la

partilla del peso de un lab vacío en la noche y por su determinación contagiosa; al Daniel Fulla, por la

compañía en las longas noches de beamtime, las inyecciones de autoestima y la “gold”; a Lesley Roca y

Álvaro, por la enormísima simpatía, por las pizzas caseras y todos los buenísimos momentos; a Esther Peña,

por la partilla de la misma situación de ser una “visitante” en HH, por todas las nuestras aventuras

hamburguesas; a Gissela Lehmann, por la hospitalidad, por ser la amiga única que es, por mi maravilloso

cumpleaños 2009, por tener un hijo tan lindo como Vinny, por toda la Inka Kola, los camotes y la calza y por

tenerme enseñado español; a Renzo Perales, que, aunque lejos, de hecho siempre ha estado conmigo en HH,

por ser mí espejo y por la complicidad.

Porque o ambiente lá fora é tão importante como o ambiente dentro do laboratório para que a estrela

da sorte sorria aos bons resultados, não posso deixar de agradecer aos meus amigos que foram rasgando

emoções entre os dias de trabalho.

O maior dos agradecimentos aos meus pais, pelo seu apoio incondicional, por terem confiado sempre

nas minhas capacidades e acreditado sempre no meu sucesso, mesmo quando eu própria não acreditava. Por

terem sido os principais impulsionadores desta minha odisseia pela ciência e por me terem “dado asas”.

Finalmente, agradeço à FCT, MCTES (Portugal) e à EMBO pelo apoio financeiro.

TTaabbllee ooff CCoonntteennttss

iixx

Table of contents

Acknowledgments/ Agradecimentos ix Summary xiii Resumo xv Abbreviations

xvii

Chapter I – General introduction

1

1. Leishmania and Leishmaniasis 3 1.1. Leishmania infantum life cycle 7 1.2. Trypanosomatids biochemical uniqueness 9

1.2.1. The kinetoplast 9 1.2.2. The glycosome 10 1.2.3. Trypanothione 11

2. Methylglyoxal 13 2.1. Methylglyoxal biosynthesis 14

2.1.1. Methylglyoxal biosynthesis in trypanosomatids 17 2.2. Methylglyoxal catabolism 17

2.2.1. The glyoxalase pathway 18 2.2.1.1. Glyoxalase I 19 2.2.1.2. Glyoxalase II 21 2.2.1.3. The glyoxalase pathway in Trypanosomatids 23

2.2.2. Aldose reductase 25 2.2.2.1. Aldose reductase in Trypanosomatids 26

3. Aims and scope of this work

28

Chapter II – Glyoxalase I from Leishmania infantum

29

1. Summary 31 2. Introduction 32 3. Materials and Methods 34

3.1. Cloning and expression of LiGLO1 34 3.2. Purification of LiGLO1 34 3.3. Metal analysis by Inductively-Coupled Plasma 35 3.4. Crystallization 35 3.5. Data collection and processing 36 3.6. Crystal Structure Solution 37 3.7. Anomalous difference maps 37 3.8. Occupancies of metal binding sites 37 3.9. LiGLO1 Kinetic Analysis 38

4. Results and Discussion 39 4.1. The L. infantum glyoxalase I gene and deduced protein 39


xx

4.2. Recombinant LiGLO1 over-expressing and purification 39 4.3. Crystals, data collection and processing 40 4.4. Overall description of the LiGLO1 crystal structure 43 4.5. Active Site 45 4.6. Metal composition 46 4.7. LiGLO1 Kinetic Analysis 54 4.8. LiGLO1 evolutive considerations 55

5. Acknowledgements

55

Chapter III – Glyoxalase II from Leishmania infantum

57


3.1. LiGLO2 cloning: native and mutant forms 62 3.2. Protein expression and purification 62 3.3. Crystallization 64 3.4. Data collection and crystal structure determination 64 3.5. Metal analysis of recombinant native and mutant glyoxalase II 65 3.6. Enzyme activity assays 65 3.7. Determination of kinetic parameters 66 3.8. Activity in crystals 66

3.9. Evolutionary analysis 66 4. Results 67

4.1. The L. infantum glyoxalase II gene and deduced protein 67 4.2. Over-expression and purification of recombinant glyoxalase II 71 4.3. Final structures 71 4.4. The active site 76 4.5. The substrate-binding site 77 4.6. LiGLO2 kinetics: specificity for thiolesters of SPD-GSH conjugates 78 4.7. Mutant form of LiGLO2 78 4.8. Trypanothione specificity: structural and evolutionary analysis 82

5. Discussion 83 6. Acknowledgements

86

Chapter IV – Aldose Reductase from Leishmania infantum

87


3.1. Cloning of LiAKR 91 3.2. Expression of LiAKR in different E. coli strains and protein solubility 91 3.3. Purification buffer optimization by ThermoFluor 92 3.4. Large scale production and purification from soluble fraction 92 3.5. Protein analysis by mass spectrometry 93


xxii

3.6. Recombinant LiAKR activity assay 93 4. Results and Discussion 93

4.1. Cloning, expression and purification of LiAKR 94 4.2. Purification buffer optimization by ThermoFluor 96 4.3. Protein analysis by mass spectrometry 97 4.4. Activity of recombinant LiAKR 97

5. Concluding remarks 98 6. Acknowledgements

99

Chapter V – Concluding remarks

101

References 109

SSuummmmaarryy

xxiiiiii

SSuummmmaarryy

Leishmaniasis, caused by a Leishmania parasite belonging to the Trypanosomatidae family,

are diseases affecting humans and other mammals. The most severe form of the disease is lethal if

untreated, currently existing no vaccines or efficient therapies. The identification of new therapeutic

targets is presently based on exploiting the biochemical differences between the parasite and the

host. One of the main biochemical characteristics distinguishing trypanosomatids from other

eukaryotic cells is the functional replacement of glutathione by trypanothione. In trypanosomatids,

the glyoxalase system, comprising the enzymes glyoxalase I and glyoxalase II, depends on

trypanothione to eliminate methylglyoxal, a toxic compound formed non-enzymatically during

glycolysis. Hence, this is an excellent model system to understand trypanothione-dependent

enzymes specificity at a kinetic and molecular level. The methylglyoxal metabolism in L. infantum

study would not be complete without an account of aldose reductase, a NADPH-dependent

enzyme also catabolising this toxic compound. This project includes an eclectic structural and

biochemical study of the main enzymes involved in methylglyoxal catabolism, contributing for the

knowledge of these complex parasites. Additionally, these enzymes’ activities complement each

other in such a way that they can be synergistically exploited in the quest for new anti-leishmanial

drug targets.

The glyoxalase I gene from Leishmania infantum (LiGLO1) was isolated and cloned into an

expression vector for bacteria. The recombinant protein was over-expressed in E. coli, purified and

kinetically characterised. LiGLO1 showed to preferentially use the hemithioacetal derived from

trypanothione, although it can also catalyse the same reaction with the glutathione-derived

hemithioacetal. The recombinant protein was crystallised and its structure solved by molecular

replacement, using the glyoxalase structure from L. major as a search model. Although the LiGLO1

structure is very similar to the L. major GLO1, as expected by its high homology, the metal observed

at the active site is different. While LmGLO1 requires nickel for its activity, like glyoxalase I from

prokaryotes, it was shown both by ICP and anomalous diffraction that LiGLO1 contains zinc in the

active site, as its eukaryotic homologues. On the other hand, LiGLO1 has significant structural

differences relatively to the human glyoxalase I enzyme.

The glyoxalase II gene from L. infantum (LiGLO2) was also isolated and cloned in a bacterial

expression vector. The recombinant protein was over-expressed in E. coli, purified and kinetically

characterised, confirming its specificity towards trypanothione-derived thiolesters. LiGLO2 was

crystallised and its structure solved by molecular replacement, using the glutathione-dependent

SSuummmmaarryy

xxiivv

human glyoxalase II structure as a search model, for its high sequence homology with the

structurally unknown L. infantum protein. The determined structural model for LiGLO2 is very

similar to its human counterpart. Highly conserved residues were identified in the active site, as

well as specific residues of the L. infantum enzyme, being noteworthy the presence of the

spermidine-binding Cys294 and Ile171, both absent from the human enzyme. The presence of a

spermidine molecule on the LiGLO2 substrate binding site, together with sequence analysis,

clarified the enzyme’s substrate specificity at a molecular level. Both ICP metal-analysis and the B

factor values for the metal atoms revealed the presence of zinc and/or iron in the enzyme active

site. A structure with D-lactate in the active site was obtained by crystal soaking with substrate.

Superimposing both LiGLO2 structures, the localization of the trypanothione-derived thiolester in

the substrate-binding site could be clearly inferred. Two of the residues forming the substrate-

binding pocket, Tyr291 and Cys294, were subsequently replaced by the S-D-lactoylglutathione-

binding residues found on the human enzyme, Arg249 and Lys252, respectively. Recombinant

mutated LiGLO2 was over-expressed in E. coli. Kinetic analysis revealed that the enzyme’s

substrate specificity was changed, catalysing the reaction with S-D-lactoylglutathione, and loosing

affinity towards S-D-lactoyltrypanothione. These results show that the mutated residues are critical

for the enzyme specificity.

The aldose reductase gene from L. infantum (LiAKR) was identified for the first time in a

trypanosomatid. It was isolated and cloned into an expression vector. Over-expression of the

soluble recombinant protein in E. coli was only achieved by co-expression with chaperone systems.

The LiAKR enzyme was kinetically characterised as a NADPH-dependent aldose reductase

involved in the catabolism of methylglyoxal. This protein was recently crystallised, although the

observed diffraction requires crystal optimization.

Keywords: Leishmania infantum, methylglyoxal, trypanothione, glyoxalase pathway, aldose

reductase.

RReessuummoo

xxvv

RReessuummoo

Leishmanioses são doenças que afectam humanos e outros mamíferos, provocadas por um

parasita do género Leishmania, pertencente à família Trypanosomatidae. A forma mais severa da

doença é letal se não for tratada, não existindo actualmente vacinas ou terapias curativas eficazes. A

identificação de novos alvos terapêuticos baseia-se em diferenças encontradas entre o parasita e o

hospedeiro. Uma das principais características bioquímicas que distingue os tripanossomatídeos de

outras células eucariotas é a substituição funcional de glutationo por tripanotiono. Em

tripanossomatídeos, o sistema dos glioxalases, constituído pelos enzimas glioxalase I e glioxalase II,

depende de tripanotiono para eliminar o metilglioxal, um composto tóxico formado não-

enzimaticamente durante a glicólise. Assim, este é um excelente sistema modelo para compreender a

especificidade de enzimas dependentes de tripanotiono a um nível cinético e molecular. No entanto,

o estudo do metabolismo do metilglioxal em L. infantum não estaria completo sem referir o aldose

redutase, um enzima dependente de NADPH que também catabolisa este composto tóxico. Este

projecto inclui um estudo estrutural e bioquímico eclético dos principais enzimas envolvidos no

catabolismo do metilglioxal, contribuindo para o estudo destes complexos parasitas. Para além

disso, as actividades destes enzimas são de tal modo complementares que podem ser exploradas

sinergisticamente na busca por novos alvos para fármacos anti-leishmania.

O gene do glioxalase I de Leishmania infantum foi isolado e clonado num vector de expressão. A

proteína recombinante foi sobre-expressa em E. coli, purificada e caracterizada cineticamente, verificando-se

que o LiGLO1 catalisa preferencialmente o hemitioacetal derivado de tripanotiono, embora também possa

utilizar o hemitioacetal derivado de glutationo. A proteína recombinante foi cristalizada e a sua estrutura

resolvida por substituição molecular, utilizando a estrutura do glioxalase I de L. major como modelo de

pesquisa. Embora a estrutura do LiGLO1 seja muito semelhante à do LmGLO1, como esperado pela sua

elevada homologia de 97 %, estes enzimas diveregem no metal presente no centro activo. Enquanto o

LmGLO1 requer níquel para a sua actividade, à semelhança dos glioxalases I de procariotas, foi verificado

tanto por ICP como por difracção anómala, que o LiGLO1 contém zinco no seu centro activo, à semelhança

dos seus homólogos eucariotas. Estes resultados permitiram-nos estabelecer uma diferença entre ambas as

espécies de Leishmania, e propor uma hipótese em que o enzima de L. infantum terá divergido dos procariotas

mais cedo na linha evolutiva do que o enzima de L. major. Por outro lado, LiGLO1 tem grandes diferenças

estruturais em relação ao homólogo humano.

O glioxalase II de L. infantum foi também isolado e clonado num vector de expressão. A proteína

recombinante foi sobre-expressa em E. coli, purificada e caracterizada cineticamente, confirmando-se a sua

especificidade para os tioésteres derivados de tripanotiono. LiGLO2 foi cristalizado e a sua estrutura resolvida

RReessuummoo

xxvvii

por substituição molecular, utilizando a estrutura do glioxalase II humano, dependente de glutationo, como

modelo de pesquisa. O modelo da estrutura determinado para o LiGLO2 é muito semelhante ao do seu

homólogo humano. Foram identificados resíduos conservados no centro activo (His76, His78, Asp80, His81,

His139, Asp164, His210) bem como resíduos específicos no enzima de L. infantum (dos quais é de salientar a

presença da Cys294 e Ile171, que ligam a espermidina e a ausência dos resíduos Arg249, Lys143 e Lys252,

existentes no enzima humano). A presença de uma molécula de espermidina no local de ligação ao substrato

do LiGLO2, juntamente com uma análise das sequências, elucidou a especificidade do substrato do enzima ao

nível molecular. Tanto a análise de metais por ICP, como os valores dos factores B dos átomos de metal,

revelaram a presença de zinco e/ou ferro no centro activo do enzima. Foi obtido um modelo estrutural deste

enzima com D-lactato no centro activo, através de soaking de cristais com substrato. Sobrepondo ambas as

estruturas do LiGLO2, pôde ser claramente inferida a localização do tioester derivado de tripanotiono no

centro de ligação ao substrato. Dois dos resíduos que formam a cavidade onde se liga o substrato, Tyr291 e

Cys294, foram subsequentemente substituídos por resíduos que ligam o S-D-lactoilglutationo no enzima

humano, Arg249 e Lys252, respectivamente. O LiGLO2 mutado recombiante foi sobre-expresso em E. coli.

Este enzima mutado foi instável durante o processo de purificação. Análise cinética revelou que a

especificidade do enzima para o substrato foi alterada, reagindo com S-D-lactoilglutationo e perdendo

actividade para o S-D-lactoiltripanotiono. Estes resultados mostram que os resíduos mutados são críticos para

a especificidade do enzima.

O gene do aldose redutase de L. infantum foi identificado pela primeira vez num tripanossomatídeo.

Foi isolado e clonado num vector de expressão. A sobre-expressão da proteína recombinante na fracção

solúvel em E. coli foi apenas conseguida por co-expressão com sistemas de chaperones. O enzima LiAKR foi

cineticamente caracterizado como um aldose redutase dependente de NADPH envolvido no catabolism do

metilglioxal. Esta proteína foi recentemente cristalizada, embora a difracção observada requeira optimização

dos cristais.

Palavras-chave: Leishmania infantum, metilglioxal, tripanotiono, via dos glioxalases, aldose

redutase.

AAbbbbrreevviiaattiioonnss

xxvviiii

AAbbbbrreevviiaattiioonnss Å Angström

A; Abs Absorbance

Acetyl-CoA Acetyl-coenzyme A

ADP Adenosine 5’-diphosphate

AGE Advanced glycation end-product

AIDS Acquired immune deficiency syndrome

AKR Aldo-keto reductase

AKR1A Human aldehyde reductase; aldehyde:NAD(P)+ oxidoreductase; EC 1.1.1.2

AKR1B Human aldose reductase; alditol:NAD(P)+ oxidoreductase; EC 1.1.1.21

ATP Adenosine 5’-triphosphate

Bj Thermal vibration factor

1,3-BPGA 1,3-biphosphoglycerate

BSA Bovine serum albumin

Co-NTA Cobalt-nitrilotriacetic acid

CoA Coenzyme A

dmin Maximum resolution of a diffraction pattern

Da Dalton

DESY Deutsches Elektronen-Synchrotron

DHAP Dihydroxyacetone phosphate

DNA Deoxyrribonucleic acid

DTT Dithiothreitol

Ε Molar absorptivity coefficient

EDTA Ethylene diamine tetraacetic acid

EGTA Ethylene glycol tetraacetic acid

ESRF European Synchrotron Radiation Facility

eV Electron volt

FPLC Fast protein liquid chromatography

Fructose-1,6-BP D-Fructose-1,6-bisphosphate

GAP D-Glyceraldehyde-3-phosphate

GAPDH D-Glyceraldehyde-3-phosphate dehydrogenase: NADP+ oxidoreductase;

EC 1.2.1.9


xxvviiiiii

Glycerol-3-P D-Glycerol-3-phosphate

6-P-Glucose D-Glucose-6-phosphate

GPDH D-Glycerol-3-phosphate dehydrogenase;

sn-glycerol-3-phosphate: NAD+ 2-oxidoreductase; EC 1.1.1.8

GSH Glutathione, γ-glutamilcisteynilglicine

GspdSH N1-Glutathionylspermidine

GLO1 Glyoxalase I; lactoylglutathione lyase; EC 4.4.1.5

GLO2 Glyoxalase II; hydroxyacylglutathione hydrolase, EC 3.2.1.6

GLO4 Glyoxalase II mitochondrial isoform;

hydroxyacylglutathione hydrolase, EC 3.2.1.6

GRE3 Yeast aldose reductase gene, Gene de Respuesta al Estress

GSSG Oxidised glutathione

Hepes N-(2-hydroxyethyl)piperazine-2-ethanesulfonic acid

HIV Human immunodeficiency virus

HTA Hemithioacetal

ICP Inductively coupled plasma

IPTG Isopropil-β-D-thiogalactopyranoside

kDNA Kinetoplast DNA

kcat Catalytic constant

Km Michaelis-Menten constant

LB Luria-Bertani

LiGLO1 Glyoxalase I from Leishmania infantum; lactoylglutathione lyase; EC 4.4.1.5

LiGLO2 Glyoxalase II from Leishmania infantum; hydroxyacylglutathione hydrolase;

EC 3.2.1.6

LiAKR Aldose reductase from Leishmania infantum; alditol:NAD(P)+ oxidoreductase;

EC 1.1.1.21

M Molar

MAGE Methylglyoxal-derived advanced glycation

MALDI-FTICR-MS Matrix assisted laser desorption ionization –

Fourier transform ion cyclotron resonance mass spectrometry

MALDI-TOF-MS Matrix assisted laser desorption ionization –

time of flight mass spectrometry

MES 2-n-morpholino-ethanesulfonic acid

MG Methylglyoxal


xxiixx

MLT Mono-S-(lactoyl)-trypanothione

MOPS 3-(N-Morpholino)propanesulfonic acid

MOLD Methylglyoxal-lysine dimer

MPD 2-Methyl-2,4-pentanediol

Mr Molecular weight

MR Molecular replacement

mRNA Messenger RNA

NAD+ Nicotinamide adenine dinucleotide, oxidised form

NADH Nicotinamide adenine dinucleotide, reduced form

NADP+ Nicotinamide adenine dinucleotide phosphate, oxidised form

NADPH Nicotinamide adenine dinucleotide phosphate, reduced form

Ni-NTA Nickel-nitrilotriacetic acid

NMWL Nominal molecular weight limit

NTA Nitrilotriacetic acid

OD Optical density

PBS Saline phosphate buffered

PCR Polymerase chain reaction

PEG Poliethylene glycol

PFK 6-Phosphofructokinase; ATP: D-fructose-6-phosphate 1-phosphotransferase;

EC 2.7.1.11

3-PGA 3-Phosphoglycerate

PMF Peptide mass fingerprint

Rmsd Root mean square deviation

RNA Ribonucleic acid

RNAi RNA interference

Rpm Rotations per minute

σ (I) Error associated to intensity

S Soluble fraction

SSAO Semicarbazide-sensitive amine oxidase; EC 1.4.3.6

SDL-GSH S-D-lactoylglutathione

SDL-GspSH S-D-lactoylglutathionylspermidine

SDL-T(SH)2 S-D-lactoyltrypanothione

SDS Sodium dodecyl sulfate

SDS-PAGE Sodium dodecyl sulfate polyacrylamide gel electrophoresis


xxxx

Spd Spermidine; N-(3-aminopropyl)butane-1,4-diamine

T Total cell content

TFK Potassium phosphate buffer

TIM Triosephosphate isomerase; D-glyceraldehyde-3-phosphate ketol-isomerase,

EC 5.3.1.1

Tm Temperature midpoint of the protein-unfolding transition

TS2 Oxidised trypanothione; oxidised N1,N8-bis(glutathionyl)-spermidine

TR Trypanothione reductase; EC 1.6.4.8

Tris Trishydroxymethylaminomethane

T(SH)2 Reduced trypanothione; reduced N1,N8-bis(glutathionyl)-spermidine

U Enzymatic activity units

V Limiting rate

VM Mathews coefficient

% v/v Percentage expressed in volume/volume

% w/v Percentage expressed in weight/volume

WHO World Health Organization

CChhaapptteerr II GGeenneerraall IInnttrroodduuccttiioonn

CChhaapptteerr II

33

11.. LLeeiisshhmmaanniiaa aanndd LLeeiisshhmmaanniiaassiiss

Leishmaniasis is a group of diseases caused by flagellated protozoa from the

Trypanosomatidae family. Belonging to the Kinetoplastida Order, this family integrates several

protozoan parasites, affecting humans, animals, plants and insects. Besides Leishmaniasis, some of

the human diseases caused by these etiologic agents are the sleeping sickness and Chagas’ disease,

caused by the parasites Trypanosoma brucei and Trypanosoma cruzi, respectively (for review see

Castro & Tomás 2008). These parasites are also responsible for animal diseases, as reported for T.

Brucei brucei, T. congolense and T. vivax causing Nagana in cattle in Africa, and Leishmania species

leading to leishmaniasis in a range of animals from rodents (Shaw & Lainson 1968), to guinea-pig

(Bryceson et al. 1970) and dogs (Ciaramella et al. 1997).

Leishmania is one of the nine genera of the Trypanosomatidae, a classification based on their

morphological features. The other genera are: Trypanosoma, Blastocrithidia, Crithidia, Endotrypanum,

Herpetomonar, Leptomonas, Phytomonas and Sauroleishmania (Hoare 1966 as in Hoare 1967). Although

phylogenetically close, trypanosomatids share many biochemical traits. Mutual exclusivity can arise

even between two Leishmania species, making them surprisingly unique, as will be discussed along

this work.

Leishmania is transmitted by a female sandfly. The parasite’s name, and consequently the

disease, comes from William Leishman who in 1901 identified the organisms in the spleen of a

patient who had died from “dum-dum fever”. This disease was

characterised by general debility, irregular fever, severe

anaemia, muscular atrophy and excessive swelling of the spleen

(Leishmaniasis. A brief history of the disease, WHO 2010).

Another form of the disease, cutaneous leishmaniasis, seems to

have existed way back in history, as proved by representations

of skin lesions and facial deformities, evidence of cutaneous and

mucocutaneous forms of leishmaniasis, found on first century

pre-Inca potteries from Ecuador and Peru (Figure I.1.)

(Leishmaniasis. A brief history of the disease, WHO 2010). The

disease was often registered along history, as illustrated by the

15th and 16th centuries Inca texts mentioning the "valley

sickness" or "Andean sickness", as consisting on skin lesions,

Figure I.1. – Pre-Inca pottery, “Huaco Mochica”, showing leishmaniasis lesions in the nose and upper lip (as first suggested by Ashmead 1900; picture as in Altamirano-Enciso et al. 2003).

CChhaapptteerr II

44

common to the Andes seasonal agricultural workers. Later, the disease was also referred to as

"white leprosy". On the other hand, the presently defined visceral leishmaniasis, was described in

India by physicians who named it kala-azar (meaning "black fever") (Leishmaniasis. A brief history

of the disease, WHO 2010).

It is estimated that twelve million people in the World are affected by one of the diverse

forms leishmaniasis (cutaneous, visceral or muco-cutaneous). About two million new cases (500,000

of visceral leishmaniasis) appear every year in eighty-eight countries spread through Mediterranean

Europe, South America, Central Asia and Africa (data from Leishmaniasis. Burden of disease, WHO

2010). It is estimated that more than 350 million people are at risk (Leishmaniasis. Initiative for

Vaccine Research, WHO 2010). The organisms observed by Leishman, were only separated from

trypanosomes in 1903, by Captain Donovan (Donovan 1903 in Bailey & Bishop 1959). In the same

year, Major Ross associated these organisms to the kala-azar disease, naming them Leishmania

donovani and creating the Leishmania genus (Ross 1903 in Bailey & Bishop 1959). Altogether, there

are about twenty Leishmania species pathogenic for humans that are transmitted by thirty of the five

hundred known sandfly species (Figure I.2.) (Leishmaniasis. The disease and its epidemiology,

WHO 2010). According to the involved vector and the affected area of the World, Leishmania

parasites can be considered as New World or Old World (Figure

I.3.). In the first group, parasites are transported by a vector of

the Lutzomyia genus which, being a permissive vector, transports

a range of Leishmania species, including L. chagasi, L. braziliensis

or L. amazonensis (Sharma & Sarman Singh 2008). Old World

Leishmania are transported by a vector of the genus Phlebotomus.

Both Phlebotomus papatasi and P. sergenti are specific for L. major

and L. tropica, respectively. Although Phlebotomus argentipes is

more tolerant to L. donovani and L. infantum, it can also be the

vector for L. major, L. tropica and L. amazonensis (Sharma &

Sarman Singh 2008).

Figure I.2. Phlebotomine sandfly (Stanford University, USA, available from: www.stanford.edu/class/humbio103/ParaSites2003/Leishmania)

CChhaapptteerr II

55

Figure I.3. World distribution of visceral leishmaniasis (WHO 2003, available from:

www.who.int/leishmaniasis/leishmaniasis_maps/en/index.html). Incidence of leishmaniasis is shown to

affect eighty-eight countries, both in New World and Old World. A characteristic sandfly genus is responsible

for transportation of the parasite: Lutzomyia in the New World, and Phlebotomus in the Old World.

Leishmaniasis forms differ in severity and manifestations, and can be either zoonotic, as

when caused by L. infantum (Tesh 1995), or anthroponotic disease, as L. donovani (Rosypal et al.

2010). The different forms of leishmaniasis can be divided in two major groups: cutaneous

leishmaniasis and visceral leishmaniasis. In cutaneous leishmaniasis (also known as oriental sore,

Delhi ulcer, Aleppo, Delhi or Baghdad boil) the parasite replicates within macrophages located in

the dermis and the disease is manifested as skin lesions. In visceral leishmaniasis (also known as

kala-azar, black disease, dum-dum fever) the parasite replicates within the bone marrow, spleen or

liver and the disease is associated with fever, hepatosplenomegaly, anaemia and other life

threatening symptoms (Murray et al. 2005). The type of disease depends on the parasite species:

L. tropica (L. t. major, L. t. minor and L. ethiopica) and L. mexicana cause the cutaneous form of the

disease (Figure I.4a.), while L. donovani, L. infantum and L. chagasi lead to the visceral leishmaniasis

form (Figure I.4b.; Sharma & Sarman Singh 2008).

The third form of the disease, mucocutaneous leishmaniasis (espundia, Uta, Chiclero ulcer)

(Leishmaniasis. The disease and its epidemiology, WHO 2010; Sharma & Sarman Singh 2008), is

caused by, for example, L. (viannia) braziliensis and L. (viannia) guyanensis. In the case, the parasite

replicates within macrophages located in the naso-oropharyngeal mucosa (Sharma & Sarman Singh

2008).

(a) (b) (c)

CChhaapptteerr II

66

We can also consider another less common form of the disease, the diffuse cutaneous or

mucocutaneous leishmaniasis, caused primarily by L. mexicana, L. ethiopica and L. donovani

(Leishmaniasis. The disease and its epidemiology, WHO 2010; Sharma & Sarman Singh 2008),

characterised by non-ulcerating nodules over the entire body (Figure I.4c.). This leishmaniasis form

commonly appears as a relapse manifested by skin lesions, after leishmania symptoms attenuation

(especially when in the visceral form). In this case, the syndrome is called kala-azar dermal

leishmaniasis and attributes to the patient a reservoir host role (Stark et al. 2006).

Figure I.4. Forms of leishmaniasis. (a) Child showing a cutaneous leishmaniasis lesion on the face (The

Welcome Trust 2000, Leishmaniasis, Topics in International Health). (b) Profile view of a child suffering from

visceral leishmaniasis, exhibiting splenomegaly, distended abdomen and severe muscle wasting (The

Welcome Trust 2000, Leishmaniasis, Topics in International Health). (c) Girl with diffuse mucocutaneous

leishmaniasis of the face, responding to treatment (WHO/TDR/El-Hassan).

Leishmaniasis gain dramatic relevance in areas where occurs co-infection with HIV

(Montalban et al. 1990). This is due to the development of atypical symptoms by individuals with

immune system deficiencies, apart from their higher susceptibility to the disease (Angarano et al.

1998). Although often neglected, in 1990, visceral leishmaniasis was estimated to be one of the most

frequent parasitic disease co-infecting AIDS patients, in Spain (Montalban et al. 1990).

Leishmaniasis can be lethal, especially when in the visceral form. There is currently no

vaccine against these diseases. Both visceral and cutaneous leishmaniasis are traditionally treated

with pentavalent antimonials, which are toxic and decreasing their efficiency due to emerging

trypanosomatid resistance (Sundar 2001). The alternative drugs, such as Amphotericin B,

Pentamine and Miltefosine have low efficiencies and high costs. These drawbacks, together with the

emergence of resistant trypanosomatids, demand the investigation of these parasites’ metabolism

targeting new therapeutic approaches.

CChhaapptteerr II

77

11..11.. LLeeiisshhmmaanniiaa iinnffaannttuumm lliiffee ccyyccllee

L. infantum life cycle alternates between phagolysosomes of the vertebrate host (e.g. human)

macrophages and the alimentary tract of an insect vector (sandfly) (Figure I.5.). Only the female

sandfly transmits the parasite, as it requires blood to obtain the required proteins for the eggs

development (Leishmaniasis. The disease and its epidemiology, WHO 2010). In the sandfly, the

parasite grows for four to twenty-five days as flagellated extracellular promastigotes

(Leishmaniasis. The disease and its epidemiology, WHO 2010), asexually reproducing (by binary

fission) in the sandfly midgut (Hepburn et al. 2003). Requiring organic matter, heat and humidity to

the larvae survival, the female sandfly lays its eggs in places as the bark of old trees, ruined

buildings, animal shelters or household rubbish (Sharma & Singh 2008).

Figure I.5. Leishmania spp. life cycle. Promastigotes reproduce in the vector midgut. When injected into the

vertebrate host, they are phagocytised by macrophages, where they shift their morphologic form to

amastigotes. At the macrophages’ death, amastigotes are released to infect other cells (Kamhawi et al., 2004).

CChhaapptteerr II

88

Figure I.6. L. infantum parasite forms. (a) Promastigote (amplification 1000x; picture taken by R. L. Jacobson 1996). (b) Several amastigotes in a macrophage cytoplasm (Joiner et al. 2005).

Promastigotes (Figure I.6.) are introduced into

the host during a blood meal taken by the sandfly,

usually in the evening and in a radius of several

hundred meters from its habitat (Sharma & Singh

2008). The parasites are subsequently phagocytosed by

macrophages in the skin, liver, spleen and bone

marrow and suffer a metamorphosis, where they

change their morphological form to intracellular

amastigotes (Herwaldt et al. 1999). Amastigotes

(Figure I.6.), a parasite form without flagella and smaller than promastigotes, reproduce in the

macrophages, being freed at their death to infect other cells (Kamhawi et al., 2004).

Studies on Leishmania differentiation, comparing promastigote and amastigote gene and

protein expression, revealed that both parasite forms have reached a high level of adaptation to

their very distinct environments (Rosenzweig et al. 2008). Respiration, catabolism of energy

substrates and synthesis of macromolecules are explicit example processes of the latter adaptation.

In amastigotes, these metabolic processes occur in an acidic pH, while in promastigotes the optimal

pH is neutral (Rosenzweig et al. 2008), similar to the parasite´s respective environmental pH

(Opperdoes & Coombs 2007). Another striking aspect is the different activation extent of

fundamental pathways: glycolysis, more active in promastigotes; the fatty acid oxidation, more

active in amastigotes (Opperdoes & Coombs 2007, Rosenzweig et al. 2008); or gluconeogenesis,

essential for the amastigotes infectiveness and proliferation in the macrophages and not relevant in

promastigotes (Naderer et al. 2006, Rosenzweig et al. 2008). On the other hand, the identification of

stage-specific genes supports the adjustment of each of the

Leishmania forms to its environment at a genetic level

(Zhang et al. 1996; Bates 1993; Wiese 1998; Bente et al. 2003;

Akopyants et al. 2004; Almeida et al. 2004; Nugent et al. 2004;

Walker 2006; Huynh et al. 2006; Rosenzweig et al. 2008).

Although different characteristics for promastigotes

and amastigotes are presently known, as mentioned, the

molecular mechanisms underlying the reason for and the

morphological change are not completely understood.

However, differentiation in L. donovani, the most similar

Figure I.7. Promastigotes in aggregation stage (8h). Amplification 40x. Picture courtesy of Renzo Perales.

CChhaapptteerr II

99

Leishmania species to L. infantum, was revealed to be a regulated process as far as it is accompanied

by changes in gene and protein expression (Saar et al. 1998; Barak et al. 2005; Saxena et al. 2007;

Rosenzweig et al. 2008). It was inferred that differentiation had four main stages (as described in

Rosenzweig et al. 2008): i) 0–4 h, differentiation signal is received by promastigotes; ii) 5–9 h,

promastigotes slow down their motion and aggregate (Figure I.7.); iii) 10–24 h, promastigotes

undergo morphological change into amastigotes; and iv) 25–120 h, amastigotes maturation. At the

beginning of the differentiation process almost all gene transcripts are down-regulated, while

transcripts specific for amastigotes are up-regulated in the fourth stage described (Rosenzweig et al.

2008). However, changes in mRNA do not to dependably affect proteins amounts. Regulation of

protein activity seems to occur mainly by posttranscriptional modifications (Clayton et al. 2002).

Furthermore, Besteiro and co-workers investigated the protein remodelling by autophagy as an

essential process for promastigote-to-amastigote differentiation (Besteiro et al. 2006, Rosenzweig et

al. 2008).

11..22.. TTrryyppaannoossoommaattiiddss BBiioollooggiiccaall UUnniiqquueenneessss

Being invasive parasites of host cells, trypanosomatids need to be adapted not only to both

extra and intracellular environments, but also to the abrupt change they undergo between the two

very different and extreme conditions. Consequently, these organisms developed unique

characteristics along evolution, some of the most relevant being the kinetoplast, the glycosome and

the thiol trypanothione. These trypanosomatid-specific features inevitably attract the

parasitologists’ attention towards the identification of new therapeutic targets.

1.2.1. The Kinetoplast

The Kinetoplast, a mitochondrial organelle, located near the basal body, encloses the

network formed by the two forms of kDNA (kinetoplast DNA): the maxicircle and the minicircle.

The former includes large molecules at low copy number and correspond to the conventional

mitochondrial DNA, while the latter comprises small molecules in high copy number, functionally

related to the editing process of maxicircle kDNA (Simpson 1987; Sturm and Simpson 1990,

Brandão 2000). Kinetoplast features in general, and minicircles in particular, are used for

trypanosomatid diagnosis (Morel et al. 1980; Sturm et al. 1989; Degrave et al. 1994; Fernandes et al.

1996).

CChhaapptteerr II

1100

1.2.2. The Glycosome

Another important trypanosomatids characteristic is the unique sequestering of glycolysis

and other pathways of carbohydrate metabolism in specialised organelles, designated glycosomes

(Opperdoes & Borst, 1977). Glycosomes are similar to peroxisomes for having an outer

phospholipidic layer, not enclosing DNA and including a matrix of proteins which are synthesised

in the cytosol and then imported. However, unlike the peroxisomes, the glycosomes are essential

organelles (Furuya et al. 2002).

Figure I.8. Glycolysis and hypothetical glyoxalase pathway location in Leishmania. Solid lines represent

reactions catalysed by a single enzyme; dashed lines represent multiple sequential reactions. Fructose-1,6-BP,

fructose-1,6-bisphosphate; GAP, glyceraldehyde 3-phosphate; 1,3-BPGA, 1,3-biphosphoglycerate; 3-PGA, 3-

phosphoglycerate; DHAP, dihydroxyacetone phosphate; Glycerol-3-P, glycerol 3-phosphate; Pi, inorganic

phosphate; GLO1, glyoxalase I; GLO2, glyoxalase II. Adapted from (Opperdoes & Coombs 2007).

The vital importance of the processes occuring in the glycosome has led to the notion that

this metabolic compartmentation itself might be essential as well. In 1997, Bakker and co-workers

discovered that the glycolytic flux could only be controlled if a part of the pathway was considered

to occur inside the glycosome (Bakker et al. 1997, Myler & Fasel 2008). Enclosed by the glycosomal

CChhaapptteerr II

1111

membrane, impermeable to metabolites and co-enzymes (Visser et al. 1981; Opperdoes, 1987;

Clayton and Michels, 1996; Blattner et al. 1998), are the first seven of the nine glycolytic enzymes

which convert D-glucose to 3-phosphoglycerate, being present in the cytoplasm only the last three

enzymes of this pathway (Opperdoes and Borst, 1977; Opperdoes, 1987; Hannaert and Michels,

1994; Hannaert et al. 2003; Moyersoen et al. 2004) (Figure I.8.). The glycosome and the enclosed

metabolic processes, including or not the methylglyoxal catabolism (Figure I.8.), are nowadays

considered relevant candidates for drug targets (Myler & Fasel 2008).

1.2.3. Trypanothione

Efficient antioxidant systems are an adaptation to the hostile environment faced by

trypanosomatids when invading the host, where oxidants as peroxynitrite, hypochlorite, and H2O2

are a constant threat (Jager & Flohé 2006). These systems include around twenty thiol-dependent

proteins (Krauth-Siegel et al. 2005) and the unique thiol trypanothione (T(SH)2, N1,N8-

bis(glutathionyl)spermidine) (Fairlamb et al. 1985), a conjugate of two molecules of glutathione

(GSH) with the polyamine spermidine.

Functionally, trypanothione replaces glutathione in trypanosomatids, being the glutathione-

dependent enzymes replaced by functionally analogue enzymes using trypanothione (Muller et al.

2003). Like GSH, T(SH)2 is reduced from its oxidised form by a NADPH-dependent trypanothione

reductase (EC 1.6.4.8, TR; Shames et al. 1986). Producing trypanothione, these organisms’ specific

oxidation-reduction mechanism is based in the trypanothione/ trypanothione reductase conjugate

(Fairlamb et al. 1985), replacing the pair glutathione/ glutathione reductase (Schmidt and Krauth-

Siegel 2003).

In trypanosomatids, as in other organisms, glutathione is synthesised by consecutive activity

of the enzymes γ-glutamylcysteine synthetase (EC 6.3.2.2; Hibi et al. 2004) and glutathione

synthetase (EC 6.3.2.3; Fyfe et al. 2010). For spermidine, however, the biosynthetic pathway diverges

according to the trypanosomatid species (Bacchi et al. 2007).

T(SH)2 is synthesised by the conjugation of spermidine with two glutathione molecules

(Figure I.9.) (Flohe et al. 1999; Oza et al. 2005). Its synthesis begins with N1 or N8-monoglutathionyl-

spermidine formation, catalysed by the glutathionyl-spermidine sinthetase (γ-L-glutamil-L-

cysteinil-glycine: spermidine ligase, EC 6.3.1.8). Trypanothione synthetase (glutathionyl-

CChhaapptteerr II

1122

spermidine: glutathione ligase, EC 6.3.1.9) catalyses the monoglutathionyl-spermidine ligation to a

second GSH molecule, forming T(SH)2. Trypanothione formation can be inhibited at the

glutathionyl-spermidine level, by compounds similar to spermidine or glutathione (Henderson et al.

1990; Verbruggen et al. 1996). In L. major, trypanothione synthetase can catalyse both T(SH)2

formation steps (Oza et al. 2005).

Figure I.9. Synthesis reactions of glutathionyl-spermidine and trypanothione, from glutathione and

spermidine (Oza et al. 2002).

As a reducing agent, T(SH)2 shows an oxidation-reduction potential of -242 mV, similar to

GSH (-230 mV). However, being a dithiol, T(SH)2 has two reducing disulfide groups available for

reaction, which is equivalent to two GSH molecules. Hence, it is kinetically more favourable as a

reductant than GSH (Gilbert 1990; Krauth-Siegel et al. 2005). On the other hand, these thiols differ in

their pKa value. Compared to the GSH pKa value of 8.7-9.2, T(SH)2 has a lower pKa (7.4) (Moutiez et

al. 1994), probably due to the nitrogen atom positively charged in the spermidine bridge (Krauth-

Siegel et al. 2005). Moreover, high T(SH)2 reactivity, when compared to GSH, arises in part from its

pKa value overlapping the pH in the trypanosomatids environment (Fraser-L’Hostis et al. 1997), as

CChhaapptteerr II

1133

the velocity second-order constants are optimal when the thiol pKa matches the media solution pH

(Gilbert 1990; Krauth-Siegel et al. 2005).

Trypanothione participates in a wide range of reactions, including reduction of

dihydroascorbate (Krauth-Siegel & Ludemann 1996), hydroperoxides (pair trypanothione/

tryparedooxin) (Flohé et al. 1999; Flohé et al. 2002) and ribonucleotides (Dormeyer et al. 2001). This

thiol is also involved in the elimination of 2-oxoaldehydes, such as methylglyoxal (Irsch & Krauth-

Siegel 2004; Sousa Silva et al. 2005), a toxic by-product of glycolysis formed in all living cells.

22.. MMeetthhyyllggllyyooxxaall bbiioocchheemmiissttrryy

The first characterization of methylglyoxal’s catabolic enzymes dates back to 1913, with the

identification of a system enabling the conversion of α-oxoaldehydes to α-hidroxyacids, presently

recognised as the glyoxalase system (Dakin & Dudley, 1913a; Dakin & Dudley, 1913b; Neuberg,

1913). Since 1928, methylglyoxal was considered as a key glycolytic intermediate (Neuberg & Kobel,

1928). Twenty years later this perception was abandoned when glutathione was identified as an

indispensable co-factor of the glyoxalase system, keeping in mind that the glycolytic pathway does

not use glutathione (Lohman 1932). Furthermore, D-lactate was found to be this pathway’s product,

instead of the L-lactate glutathione-independent production in muscle cells (Racker 1951). Even

when methylglyoxal was dismissed as a metabolic intermediate, its function and role arouse

scientific community’s interest concerning glyoxalase functions, with methylglyoxal and D-lactate

being detected in a wide range of organisms (Hopkins &

Morgan 1945). The hypothesis that methylglyoxal and the

glyoxalase pathway could be involved in controlling cell

division and cancerogenesis (Szent-Gyorgyi, 1965) enthused

scientific investigation in this field. Presently, we know that

methylglyoxal is present in all cells as a very reactive but

unavoidable product of secondary metabolism.

Methylglyoxal’s reactivity arises from the presence of

two highly reactive carbonyl groups (Figure I.10.). Within biological molecules, amino groups are

the most prevalent nucleophile groups. Being part of proteins, nucleic acids and basic

phospholipids they might be modified by methylglyoxal, justifying its mutagenic and toxic nature.

Figure I.10. Methylglyoxal. (Carbons in grey, hydrogens in white and oxygen atoms in red.)

CChhaapptteerr II

1144

Due to its ability to glycate DNA, leading to genomic integrity loss, methylglyoxal is reported as a

mutagenic and genotoxic agent (Migliore et al. 1990, Rahman et al. 1990; Pischetsrieder et al. 1999).

One of the most severe methylglyoxal effects is the glycation of proteins and basic phospholipids,

leading to the formation of advanced glycation end-products (AGE) (Bucala et al. 1993). In proteins,

methylglyoxal’s main targets are arginine and lysine residues, and the derived products are named

MAGE (methylglyoxal-derived advanced glycation end-products) (Gomes et al. 2005a). Moreover,

methylglyoxal is accountable for protein cross-linking. For example, from the reaction of

methylglyoxal with lysine residues a specific AGE can be formed, MOLD (methylglyoxal-lysine

dimers), an AGE present in lens proteins, as well as in diabetic patients (Nagaraj et al. 1996; Frye et

al. 1998).

Methylglyoxal effects have not always been described as hazardous. Indeed, an anti-tumour

activity in vivo was reported (Apple & Greenverg 1967; Conroy 1978; Dianzani 1978), although no

clinical application has been developed for the lack of ability to select the compound’s toxicity.

Recent studies revealed that methylglyoxal enhanced the chaperone function of α-crystallin and

inhibits glycation-mediated pentosidine synthesis that would cause loss of α-crystallin chaperone

function (Puttaiah et al. 2007). Also, it was shown that in yeast, glycation elicits a cellular response

involving heat shock proteins from the refolding chaperone pathway, being the Hsp26p activated

by glycation (Gomes et al. 2008).

22..11.. MMeetthhyyllggllyyooxxaall bbiioossyynntthheessiiss

Methylglyoxal may be synthesised through either enzymatic or non-enzymatic pathways,

depending on the organism (Figure I.11.). In bacteria, it can be produced enzymatically through the

enzyme methylglyoxal synthase (EC 4.2.3.3; Cooper & Anderson 1970). Methylglyoxal can also be

formed from enzymatic reactions involved in the L-threonine metabolism (Ray & Ray 1987; Lyles &

Chalmers 1992); or by the catabolism of ketone bodies, acetoacetate and acetone (Casazza et al. 1984;

Koop & Casazza 1985; Aleksandrovskii 1992). Non-enzymatically, it can be formed through

lipoperoxidation reactions (Esterbauer et al. 1982) or as a by-product of glycolysis from the β-

elimination of phosphate from the triose phosphates dihydroxyacetone phosphate (DHAP) and

glyceraldehyde 3-phosphate (GAP) (Richard 1993). These methylglyoxal biosynthetic systems will

be described in detail.

CChhaapptteerr II

1155

Figure I.11. Main routes of methylglyoxal production. This toxic compound is produced both enzymatically (dark-green arrows), from L-threonine and ketone bodies metabolism (Casazza et al. 1984; Lyles & Chalmers 1992); and non enzymatically (light-green arrows), from lipoperoxidation or as a by-product of glycolysis, by β-elimination of the phosphate group from dihydroxyacetone phosphate (DHAP) and glyceraldehyde 3-phosphate (GAP) (Richard 1993). Methylglyoxal synthase is only present in prokaryotes (Hopper & Cooper 1971; Hopper & Cooper 1972). Adapted from Ricardo Gomes, PhD Thesis 2008.

Methylglyoxal synthase (glycerine-phosphate phosphor-lyase, EC 4.2.3.3), first purified from

Escherichia coli and only detected in prokaryotes, catalyses the triose phosphate dihydroxyacetone

phosphate (DHAP) conversion into methylglyoxal. In bacteria, methylglyoxal formation also

constitutes a bypass to glycolysis, as the D-lactate produced through the glyoxalase pathway might

be converted to pyruvate by the enzyme D-lactate dehydrogenase (D-lactate: NAD+ oxidoreductase,

EC 1.1.1.28) (Cooper & Anderson 1970). Inorganic phosphate is a common methylglyoxal synthase

allosteric inhibitor. If this compound is present in high concentrations, glycolysis tends occur

through glyceraldehyde 3-phosphate dehydrogenase (GAPDH, D-glyceraldehyde-3-

phosphate:NAD+ oxidoreductase (phosphorylating), EC 1.2.1.12), whose activity is inorganic

phosphate dependent (Hopper & Cooper 1971; Hopper & Cooper 1972). Under conditions of

phosphate starvation, methylglyoxal synthase activity is increased and methylglyoxal arises from

DHAP. This is a regulation mechanism which allows an effective use of inorganic phosphate by

glycolysis, while keeping the production of pyruvate (Cooper 1984). Hence, a glycolysis regulation

role in bacteria was attributed to methylglyoxal synthase, based on intracellular phosphate

availability (Cooper 1984).

CChhaapptteerr II

1166

Another methylglyoxal biosynthetic pathway is the L-threonine catabolism, via

aminoacetone catalysed by the enzyme amine oxidase (SSAO, amine:oxygen oxidoreductase,

EC.1.4.3.6) (Lyles & Chalmers 1992). This pathway’s main role is to enzymatically produce glycine

and acetyl-CoA, with aminoacetone as an intermediate. In the presence of low levels of CoA (e.g.

diabetic ketoacidosis, where most CoA is in the form of acetyl-CoA), the production of

aminoacetone from threonine increases, enhancing methylglyoxal production through SSAO

activity (Tressel et al. 1986).

Methylglyoxal is also generated by the oxidation (enzymatic or non-enzymatic) of

acetoacetate by myeloperoxidase (donor:hydrogen-peroxide oxidoreductase, EC. 1.11.1.7)

(Aleksandrovskii 1992; Kalapos 1999), and by acetone enzymatic oxidation by cytochrome P450

IIE1 (reduced-flavoprotein:oxygen oxidoreductase, EC 1.14.14.1) in a NADPH-dependent two-step

reaction, with acetol as intermediate (Casazza et al. 1984; Koop & Casazza 1985). Ketone bodies

might provide a significant supply of methylglyoxal when under pathological conditions like

ketosis and diabetic ketoacidosis (Turk et al. 2006).

In the main pathway for methylglyoxal biosynthesis, it arises as a by-product of glycolysis.

Methylglyoxal is formed non-enzymatically from the 1,2-enediolate, a common intermediate to

DHAP and GAP, through the irreversible β-elimination of the phosphate group (Richard 1984;

Figure I.11.). At physiological pH, phosphorylated trioses are much more reactive towards the loss

of α-carbonyl protons than the corresponding triose, producing an enediolate phosphate

intermediate, which has a low energy barrier for the phosphate group expulsion. Hence, it is the

substrate deprotonation to an enediolate phosphate intermediate followed by the phosphate group

cleavage that lead to the formation of methylglyoxal (Richard 1993). Triose phosphate isomerase

(TIM, D-glyceraldehyde-3-phosphate aldose-ketose-isomerase, EC. 5.3.1.1) ensures the required

stabilization of the enzyme-bound enediolate phosphate intermediate, reducing substrate

degradation into methylglyoxal, by making the protonation of the enzyme-bound enediolate

phosphate intermediate faster than the phosphate group expulsion (Richard 1991). However, this

non-enzymatic formation of methylglyoxal is unavoidable, with a formation rate estimated to be 0.1

mM per day (Richard 1993).

The overall methylglyoxal formation rate depends on the organism, tissue, cell, metabolism

and physiological conditions. Nevertheless, it seems to be related to the glycolytic flux, confirming

that the glycolytic bypass is the main methylglyoxal biosynthesis pathway (Fareleira et al. 1997;

Martins et al. 2001; Altenberg & Greulich 2004).

CChhaapptteerr II

1177

2.1.1 Methylglyoxal biosynthesis in trypanosomatids

In L. infantum, methylglyoxal seems to be formed non-enzymatically, as suggested by its low

concentration in the parasite and the absence of a methylglyoxal synthase gene and activity (Sousa

Silva et al. 2005). This gene seems to be also absent from other trypanosomatids, including T. brucei,

T. cruzi and L. major (Opperdoes & Michels 2008). There are no available studies for the other non-

enzymatic pathways for methylglyoxal biosynthesis in trypanosomatids. Hence, its formation is

commonly considered to occur through the spontaneous phosphate elimination from glycolytic

triose phosphates (Sousa Silva et al. 2005; Opperdoes & Michels 2008).

22..22.. MMeetthhyyllggllyyooxxaall ccaattaabboolliissmm

Methylglyoxal has shown to be a mutagenic, toxic and inhibitor of glycolytic enzymes

(Leocini et al. 1980; Westwood et al. 1997; Lo et al. 1994; Oya et al. 1999). Furthermore, it causes cell

death, when at high concentrations, and cell growth delay at sublethal concentrations (Kalapos

1999; Okado et al. 1996; Ponces Freire et al. 2003; Maeta et al. 2005b). Hence, organisms, unable to

avoid this compound biosynthesis, developed defensive enzymatic mechanisms to catabolise

methylglyoxal.

The glyoxalase system, involving the glyoxalase I (lactoylglutathione lyase; EC 4.4.1.5,

GLO1) and the glyoxalase II (hydroxyacylglutathione hydrolase; EC 3.1.2.6, GLO2) is the main

catabolic pathway for this α-oxoaldehyde. However, other pathways known to lead to

methylglyoxal degradation are: the enzyme aldose reductase (alditol:NAD(P)+ 1-oxidoreductase,

EC.1.1.1.21.) (Vander Jagt et al. 1992); some oxide-reductases and dehydrogenases, taking advantage

of methylglyoxal ability to be oxidised or reduced (Kalapos 1999); α-oxoaldehyde dehydrogenase

(2-oxoaldehyde:NAD(P)+ 2-oxidoreductase, EC. 1.2.1.23) (Monder 1967); aldehyde dehydrogenase

(aldehyde:NAD+ oxidoreductase, EC.1.2.1.3) (Izaguirre et al. 1998); methylglyoxal reductase (D-

lactaldehyde:NAD+ oxidoreductase, EC. 1.1.1.78) (Ray & Ray 1984); and pyruvate dehydrogenase

(pyruvate: dihydrolipoyllysine-residue acetyltransferase-lipoyllysine 2-oxidoreductase, EC. 1.2.4.1)

(Baggetto & Lehninger 1987). Among these enzymes, the glyoxalases and aldose reductase are

considered the main methylglyoxal catabolic systems.

CChhaapptteerr II

1188

2.2.1. The glyoxalase pathway

The glyoxalase, named for the belief of being a single enzyme, was discovered in 1913 by

two different simultaneous studies, which identified the conversion of methylglyoxal to lactic acid

in animal tissues (Neuberg 1913; Dakin & Dudley 1913a; Dakin & Dudley 1913b). In 1951, Racker

showed that in fact two enzymes, glyoxalase I and glyoxalase II, are involved in the latter

conversion (Racker 1951).

The glyoxalase pathway has been considered the main catabolic system of 2-oxoaldehydes,

as methylglyoxal (Thornalley 1990), a compound produced in every organism (Figure I.11.). It

comprises the glyoxalase I (S-D-lactoylglutathione methylglyoxal-lyase, EC 4.4.1.5) and the

glyoxalase II (S-2-hydroxyacylglutathione hydrolase, EC 3.1.2.6) that convert methylglyoxal to D-

lactate using reduced glutathione as a specific co-factor (Racker 1951; Thornalley 1990). In this

system, methylglyoxal reacts non-enzymatically with glutathione, forming an hemithioacetal

(Vander Jagt et al. 1975; Thornalley 1990; Thornalley 1993). This compound is then isomerised by

glyoxalase I to the thiolester, S-D-lactoylglutathione (SDL-GSH). This thiolester is then hydrolysed

to D-lactate by glyoxalase II (hydroxyacylglutathione hydrolase EC 3.1.2.6), regenerating GSH

(Thornalley 1990; Vander Jagt 1993a).

Although it is clear that the glyoxalase pathway’s main role is the methylglyoxal

detoxification, many studies suggested a connection between the glyoxalase system and other

physiologic processes. As an example, it was reported that immature, proliferating cells and tissues

have a high glyoxalase I activity but a low glyoxalase II activity, whereas in mature differentiated

cells the reverse is observed (Principato et al. 1982), though no causal relationship between the

glyoxalase pathway and cell proliferation was reported. Also, it is known that S. cerevisiae mutants

for glyoxalase I and glyoxalase II are viable, discarding any association between the glyoxalase

system activity and cell survival, except when cells are challenged with methylglyoxal (Bito et al.

1997; Inoue & Kimura 1996). These assumptions support the interest that has been drawn to this

pathway, especially on the association between methylglyoxal, the derived AGE and the

pathogenesis of diabetic complications and neurodegenerative diseases (Thornalley 1993;

Thornalley 1996).

CChhaapptteerr II

1199

Figure I.12. Methylglyoxal catabolism by the glyoxalase pathway and aldose reductase. Methylglyoxal is

formed non-enzymatically (n.e.) from glyceraldehyde-phosphate (GAP) or dihydroxyacetone (DHAP)

phosphate and is further catabolised. In the glyoxalase pathway, methylglyoxal reacts non-enzymatically with

reduced glutathione (GSH), forming an hemithioacetal (HTA). This hemithioacetal is then isomerised by

glyoxalase I (GLO1), forming the thiolester S-D-lactoylglutathione, which is subsequently hydrolysed to D-

lactate by glyoxalase II (GLO2), regenerating GSH. Aldose reductase catabolises methylglyoxal to 1,2-

propanediol in a two-steps NADPH-dependent reaction. Adapted from (Vander Jagt & Hunsaker 2003;

Gomes et al. 2005b).

2.2.1.1. Glyoxalase I

Glyoxalase I (GLO1) is present in most organisms, either prokaryotes or eukaryotes, and it

has been characterised at the molecular and kinetic levels in many of them, including mammalian

tissues (Han et al. 1976; Aronsson & Mannervik 1977; Marmstal & Mannervik 1978; Baskaran &

Balasubramanian 1987), plants (Deswal & Sopory 1991; Deswal & Sopory 1999; Norton et al. 1990),

E. coli (Clugston et al. 1998), S. cerevisiae (Marmstal et al. 1979), L. infantum (Vickers et al. 2004; Sousa

Silva et al. 2005) and Plasmodium falciparum (Deponte et al. 2007).

As mentioned, GLO1 catalyses the isomerisation of a hemithioacetal to the thiolester S-D-

lactoylglutathione. This reaction’s mechanism understanding is hampered by the non-enzymatic

CChhaapptteerr II

2200

hemithioacetal formation from methylglyoxal and GSH, implying the simultaneous presence of the

three species in equilibrium. Being the dissociation constant for hemithioacetal 3x10-3 M, in the

range of intracellular glutathione concentration, hemithioacetal concentration is noticeably

dependent on GSH concentration (Vander Jagt 1993a). Consequently, under physiological

conditions such as oxidative stress, where GSH concentration is decreased, the glyoxalase pathway

activity may be diminished (Abordo et al. 1999).

GLO1 was kinetically characterised in several organisms. In situ studies of the glyoxalase

pathway in yeast revealed a Km of 0.53 mM and a V of 0.53 x 10-3 mM.s-1 for glyoxalase I towards the

glutathione-derived hemithioacetal (Martins et al. 2001b). Purified GLO1 from S. cerevisiae has an

apparent Km of 0.41 mM (similar to the value obtained from in situ studies) and a kcat/Km of 18.9x103

mM-1.s-1 for the same substrate (Inoue & Kimura 1996). In this organism, GLO1 has two active sites,

most likely catalysing the same isomerization reaction, due to their high structural similarity

(Frickel et al. 2001). Plasmodium falciparum also has a glyoxalase I with two functional active sites,

having similar catalytic activities but different substrate affinities (Deponte et al. 2007). The apparent

Km values for this enzyme, using the hemithioacetal substrate, are 0.016 mM and 0.103 mM, for both

active sites. The recombinant human GLO1 showed a Km of 0.071 mM towards the glutathione-

derived hemithioacetal and a kcat/Km of 0.22x103 mM-1.s-1 (Ridderstrom & Mannervik 1996). Another

isoform of the human enzyme was identified, differing in position 111 with a glutamate instead of

an alanine, showing glyoxalase I activity but different electrophoretic properties (Kim et al. 1995).

Glyoxalase I was also identified in trypanosomatids. GLO1 activity was detected in L. infantum

protein extracts, with a Km of 0.240 mM towards the trypanothione-derived hemithioacetal (Sousa

Silva et al. 2005). This enzyme was also able to isomerise methylglyoxal-glutathione hemithioacetal

with lower affinity (Km of 1.85 mM). The recombinant L. major GLO1 showed similar kinetic

parameters to the human enzyme (Km of 0.032 mM and kcat/Km of 25x103 mM-1.s-1) although towards

the trypanothione-derived hemithioacetal (Vickers et al. 2004). Similarly, the recombinant L.

donovani GLO1 reacts with the hemithioacetal derived from trypanothione with a Km of 0.028 mM

and a specific activity of 5.60x103 nmol.s-1.mg-1 protein (Padmanabhan et al. 2005). This enzyme also

prefers this substrate relatively to the hemithioacetal derived from glutathione (Padmanabhan et al.

2005). In the same study, L. donovani GLO1 was inhibited by the classical human and yeast GLO1

inhibitors: purpurogallin, flavone, quercetin and lapachol.

Structural information of glyoxalase I enzyme is also available through the X-ray structures

from various organisms, including E. coli (EcGLO1; PDB entries 1F9Z, 1FA5, 1FA6, 1FA7, 1FA8 (He

CChhaapptteerr II

2211

et al., 2000)), H. sapiens (HsGLO1; PDB entries 1FRO, 1QIN, 1QIP, 1BH5 (Cameron et al., 1997, 1999;

Ridderstrom et al., 1998)) and L. major (LmGLO1; PDB entry 2C21 (Ariza et al., 2006)). Almost all

eukaryotic and prokaryotic glyoxalase I proteins characterised so far are homodimeric molecules

(Cameron et al. 1997; Sukdeo et al. 2004), with each monomer composed of two βαβββ domains and

the residues from each subunit contributing to the active site pocket. However, in yeast (Thornalley

et al. 2003) and plasmodia (Iozef et al. 2003) the enzyme is monomeric.

Glyoxalase I is a metalloprotein, typically with zinc or nickel at the active site. Zn2+-

dependent GLO1 comprise eukaryotic enzymes, as those from H. sapiens and S. cerevisiae (Aronsson

et al. 1978; Ridderstrom et al. 1998). However, nickel-dependent enzymes have been characterised in

several prokaryotes, such as the Ni2+-dependent GLO1 from E. coli, Pseudomonas aeruginosa, Yersinia

pestis and Neisseria meningitides (Sukdeo et al. 2004). Nevertheless, Pseudomonas putida (prokaryotic)

GLO1 is Zn2+-dependent (Saint-Jean et al. 1998) and L. major GLO1 (eukaryotic) was reported to

contain divalent nickel (Ariza et al. 2006). Hence, this classification of glyoxalase I based on the

metal type is not clear.

2.2.1.2. Glyoxalase II

Glyoxalase II (GLO2), a β-lactamase fold-containing enzyme, was purified and characterised

from several mammals (Uotila 1973; Oray & Norton 1980; Ball & Vander Jagt 1981; Principato et al.

1984; Allen et al. 1993), plants (Norton et al. 1990; Maiti et al. 1997), yeast (Talesa et al. 1990b) and L.

infantum (Sousa Silva et al. 2005; Sousa Silva et al. 2008). In some organisms, the metalloprotein

presents a cytosolic and a mitochondrial isoform (Talesa et al. 1988; Talesa et al. 1989; Talesa et al.

1990; Bito et al. 1997; Maiti et al. 1997; Cordell et al. 2004). In mammals, they are both coded by a

single gene and produced by alternative translation initiation of the gene transcripts (Cordell et al.

2004). However, in yeast, cytosolic GLO2 and mitochondrial GLO4 are coded by different genes

(Bito et al. 1997), resulting in proteins with 59.1 % identity. Being mitochondrial GLO1 absent from

rat (Talesa et al. 1988; Talesa et al. 1989) and yeast (Bito et al. 1997), it was suggested that

mitochondrial GLO2 hydrolyses the S-D-lactoylglutathione diffusing or being transported into this

cell compartment. This could constitute a mitochondrial GSH source (Scire et al. 2000), although

GSH import was described (Martensson et al. 1990). In yeast, GLO4 could also catabolise other GSH

thiolesters in the mitochondria (Thornalley 1990; Thornalley 1993; Vander Jagt 1993a).

CChhaapptteerr II

2222

Glyoxalase II kinetic analysis was performed in several organisms. In situ measured activity

of yeast GLO2 revealed a Km of 0.32 mM and a V of 0.0172x10-3 mM.s-1 using S-D-lactoylglutathione

as substrate (Martins et al. 2001b). This substrate was hydrolysed by the recombinant purified GLO2

with a Km of 0.112 mM and by the recombinant purified mitochondrial GLO4 with a Km of 0.072

mM (Bito et al. 1999). The kinetic parameters for the recombinant human enzyme were a Km of 0.187

mM and a kcat of 780 s-1 for the glutathione-derived thiolester (Ridderstrom et al. 1996). In

trypanosomatids, the glyoxalase II reacts with thiolesters derived from trypanothione (Irsch &

Krauth-Siegel 2004; Sousa Silva et al. 2005). GLO2 activity was detected in total protein extracts from

L. infantum (Sousa Silva et al. 2005). This enzyme hydrolysed the S-D-lactoyltrypanothione with a Km

of 0.098 mM and could not react with the glutathione-derived thiolester. The recombinant L.

donovani GLO2 revealed a Km of 0.039 mM using S-D-lactoyltrypanothione as a substrate

(Padmanabhan et al. 2006) but had almost no activity in presence of S-D-lactoylglutathione

(Padmanabhan et al. 2006).

Structurally, GLO2 is a monomer containing two domains. The first folds into a four-layered

β-sheet, typical from metallo-β-lactamases, and the second is predominantly α-helical (Cameron et

al. 1999). Structural information of GLO2 is available through the X-ray structures of different

organisms, including human (PDB entry 1QH5 (Cameron et al. 1999)) and Arabidopsis thaliana (PDB

entry 1XM8 (Marasinghe et al. 2005)). GLO2 proteins contain the highly conserved metal binding

motif THXHXDH, common to all known glyoxalases II, including human and Arabidopsis (Cameron

et al. 1999; Crowder et al. 1997; Zhang et al. 2001). The human GLO2 crystal structure revealed the

presence of two Zn2+ ions per molecule in the enzyme’s active site (Cameron et al. 1999). As for A.

thaliana mitochondrial glyoxalase II, this enzyme can incorporate a range of different metal centres,

being the prevalent the Fe(III)Zn(II) centre (Marasinghe et al. 2005). Also, L. infantum GLO2 enzyme

is able to bind either Zn or Fe (Silva et al. 2008), whereas in Trypanosoma brucei glyoxalase II,

sequence analysis seemed to indicate that zinc is the main metal (Irsch & Krauth-Siegel 2004). For

any of the latter GLO2, one of the metal binding sites consists of three histidine residues, a bridging

aspartic acid residue and a bridging water/hydroxide ion, while the second metal binding site

contains two histidine residues, a terminal bound aspartic acid and the same bridging aspartic acid

residue and a water molecule (Cameron et al. 1999).

CChhaapptteerr II

2233

2.2.1.3. The glyoxalase pathway in Trypanosomatids

Leishmania was first reported to produce D-lactate as an end-product of methylglyoxal in 1988

(Darling & Blum, 1988). The glyoxalase pathway, considered the main methylglyoxal catabolising system in

trypanosomatids, was shown to be trypanothione-dependent in T. brucei, L. infantum and L. major (Irsch and

Krauth-Siegel 2004; Vickers et al. 2004; Sousa Silva et al. 2005). Both GLO1 and GLO2 are present and active in

L. major, as confirmed by the production of D-lactate in this organism (Opperdoes & Michels 2008). However,

the GLO1 gene is absent from T. brucei, while L. brasiliensis lacks the GLO2 gene (Opperdoes & Michels 2008).

GLO1 and GLO2 were identified in L. donovani. Both recombinant enzymes from this parasite were

biochemically and kinetically studied (Padmanabhan et al. 2005; Padmanabhan et al. 2006), as previously

mentioned. Also L. major GLO1 was identified, kinetically analysed and structurally studied, as formerly

referred (Vickers et al. 2004; Ariza et al. 2006).

In L. infantum, glyoxalase I and glyoxalase II are present and show specificity towards trypanothione

and S-D-lactoyltrypanothione (SDL-T(SH)2), respectively (Sousa Silva et al. 2005) (Figure I.13.). Both enzymes

are active in protein extracts and act sequentially as a pathway, as shown by time-course analysis (Sousa Silva

et al. 2005). Using trypanothione-derived hemithioacetal, the kinetic parameters for both glyoxalases in total

protein extracts were KmGLO1 0.24 mM and KmGLO2 0.073 mM.

The glyoxalase pathway’s potential as a putative therapeutic target in trypanosomatids lies not only

on its importance as a main catabolic route for methylglyoxal in living cells, but also on the differences

relatively to their hosts. The importance of the glyoxalase pathway as a therapeutic target was studied in L.

infantum by modelling and computer simulation (Sousa Silva et al. 2005). The simulation results showed that

the glyoxalase enzymes were poor therapeutic targets, and the inhibition of both GLO1 and GLO2 would

have only a slight to no effect, respectively, on methylglyoxal steady-state concentration. In the same study, it

was also demonstrated that methylglyoxal formation rate and trypanothione concentration would have,

respectively, a direct and inverse proportional effect on methylglyoxal concentration. Despite this conclusion,

this study revealed that LiGLO2 is specific for the trypanothione-derived thiolester, not having activity in the

presence of S-D-lactoylglutathione. LiGLO1 can also react with the hemithioacetal formed from glutathione

and methylglyoxal, although it shows a higher affinity for the trypanothione-derived substrate (Sousa Silva et

al. 2005).

CChhaapptteerr II

2244

Figure I.13. Metabolism of methylglyoxal in L. infantum. Methylglyoxal is formed non-enzymatically (n.e.)

from glyceraldehyde-3-phosphate (GAP) or dihydroxyacetone phosphate (DHAP) and is further catabolised

through the glyoxalase pathway. Methylglyoxal reacts non-enzymatically with reduced trypanothione

(T(SH)2), forming an hemithioacetal. This hemithioacetal is then isomerised by glyoxalase I, forming the

thiolester S-D-lactoyltrypanothione, which is subsequently hydrolysed to D-lactate by glyoxalase II,

regenerating T(SH)2 (Barata et al. 2010).

CChhaapptteerr II

2255

2.2.2. Aldose Reductase

The aldo-keto reductases (AKRs) is an enzyme superfamily that comprises a wide range of

oxidoreductases, including the aldose reductase (AKR1B; alditol:NAD(P)+ oxidoreductase, EC

1.1.1.21) and aldehyde reductase (AKR1A; aldehyde:NAD(P)+ oxidoreductase, EC 1.1.1.2) (Jez &

Penning 2001). Members of AKR were found in both prokaryotes and eukaryotes, from bacteria and

archaebacteria to protozoa and fungi, from invertebrates to invertebrates and plants, suggesting

that it is a very ancient superfamily (Jez et al. 1997).

Aldose reductase, the first enzyme of the polyol pathway (Burg et al. 1996), catalyses the

NADPH-reduction of a wide range of aldehydes to polyols (Ginsburg & Hers 1960; Hers 1956),

assuming a detoxification role. The most known reaction catalysed by aldose reductase is the

reduction of D-glucose to sorbitol in a NADPH-dependent reaction, which is then converted to D-

fructose by the NAD+-dependent sorbitol dehydrogenase (EC 1.1.1.14; Jeffery & Jornvall 1983;

Leissing & McGuiness 1983). Hence, aldose reductase is usually linked to diabetes, as the polyol

pathway activity increases upon hyperglycaemia (Gonzalez et al. 1984a; Gonzalez et al. 1984b),

leading to cellular damage and NADPH/NAD+ depletion (Yabe-Nishimura 1998). Therefore,

several aldose reductase inhibitors, envisioning therapeutic possibilities, are available (Ramasamy et

al. 1997; Yabe-Nishimura 1998; Iwata et al. 2006).

Although D-glucose catabolism has impelled most of the aldose reductase studies, this is a

poor substrate for this enzyme, with a Km of 70 mM and a kcat/Km of 0.015 mM-1.s-1, when compared

to other physiological substrates (Vander Jagt et al. 1990; Vander Jagt et al. 1992). Aldose reductase

has a much higher affinity towards methylglyoxal (Km of 0.008 mM and kcat/Km of 3.0 mM-1.s-1)

(Vander Jagt et al. 1992), which is reduced to acetol, in a NADPH-dependent reaction (Figure I.12.).

Being also an aldose reductase substrate, acetol is reduced in a NADPH-dependent reaction to D-

1,2-propanediol (Vander Jagt et al. 1992).

Methylglyoxal promotes a dose- and time-dependent increase in aldose reductase mRNA,

protein level and enzymatic activity (Yabe-Nishimura et al. 2003). In S. cerevisiae, aldose reductase is

coded by the GRE3 gene (stress response gene, YHR104W). Its expression is up-regulated osmotic

and oxidative stress to efficiently eliminate the extra methylglyoxal produced under these

conditions (Aguilera & Prieto 2001).

Most aldose reductase available structures are from the human enzyme, most probably due

to its importance in diabetes. The first human aldose reductase structure was solved in 1992 (PDB

CChhaapptteerr II

2266

entry 1ADS (Bhorani et al. 1992)). Since then, several others became available, including structures

with a broad range of inhibitors and small molecules. Besides the human enzyme, there are also

accessible other aldose reductase structures from other organisms, including the protozoan Giardia

lamblia (PDB entry 3KRB (Seattle Structural Genomics Center for Infectious Disease, to be

published)) and the mammal Sus scrofa (PDB entry 1AH4 (Urzhumtsev et al. 1997)). As other

members of the AKR superfamily, structurally known aldose reductases are monomeric (α/β)8-

barrel proteins which bind NADPH to reduce an array of substrates at an active site containing a

tyrosine, a lysine, an aspartate and a histidine (Ye et al. 2001).

2.2.2.1. Aldose reductase in Trypanosomatids

The first known study on aldose reductase in trypanosomatids reports the identification of a

developmentally regulated acidic polypeptide of Mr= 32000 in L. major, with great sequence

similarity (40-46 %) to the reductase superfamily (Samaras et al. 1988). In 1989, a NADPH-

dependent methylglyoxal reductase was reported to be active in L. donovani (Goshal et al. 1989). The

authors considered this enzyme specific for methylglyoxal being different from the less specific

aldehyde reductases. In 1995, another protein identified as aldehyde reductase from L. donovani was

referred to catabolise acetaldehyde to ethanol in the presence of NADPH (Keegan & Blum 1995).

Recently, it was reported the purification and kinetic analysis of a member of the AKR family in L.

donovani (Rath et al. 2009). Although the authors classify this enzyme as an aldose reductase, it

shares 95 % homology with L. major prostanglandin-f2-alpha-synthase and the structural model

presented was based on the T. brucei brucei prostaglandin-f-synthase. As mentioned, the AKR

superfamily includes a wide range of proteins, being the prostaglandin-f2-alpha-synthase a close

smaller relative. Structural information of Leishmania aldose reductase is still unavailable.

Aldose reductase activity was found in L. infantum promastigotes total protein extracts

(Sousa Silva, data not published). This enzyme reduced methylglyoxal using NADPH with a KmMG

of 0.78 mM and a KmNADPH of 0.0033 mM (Sousa Silva, data not published), similar to other known

aldose reductases (Vander Jagt et al. 1992; Vander Jagt et al. 1993b).

CChhaapptteerr II

2277

33.. AAiimmss aanndd ssccooppee ooff tthhiiss wwoorrkk

Enzymes tend to develop differences along evolution and across-organisms. Leishmania infantum, like

other trypanosomatids, has relevant biochemical characteristics which distinguishes it from other eukaryotes,

being one of the most outstanding the functional replacement of glutathione by trypanothione. Consequently,

all glutathione-dependent enzymes are replaced by trypanothione-dependent ones. Understanding these

enzymes is obviously crucial for a better insight into this parasite’s very unique metabolism.

This Ph.D. project’s scope was the characterization at the kinetic and molecular levels of the enzymes

involved in methylglyoxal catabolism in L. infantum, namely the glyoxalase pathway enzymes and the aldose

reductase.

The first aim was the kinetic and X-ray structural analysis of the recombinant enzymes of the L.

infantum glyoxalase pathway, glyoxalase I and glyoxalase II, and its comparison to other studied homologues,

targeting the understanding of each enzyme’s trypanothione specificity. Hence, the particular steps were to

identify and isolate genes, produce both recombinant proteins, solve their tridimensional structures by X-ray

crystallography and, in parallel, determine their kinetic parameters in the presence of different substrates. The

determination of L. infantum glyoxalase I and glyoxalase II structures, combined with enzyme kinetics, is

important for insight into the substrate binding, understanding the catalytic mechanism and the importance

of the pathway. The study of each of the latter enzymes had two different purposes: the detailed metal

analysis of L. infantum glyoxalase I and the substrate-binding analysis through mutation of L. infantum

glyoxalase II.

The second goal of this work was the de novo kinetic and structural study of L. infantum aldose

reductase, the second most important catabolic pathway for methylglyoxal. Following identification of the

gene coding for this enzyme, the aim was to purify the correspondent protein in significantly high yields to

pursue the enzyme kinetics and structure determination, an advantage for the understanding of this parasite’s

detoxification mechanism for methylglyoxal.

Barata, L., Sousa Silva, M., Schuldt, L., Costa, G., Tomás, A. M., Ferreira, A. E. N., Weiss, M. S., Ponces

Freire, A., Cordeiro, C. (2010) Cloning, expression, purification, crystallization and preliminary X-ray

Diffraction Analysis of Glyoxalase I from Leishmania infantum. Acta Crystallographica Section F, 66, 571–574.

Manuscript on LiGLO1 structure and metal analysis in preparation.

CChhaapptteerr IIII GGllyyooxxaallaassee II ffrroomm

LLeeiisshhmmaanniiaa iinnffaannttuumm

CChhaapptteerr IIII

3311

11.. SSuummmmaarryy

Glyoxalase I (GLO1) is the first of the two enzymes of the glyoxalase pathway,

catalysing the formation of S-D-lactoyltrypanothione from the hemithioacetal non-

enzymatically formed from methylglyoxal and reduced glutathione. In trypanosomatids,

parasitic protozoa that cause mammal diseases such as leishmaniasis and trypanosomatiasis,

glutathione is replaced by trypanothione as a cofactor for glyoxalase I. GLO1 from L.

infantum (LiGLO1) was cloned, over-expressed in E. coli, purified and crystallised. Two

crystal forms were obtained: a cube-shaped and a rod-shaped one. While the cube-shaped

form does not diffract X-rays at all, the rod-shaped form exhibits diffraction to about 2.0 Å

resolution. The crystals belong to space group P21212 with the unit cell parameters a= 130.03

Å, b= 148.51 Å, c= 50.63 Å and three dimers of the enzyme per asymmetric unit.

A metal cofactor is essential for GLO1 activity. Typically, eukaryotic GLO1 contains

Zn2+ at the active site and prokaryotic GLO1 contain Ni2+. However, a general rule to define

the metal-type according to the taxonomic group cannot be formulated since there are some

exceptions. By Inductively-Coupled Plasma (ICP) emission, X-ray fluorescence and X-ray

anomalous diffraction it could be undoubtedly established that the major metal occupying

the LiGLO1 active site is Zn2+. This finding is in stark contrast to the reported presence of

Ni2+ in the closely related LmGLO1 enzyme.

LiGLO1 was active and able to use both glutathione and trypanothione

hemithioacetals as substrate, although the latter was preferred. Hence, LiGLO1 differs from

the human enzyme counterpart in active site structure and substrate specificity. The 2.0 Å

resolution LiGLO1 structure reported in this work, together with the solved L. infantum

glyoxalase II (LiGLO2), will provide the basis for a better understanding of the glyoxalase

pathway in trypanosomatids and of the evolutionary pressure towards trypanothione

specificity.

CChhaapptteerr IIII

3322

22.. IInnttrroodduuccttiioonn

The enzyme glyoxalase I (GLO1; lactoylglutathione lyase; EC 4.4.1.5) is the first of

two enzymes involved in the thiol-dependent glyoxalase pathway (Thornalley 1990).

Together with the glyoxalase II (GLO2; hydroxyacylglutathione hydrolase, EC 3.2.1.6), it is

essential for the detoxification of methylglyoxal, a toxic and mutagenic (Marinari et al. 1984;

Lo et al. 1994) non-enzymatically formed by-product of glycolysis (Thornalley et al. 1996).

The hemithioacetal spontaneously formed by methylglyoxal and glutathione is sequentially

isomerised by glyoxalase I to S-D-lactoylglutathione and then hydrolysed by glyoxalase II to

D-lactate and glutathione (see figure I.13. from this thesis). Trypanosomatids, the causative

agents of mammal diseases, are exclusive concerning the use of trypanothione (N1,N8-

bis(glutathionyl)spermidine, T(SH)2) instead of glutathione (γ-L-glutamyl-L-

cysteinylglycine; GSH) in many metabolic processes. The glyoxalase pathway is no

exception, although the glyoxalase I from trypanosomatids can also use the glutathione-

methylglyoxal hemithioacetal (Vickers et al. 2004; Sousa Silva et al. 2005).

Eukaryotic (Cameron et al. 1997) and prokaryotic (Sukdeo et al. 2004) GLO1 are

typically homodimeric proteins with subunits of about 140 residues and a molecular weight

of about 18 kDa. Exceptions include the yeast (Thornalley 2003) and plasmodia (Iozef et al.

2003) GLO1 enzymes, which are monomeric, albeit coded by a duplicated gene in both

cases. Glyoxalase I three dimensional structural information is available for E. coli (EcGLO1;

PDB entry 1F9Z (He et al. 2000)), human (HsGLO1; PDB entry 1FRO (Cameron et al. 1997))

and L. major (LmGLO1; PDB entry 2C21 (Ariza et al. 2006)). All of these structures constitute

homodimeric enzymes, where each subunit is composed of two βαβββ domains and the

active site is located at the interface between the two subunits.

GLO1 belongs to two superfamilies: the βαβββ superfamily, characterised by

proteins with a cleft, which in GLO1 harbours the metal-binding and active site; and the

VOC (vicinal oxygen chelate) superfamily, which comprises enzymes featuring metal centre

co-ordination by substrate oxygen atoms (Sukdeo et al. 2004). The metal centre is essential

for the enzymes of both families (Sukdeo et al. 2004).

According to the metal-content, GLO1 have been divided in two groups: the Zn2+-

dependent GLO1, comprising eukaryotic GLO1, as those from H. sapiens and S. cerevisiae

CChhaapptteerr IIII

3333

(Aronsson et al. 1978; Ridderstrom et al. 1996), and Ni2+-dependent ones, including

prokaryotic enzymes from E. coli, Pseudomonas aeruginosa, Yersinia pestis and Neisseria

meningitides (Sukdeo et al. 2004). However, this division by metal-type is not accurate, since

the prokaryotic Pseudomonas putida GLO1 is Zn2+-dependent (Saint-Jean et al. 1998) while the

eukaryotic L. major GLO1 (LmGLO1) contains divalent nickel at the active site (He et al.

2000).

Here, we report the cloning, expression, purification, crystallization and preliminary

X-ray diffraction analysis of LiGLO1. In addition, the refined structure of LiGLO1 is

described, as well as its detailed kinetic and metal analysis. X-ray anomalous scattering

methods, fluorescence and Induced Coupled Plasma (ICP) analysis were used to elucidate

the nature of the metal in the LiGLO1 metal binding active site. LiGLO1 and LmGLO1

appear to have a different metal specificity although they share 97 % amino acid sequence

identity. In LmGLO1, 0.9 mol of nickel and 0.1 mol of zinc per mol of protein were detected

by atomic absorption spectrophotometry (Vickers et al. 2004), indicating that the

homodimeric protein active sites might not tightly bind the metal cofactor (Vickers et al.

2004; Clugston et al. 1998). Although the predicted metal-binding residues are conserved in

these two enzymes, zinc is the main metal present in the in LiGLO1’s active site. L. major and

L. infantum cause different forms of leishmaniasis, cutaneous and visceral respectively, being

very interesting to find significant differences in their respective biochemistry, most

probably related to protein evolution.

The studies presented in this work, together with the LiGLO2 solved structure and

kinetic analysis (Silva et al. 2008), will allow a complete assessment of the L. infantum

glyoxalase pathway and provide insights into the evolutionary path leading to glyoxalase I

metal and substrate specificity.

CChhaapptteerr IIII

3344

33.. MMaatteerriiaallss aanndd MMeetthhooddss

33..11.. CClloonniinngg aanndd eexxpprreessssiioonn ooff LLiiGGLLOO11

The LiGLO1 gene (GenBank accession no. DQ294973) was amplified from L. infantum

genomic DNA. The PCR product was cloned (forward primer 5’-

CCGCGCACATATGCCGTCTCGTCGTAT-3’, containing the NdeI restriction site

(underlined), and reverse primer 5’-CACCGCTCGAGTTACGCAGTGCCCTGCTC-3’,

containing the XhoI restriction site (underlined) immediately after the stop codon) into the

NdeI/XhoI-digested expression vector pET28a (Novagen), which was then transformed into

Escherichia coli BL21-CodonPlus (Stratagene). The correct cloning of the open reading frame

was confirmed by sequencing. The final protein sequence was preceded by

MGSSHHHHHHSSGLVPRGSH, containing the His6-tag (bold) and the thrombin cleavage

site (underlined). For over-expression of the N-terminally His6-tagged LiGLO1, E. coli BL21-

Codon Plus transformants were grown in LB medium containing 50 µg ml-1 kanamycin and

34 µg ml-1 chloramphenicol at 37°C. Expression of His6-tagged LiGLO1 was induced at the

culture OD600 of 0.6 with 0.1 mM isopropyl β-D-thiogalactopyranoside (IPTG) for 3 h at 37°C.

Cells were harvested by centrifugation at 7800 g for 30 min at 4°C. Cell pellets were frozen at

-20°C.

33..22.. PPuurriiffiiccaattiioonn ooff LLiiGGLLOO11

The cell pellet was suspended in 10 ml of buffer A (50 mM Bis-Tris pH 6.3, 200 mM

NaCl, all chemicals were obtained from Carl Roth, Karlsruhe, Germany) per g of cells and

lysed by sonication for 10 minutes at 35 % power and 0.4s pulses with 0.9s breaks between

the pulses at 4°C. The soluble fraction obtained by centrifugation at 38000 g for 40 min at 4°C

was filtered through a 0.22 µm membrane, before being applied to affinity chromatography

NTA resin charged with cobalt (Co-NTA) or nickel (Ni-NTA), resulting in two batches of

protein, identified as LiGLO1 purified using Co-NTA and Ni-NTA, respectively, for

purification at room temperature. The fusion protein, with an N-terminal tail of six histidine

residues and a thrombin cleavage site was eluted in buffer A supplemented with 500 mM

imidazole. The N-terminal His6-tag was cleaved using the Thrombin Cleavage Kit

CChhaapptteerr IIII

3355

(Novagene) and optimised cleavage conditions (1:200 thrombin dilution, overnight, at 20°C).

The cleaved protein was directly applied to a gel filtration column (Superdex S75 16/60, GE

Healthcare) equilibrated with buffer A for further purification. The purity of the

recombinant enzyme was estimated by SDS-PAGE. To confirm the identity of the expressed

protein, peptide mass fingerprinting by MALDI-FTICR-MS (Shevchenko et al. 2006) was

performed by Gonçalo da Costa at the FTICR and Advanced Proteomics Laboratory, FCUL,

Portugal. LiGLO1 was concentrated to 15 mg ml-1 in buffer A using a Vivaspin15 (molecular

weight cutoff 10000) concentrator (Sartorius Stedim Biotech). Protein concentration was

determined using a Peqlab Biotechnologie GmbH NanoDrop® ND-1000 Spectrometer at 280

nm, assuming an estimated LiGLO1 extinction coefficient of 20400 M-1 cm-1, as calculated by

ProtParam tool (Gasteiger et al., 2005) for a protein molecular weight of 18.2 kDa. Buffer A

was optimised by ligand-assisted monitoring of thermal protein unfolding in a ThermoFluor

experiment (Ericsson et al. 2006). 5 µl of 50 × Sypro Orange (fluorophore, Invitrogen), 5 µl of

1 mg/ml LiAKR and 40 µl of each buffer were added to the wells of a 96-well thin-wall PCR

plate (Bio-Rad). Fluorescence was detected while heating the plate from 4 to 95 °C in

increments of 0.5 °C using a ThermoFluor ICycler IQ thermal cycler (Bio-Rad). Two screens

were performed: a pH versus NaCl concentration screen and an additives screen, including

various compounds (nucleotides, metal ions, salts and others) supplemented to the basis

buffer 50 mM Tris-HCl pH 8.5.

33..33.. MMeettaall aannaallyyssiiss bbyy IICCPP

LiGLO1 metal analysis was performed by atomic emission spectrometry Inductively-Coupled

Plasma (ICP) (Faires et al. 1993). LiGLO1 (50 µg/ml) was analysed for nickel, cobalt and zinc using a

Jobin Yvon-Ultima ICP spectometer available at the Atomic Emission Spectrometry Service (ICP),

Faculdade de Ciências e Tecnologia, Universidade Nova de Lisboa, Portugal.

33..44.. CCrryyssttaalllliizzaattiioonn

Initial crystallization screening was performed at the High Throughput

Crystallization facility at the EMBL-Hamburg Outstation (Mueller-Dieckmann, 2006) using

commercially available crystal screens and the sitting-drop vapour-diffusion method. The

drops consisted of 0.5 µl of protein solution at a protein concentration of 15 mg/ml and 0.5

µl of reservoir solution, and were equilibrated over 80 µl reservoir solutions using 96-well

CChhaapptteerr IIII

3366

format Greiner plates. Two crystal forms were obtained from two different crystallization

conditions: conditions B1 (70 % (v/v) MPD, 100 mM MES-Na salt pH 6.5) and B2 (70 %

(v/v) MPD, 100 mM Tris-HCl pH 8.5) of JBScreen Classic 8 from Jena Bioscience (Jena,

Germany). Crystals of form 2 were then further improved by applying the hanging-drop

vapour-diffusion method using the tools from Nextal Biotechnology. Drops were prepared

by mixing 2 µl protein solution with 2 µl reservoir solution containing 62 % (v/v) MPD (2-

methyl-2,4-pentanediol) and 100 mM Tris-HCl pH 8.5, and equilibrated over 1 ml reservoir

solution.

33..55.. DDaattaa ccoolllleeccttiioonn aanndd pprroocceessssiinngg

For diffraction experiments, the crystals mounted into nylon loops were directly

flash-cooled in the cryostream without any additional cryoprotectant. The cube-shaped

crystals (Figure II.1a.) did not show any X-ray diffraction at beamline ID23-2 at the

European Synchrotron Research Facility (ESRF, Grenoble, France). The initial rod-shaped

crystals from the second condition, however, (Figure II.1b.) diffracted to 3.0 Å at the same

beamline and a complete diffraction data set was collected. A 2.1 Å resolution complete

native data set was collected from an optimised form 2 single crystal at EMBL-beamline X12

(Deutsches Elektronen-Synchrotron DESY, Hamburg, Germany), equipped with a MAR

Mosaic CCD 225 detector. Data were processed and scaled using XDS (Kabsch et al. 1993).

LiGLO1 crystals from the batches purified using Co-NTA and Ni-NTA, respectively,

were used for the analysis of the metal composition of the active site. The four energies for

data collection (9950eV, 8600eV, 8000eV and 7500eV) were determined from the theoretical

absorption curves for zinc, nickel and cobalt (Figure II.5.), respectively. For each purification

batch (Co-NTA and Ni-NTA) two crystals from the same crystallization drop were used for

the analysis. For crystal 1 four datasets were collected with stepwise decreasing energy

(9950eV, 8600eV, 8000eV and 7500eV). For crystal 2 data collection was performed with

stepwise increasing energies (7500eV, 8000eV, 8600eV and 9950eV). The respective crystal-

to-detector distances were adjusted for each energy, to obtain an equivalent resolution range

at the edge of the detector.

Indexing, integration and scaling of the data was performed using XDS and XSCALE

(Kabsch et al. 1993). The crystals belong to the orthorhombic space group P21212 and all

CChhaapptteerr IIII

3377

diffracted to at least a resolution of 2.25 Å. The R factors Rr.i.m. (redundancy-independent

merging R factor) and Rp.i.m. (precision-indicating merging R factor) (Weiss 2001) were

calculated using RMERGE (available from: www.embl-

hamburg.de/~msweiss/projects/rmerge.f or from MSW upon request).

The details of data collection and processing are summarised in Table II.1. and Table

II.2. Intensities were converted to structure factor amplitudes using the program

TRUNCATE (French & Wilson 1978; Collaborative Computational Project, Number 4, 1994).

The optical resolution of the data sets was calculated with SFCHECK (Vanguine et al. 1999).

33..66.. CCrryyssttaall ssttrruuccttuurree ssoolluuttiioonn

The three-dimensional crystal structure of LiGLOI was solved by molecular

replacement using the program MOLREP (Vagin & Teplyakov 1997) and one polypeptide

chain of glyoxalase I from L. major (PDB entry 2C21 (Ariza et al. 2006)) as a search model.

Three protein dimers per asymmetric unit were refined against a native data set of 2.1 Å in

space group P21212 (Table II.1. and II.2.). The model was adjusted using COOT (Emsley &

Cowtan 2004) and refinement was performed with Refmac5 (Murshudov et al. 1997). The

final refinement statistics for the native data are given in Table II.1. All molecular graphics

images were generated using the UCSF Chimera (Pettersen et al. 2004). For the datasets of

the metal analysis, the structures were determined by difference Fourier maps phased using

the atomic coordinates of the polypeptide chains from the native structure. One round of

refinement using Refmac5 (Murshudov et al. 1998) was performed, including 20 cycles of

rigid body refinement and 40 cycles of restrained refinement.

33..77.. AAnnoommaalloouuss ddiiffffeerreennccee mmaappss

The program FFT (Bailey 1994) was used to calculate an anomalous Fourier map.

MAPMASK and PEAKMAX (Bailey 1994) were used to search for peaks in the electron

density map above a threshold of 0.1. The atomic coordinates of native LiGLO1, which are

close to the anomalous peaks from the PEAKMAX output, were identified with WATPEAK

(Bailey 1994). The asymmetric unit of GLO1 contains three dimers, which are named AB, CD

CChhaapptteerr IIII

3388

and EF, respectively. Each dimer exhibits two metal binding sites, termed AB1 and AB2,

respectively (accordingly for the remaining two dimers).

33..88.. OOccccuuppaanncciieess ooff mmeettaall bbiinnddiinngg ssiitteess

The values of the anomalous components ∆f” for the elements zinc, nickel, cobalt and

sulfur for the four energies of data collection were taken from the internet site of the

Biomolecular Structure Center at the University of Washington, Seattle, USA

(http://skuld.bmsc.washington.edu/scatter/AS_periodic.html). To specify the values for

the different metal ions at different energies, the nomenclature used here includes the name

of the element E and the respective value of the energy used for data collection, resulting in

∆f”(E,eV) (e.g. ∆f”(Zn,9950)).

Scaling of the occupancy of the metal binding sites is performed intrinsically against

the anomalous signal of sulfur. Within each dimer the anomalous difference peak with the

highest sigma value σmax at a sulfur position is considered to have occupancy of 100 %.

Considering the ∆f” value of sulfur at the corresponding energies ∆f”(S,eV) (Table II.4.), a

scaling factor SXY,eV for each dimer and each energy is generated by

SXY,eV= σmax,eV/∆f”(S,eV).

Each metal binding site (generally XY; more precisely AB1, AB2, CD1, CD2, EF1 and

EF2) is assumed to have zinc, nickel and cobalt ions bound at an unknown ratio. All these

metal ions contribute to the anomalous signal and the contribution depends on the

occupancy (described by the variables cZn, cNi and cCo, respectively) and on the

corresponding ∆f” values for the different metal ions at different energies. Hence, the sigma

value σXY for the observed anomalous difference peak can be explained by the linear

combination

σXY,eV = cZn * ∆f”(Zn,eV) * SXY,eV + cNi * ∆f”(Ni,eV) * SXY,eV + cCo * ∆f”(Co,eV) * SXY,eV

For each binding site XY, four analogue equations at different energies result and the

values cZn, cNi and cCo can be solved. This calculation was developed by Linda Schuldt and

was implemented in the program LINSOLVE, specifically developed for this work by Gerrit

Langer, at the EMBL-Hamburg, Germany.

CChhaapptteerr IIII

3399

33..99.. LLiiGGLLOO11 KKiinneettiicc AAnnaallyyssiiss

LiGLO1 was kinetically analysed. For all assays, oxidised trypanothione (Bachem)

was reduced using dithiothreitol (Sigma) immediately before the reaction, as described

(Sousa Silva et al. 2005). High-purity methylglyoxal was used in these assays. Methylglyoxal

was prepared by acid hydrolysis of methylglyoxal 1,1-dimethyl acetal (Sigma-Aldrich),

followed by fractional distillation under reduced pressure in a nitrogen atmosphere, as

described previously (Sousa Silva et al. 2005).

Methylglyoxal was added in excess (3.34 mM in a reactional system of 2 mL), and the

hemithioacetal concentration was calculated considering the dissociation constant 3.0 mM (Vander

Jagt et al. 1972). The activity assay of LiGLO1 (purified using Co-NTA) was undertaken as previously

described (Sousa Silva et al. 2005). Hemithioacetal concentrations between 0.05 and 0.5 mM were

prepared from trypanothione (T(SH)2) and methylglyoxal, whereas for the glutathione (GSH)-derived

hemithioacetal concentrations between 0.1 and 2 mM were used. Thiolesters hydrolysis were

followed at 240 nm. All reactions were performed at 30 °C in 2 mL of 100 mM potassium phosphate

buffer pH 7.4, on an Agilent HP 8453 diode array spectrophotometer (with temperature control and

cuvette stirring). Km values for both substrates were determined using the HYPER32 software (J.S.

Easterby, Univ. of Liverpool, UK) and the limiting rate was calculated by time-course analysis using

an in-house developed software (Ferreira, A. E. N.).

44.. RReessuullttss aanndd ddiissccuussssiioonn

44..11.. TThhee LL.. iinnffaannttuumm ggllyyooxxaallaassee II ggeennee aanndd ddeedduucceedd pprrootteeiinn

A BLAST search carried out on GeneDB (Hertz-Fowler et al. 2004) for the L. infantum

genome revealed only one putative lactoylglutathione lyase-like gene, with 426 bp in length,

at chromosome 35. The sequence was confirmed by sequencing in both directions, after

complete LiGLO1 gene was amplified from genomic DNA of clone

MHOM/MA67ITMAP263. The LiGLO1 sequence (GenBank acc. nr. DQ294973) shows 96 %

identity to L. donovani (GenBank acc. nr. AY739896) and 95 % identity to L. major (GenBank

acc. nr. AY604654) and 33 % identity to human glyoxalase I (GenBank acc. nr. D13315). The

deduced protein was identified as a lactoylglutathione lyase, with 141 amino acid residues.

The predicted molecular mass of 15.7 kDa is similar to L. major and L. donovani enzymes, but

smaller than the 43.0 kDa human glyoxalase I. The isoelectric point (pI) of L. infantum

CChhaapptteerr IIII

4400

glyoxalase I, calculated from the protein sequence, is 4.7. This value is similar to the pI value

of 5.0 for L. donovani (Padmanabhan et al. 2005), 4.9 for L. major (Vickers et al. 2004) and 4.8-

5.0 reported for human glyoxalase I (Ridderstrom et al. 1996).

44..22.. RReeccoommbbiinnaanntt LLiiGGLLOO11 oovveerr--eexxpprreessssiioonn aanndd ppuurriiffiiccaattiioonn

The pET-28a expression vector carrying the LiGLO1 gene was transformed into E. coli

BL21 cells, and over-expression conditions for His6-LiGLO1 were optimised using small-

scale growth cultures. Purification buffer was optimised by ThermoFluor, an assay based on

monitoring the thermal induced unfolding of a protein in presence of several buffers by

measuring the temperature midpoint of the protein unfolding transition (Tm) (Pantoliano et

al. 2001). The results showed that the protein was most stable in 50 mM Bis-Tris pH 6.3 with

200 mM NaCl (data not shown). LiGLO1 purification was performed using a cobalt- and

nickel-affinity chromatography, to address metal identity in the enzyme, with a further gel

filtration step. The protein was about 95 % pure as estimated by SDS–PAGE. The total

purification process yield was about 20 mg of protein per litter of culture, for both

purifications using Co-NTA and Ni-NTA. LiGLO1 is a dimeric protein in solution as

confirmed by preliminary Static Light Scattering (SLS), based on measuring the average

intensity of light scattered by a protein solution of defined concentration (Kratochvil 1987).

44..33.. CCrryyssttaallss,, ddaattaa ccoolllleeccttiioonn aanndd pprroocceessssiinngg

The crystallization behaviour was observed to be similar to the enzyme from L. major

(Ariza et al. 2005), as it resulted in two crystal forms (Figure II.1.). The optimised rod-shape

crystals (Figure II.1c.) grew within 3 days at 20°C to maximum dimension 0.50x 0.15x0.15

mm3. The initial rod-shaped form 2 crystals (Figure II.1b.) diffracted to about 3.0 Å

resolution, while the optimised ones (Figure II.1c.) diffracted X-rays to beyond 2.1 Å

resolution using synchrotron radiation.

CChhaapptteerr IIII

4411

Figure II.1. Crystals of LiGLO1. (a) Form 1 crystals with dimensions of approximately 0.1x0.1x0.1

mm3. Did not exhibit any diffraction. (b) Initial form 2 crystals with dimensions of approximately

0.15x0.03x0.03 mm3. Diffracted to about 3.0 Å resolution. (c) Improved form 2 crystals with

dimensions of approximately 0.5x0.15x0.15 mm3. Diffracted to about 2.0 Å resolution.

Two complete diffraction data sets were collected (Table II.1.). The crystals belong to

space group P21212, with unit-cell parameters a=130.03 Å, b=148.51 Å and c=50.63 Å. The

Matthews coefficient VM (Matthews 1968) and solvent content, calculated based on a subunit

molecular weight of 18.2 kDa (predicted from the sequence), estimates the most likely

asymmetric unit content to be either four or six molecules. Assuming the presence of three

dimers per asymmetric unit, the Matthews coefficient is 2.2 Å3 Da-1and the solvent content

45.3 % (Kantardjeff & Rupp 2003; Matthews 1968). For two dimers the respective values

would be 3.4 Å3 Da-1and 63.6 %. A detailed examination of the self-rotation function

revealed non-crystallographic peaks on the κ = 180° section (Figure II.2.). It appears to be the

case that at least two additional twofold axes are present on this section and that all of them

lie in the xy-plane. However, without knowledge of the structure, the self rotation function

does not really allow determination of the number of dimers per asymmetric unit with

certainty.

CChhaapptteerr IIII

4422

Table II.1. Data collection, processing and refinement statistics. The values in parenthesis are for

highest resolution shell. Data were processed using XDS, RMERGE, TRUNCATE and SFCHECK

(Kabsch 1993; Bailey 1994; Vagin & Teplyakov 1997; Weiss 2001). Structure refinement was performed

with Refmac5 (Bailey 1994; Murshudov et al. 1997). Ramachandran plot was produced using

PROCHECK (Kleywegt & Jones 1996; Laskowski et al. 1993).

Data collection and processing: Beamline X12 (EMBL, DESY) Detector MARCCD 225mm Wavelength (Å) 1.0000 Crystal-detector distance (mm) 200 Rotation range per image (°) 0.5 Total rotation range (°) 200 Resolution range (Å) 50.0–2.10 (2.20-2.10) Space group P21212 Unit cell parameters, a, b, c (Å) 130.03, 148.51, 50.63 Mosaicity (°) 0.116 No. of reflections 474893 No. of unique reflections 110729 Redundancy 4.3 (4.2) I/σ(I) 12.8 (2.2) Completeness (%) 99.8 (98.9) Rmerge (%) 1) 9.7 (77.8) Rr.i.m. (%) 2) 10.4 (83.1) Rp.i.m. (%) 3) 3.6 (28.9) Overall B-factor from Wilson plot (Å2) 32.3 Optical resolution (Å) 1.65 Refinement statistics: R factor (%) 18.1 Rfree fator (%) 21.9 No. of atoms Protein 6860 MPD/ Na+/ Zn2+/ water 5/ 2/ 6/ 285 R.m.s. deviations bond lengths (Å) bond angles (°)

0.015 1.701

Ramachandran plot most favoured (%) 95.1 additionally allowed (%) 4.7

1) Rmerge= ΣhklΣi | Ii(hkl) - <I(hkl)> | / ΣhklΣi Ii(hkl), where Ii(hkl) is the intensity of the observation i of the reflection hkl. 2) Rr.i.m= Σhkl (N/(N-1))1/2

Σi | Ii(hkl) - <I(hkl)> | / ΣhklΣi Ii(hkl), where Ii(hkl) is the intensity of the observation i of the reflection hkl and N is the redundancy of the reflection hkl. 3) Rp.i.m= Σhkl (1/(N-1))1/2

Σi | Ii(hkl) - <I(hkl)> | / ΣhklΣi Ii(hkl), where Ii(hkl) is the intensity of the observation i of the reflection hkl and N is the redundancy of the reflection hkl.

CChhaapptteerr IIII

4433

Figure II.2. Self-rotation function of the LiGLO1 native data. Shown is the κ = 180° section indicating

the relative locations of the twofold symmetry axes. The peaks originating from the crystallographic

symmetry are located along the x-, y- and z-directions. The peaks representing the non-

crystallographic symmetry elements are highlighted and labelled by the respective subunit

identifiers. Blue circles show the twofold axes relating the two monomers within one LiGLO1 dimer

and red circles the twofold axes relating the monomers of different dimers to each other. In addition,

the position of the non-crystallographic threefold axis is indicated by a green triangle (Note: The peak

corresponding to the green triangle does of course not appear on the κ = 180° section depicted here,

but on the κ = 120° section instead). The three dimers of LiGLO1 in the asymmetric unit assemble to a

hexamer of approximate D3-symmetry. This figure was produced using the program MOLREP

(Vagin & Teplyakov, 1997).

The structure of LiGLO1 was solved by molecular replacement using the related structure of

glyoxalase I from L. major (PDB entry 2C21 (Ariza et al. 2006)) and the lower resolution data set

collected from the initial form 2 crystals. After placing three dimers in the asymmetric unit, the

correlation coefficient was 64.2 % and the R-factor to 3.5 Å resolution 39.6 %. This essentially confirms

the correctness of the structure solution. In retrospect, the self-rotation function (Figure II.2.) can be

examined and interpreted using the known structure as a guide. The three dimers of LiGLO1 arrange

themselves in a pseudo-D3-symmetric arrangement, with the threefold axis only about 14º away from

the crystallographic z-axis and all twofold axes close to the xy-plane. A very similar arrangement has

also been observed in the structure of LmGLO1 (Ariza et al. 2005).

CChhaapptteerr IIII

4444

44..44.. OOvveerraallll ddeessccrriippttiioonn ooff tthhee LLiiGGLLOO11 ccrryyssttaall ssttrruuccttuurree

The asymmetric unit of the orthorhombic crystal form contains six polypeptide

chains, which form three dimers named AB, CD and EF. The LiGLO1 structure was refined

against data extending to a resolution of 2.1 Å in space group P21212, resulting in an R factor

of 18.0 %, and a corresponding Rfree (Brunger 1992) of 22.0 %. The final polypeptide chains

have between 139 and 141 residues. Each protein dimer has two metal ions and two MPD (2-

methyl-2,4-pentanediol) molecules. A total of 285 water molecules were found in the

structure. The average temperature factor of the protein is 40.6 Å2. The rmsd deviation

values from ideal bond lengths and bond angles were 0.015 Å and 1.7°, respectively, and no

outlier residues were found in the Ramachandran plot (Kleywegt et al. 1996). Based on these

quality criteria, the structure can be considered well refined and of high quality.

LiGLO1 is a 141 amino acid metalloprotein arranged in dimers, as referred. Like the

other previously described glyoxalase I structures (Cameron et al. 1997; He et al. 2000; Ariza

et al. 2006), LiGLO1 is arranged in two βαβββ domains. An eight-stranded β-sheet with

pseudo-twofold symmetry emerges due to the dimer formed by the interaction of the first

domain of one monomer with the second domain of the other (Figure II.3.). Each dimer has

two metal binding sites named AB1, AB2, CD1, CD2, EF1 and EF2, respectively. The metal

binding sites are located in the interface of two monomers building up the dimer. The side

chains of His8, Glu59, His77' and Glu120' (where prime “ ' “ indicated the second monomer)

are responsible for coordination of the metal ion. Two sodium ions are located at the

interface between the dimers AB and CD, as well as between CD and EF (Figure II.3.). Dimer

AB was used for all subsequent structural interpretation.

CChhaapptteerr IIII

4455

Figure II.3. LiGLO1 structure. (a) Content of the asymmetric unit. Chain A (blue), B (yellow), C

(green), D (pink), E (gold) and F (red) are shown. Water molecules (red) interacting with zinc ions

(light blue), sodium ions (yellow) and MPD molecules are depicted. (b) Dimer AB. Chain A (blue), B

(yellow), water molecules (red) interacting with zinc ions (light blue), sodium ions (yellow) and MPD

molecules are depicted. (c) Metal-binding site. Zinc ion (light blue) is coordinated by His8 and Glu59

from chain A (blue), His77’ and Glu120’ from chain B (yellow) and a water molecule (red). Distances

are indicated. The figure was prepared using UCSF Chimera (Pettersen et al. 2004).

LiGLO1 is structurally very similar to Ni2+-dependent LmGLO1 (Ariza et al. 2006)

(rmsd of 0.27 Å superposing dimer AB, based on 273 Cα atoms), differing in only three

residues located at the protein surface: Gln39, Ala50 and Met126 of LiGLO1 corresponding

to Glu39, Gly50 and Thr126 in LmGLO1. Moreover, LiGLO1 is more similar to the

prokaryotic Ni2+-dependent EcGLO1 (He et al. 2000) (rmsd of 1.02 Å, superposing dimer AB,

based on 234 Cα atoms) than to the Zn2+-dependent HsGLO1 (Cameron et al. 1997) (rmsd of

1.48 Å, superposing dimer AB, based on 230 Cα atoms), as also observed for the LmGLO1

enzyme (Ariza et al. 2006). However, significant differences are observed between LiGLO1

CChhaapptteerr IIII

4466

and both EcGLO1 and HsGLO1. The loop between strands 6 and 7 is seven and five residues

shorter relatively to EcGLO1 and HsGLO1, respectively, and the 15-residue C-terminal helix

is absent from EcGLO1 and shorter and in a different orientation in HsGLO1.

44..55.. AAccttiivvee SSiittee

The active site of glyoxalase I consists of a highly conserved catalytic metal centre

and γ-glutamate-binding residues, and the methylglyoxal pocket and the glycylcarboxylate-

or amide-binding residues, both showing significant differences across structures.

Although we tried to solve a structure of LiGLO1 in complex with the hemithioacetal

derived from glutathione, trypanothione and glutathionil-spermidine, by soaking crystals

with this substrates, a MPD molecule was always present in the active site. This compound

is essential in the crystallization condition at a concentration as high as 3M and co-

crystallised with the protein. Similarly to what was described for LmGLO1 (Ariza et al. 2006),

this MPD molecule interacts with Try35, a residue absent from EcGLO1 and HsGLO1.

A divalent metal is required to polarise both oxygen atoms of the methylglyoxal

moiety, facilitating the rearrangement of the substrate to D-lactate (Bailey et al. 1994; Himo &

Siegbahn 2001). In the LiGLO1 structure, Zn2+ is coordinated by residues His8 and Glu59,

from one monomer, and His77 and Glu120, from another monomer, and a water molecule

(Figure II.3.). The distances between zinc ion and the coordinating atoms (> 2.13 Å) are

longer than typical for this ion (approximately 2.00 Å (Harding 1999)), suggesting the metal-

binding sites are not fully occupied, similarly to LmGLO1 (Ariza et al. 2006). This was based

on the EcGLO1 structure (He et al. 2000), the only one to reveal fully occupied metal-binding

sites. However, the distances in EcGLO1 are smaller than the ones found for LmGLO1,

showing the different metal content of both enzymes, since nickel-ion distances are typically

longer (approximately 2.06 Å (Harding 1999)) than the zinc-ion ones. The metal composition

of LiGLO1 will be described in detail in the next section of this Chapter.

In spite of the metal difference observed, and although LiGLO1 active site surface

(Figure II.4.) is slightly different relatively to EcGLO1 (He et al. 2000) and HsGLO1 (Cameron

et al. 1997), it is very similar to LmGLO1 (Ariza et al. 2006). Also, the residues binding the γ-

glutamate moiety of the substrate, Asn63 and Arg12, are conserved between the GLO1

analysed structures.

CChhaapptteerr IIII

4477

LiGLO1 structure, apart from having diverse substrate specificity from HsGLO1,

shows significant structural differences towards the human counterpart, including its less

accessible active site mainly due to interactions between β6 and β7 and the loop between β2’

and β3’.

Figure II.4. Molecular surface of LiGLO1 dimer AB (chain A in blue; chain B in yellow). Coloured

residues are: zinc ion coordinating (orange), MPD binding (red), conserved on γ-glutamyl moiety

binding (light green) and differing from LmGLO1 (pink) are coloured. Zinc ion is in light blue. The

figure was prepared using UCSF Chimera (Pettersen et al. 2004).

44..66.. MMeettaall ccoommppoossiittiioonn

To investigate the LiGLO1 metal-content, Inductively-Coupled Plasma (ICP), an atomic

emission spectrometry method, was used (Faires 1993). LiGLO1 purified on Co-NTA was analysed

targeting zinc, nickel and cobalt. Although the protein was purified using a cobalt-affinity column,

the analysis revealed that of the three metals analysed LiGLO1 contained only zinc.

In order to further analyse which metal-ion clearly occupies the metal binding site of

the active site, we exploited X-ray anomalous scattering properties of the transition metals.

Four 0.5 mm long and 0.15 mm thick crystals, two from each Co-NTA and Ni-NTA

purification batches (referred to as crystal 1 and crystal 2 from each purification batch),

respectively, were used for these measurements without the need for cryoprotectant. X-ray

fluorescence spectra were collected for crystals at the EMBL Hamburg X12 beamline at

CChhaapptteerr IIII

4488

DORIS storage ring, DESY, Hamburg. Incident X-rays of 9950 eV, 8600 eV, 8000 eV energy

were chosen to excite the elements zinc, nickel and cobalt, respectively, accordingly to the

metals absorption edges (Figure II.5.). The fluorescence spectrum (Figure II.6a.) clearly

shows zinc as the main metal bound to LiGLO1, being nickel and cobalt present in very

small amount. Also detected in low quantities are copper and manganese, commonly

detected when zinc is present; and iron, attributed to the pin used for measurement, and not

considered in the subsequent analysis (Figure II.6b.).

Figure II.5. Theoretical absorption edges of zinc, cobalt and nickel. The respective anomalous

components ∆f ” are shown as a function of incident X-ray energy. The energy values used for data

collection, indicated by black arrows, were taken from the site of the Biomolecular Structure Center at

the University of Washington, Seattle, USA.

(http://skuld.bmsc.washington.edu/scatter/AS_periodic.html).

CChhaapptteerr IIII

4499

Figure II.6. X-ray fluorescence spectra of (a) LiGLO1 crystal and (b) loop containing only reservoir

solution. In (a) zinc (Zn) corresponds to the most intense peak, being nickel (Ni) and cobalt (Co) peaks

very weak. Copper (Cu) and manganese (Mn) weak peaks are also visible. These metals are usually

detected when zinc is present. In (b) only the peak for iron (Fe) is visible, being this metal attributed

to the pin used for measurement.

For the crystal 1 (from each purification batch), data were collected stepwise increasing

the energy, while for crystal 2 (from each purification batch) data were collected by

decreasing the energy. In both cases the data sets were collected starting at the same phi

angle and the detector distance was adjusted, to obtain similar resolution limits for all data

sets collected. Crystal 1 and crystal 2 from the Co-NTA batch diffracted to 2.17 Å (Table II.

2.)., while crystal 1 and crystal 2 from the Ni-NTA batch diffracted to 2.18 Å (Table II.3.).

CChhaapptteerr IIII

5500

Table II.2. Data collection and processing from LiGLO1 crystal purified on Co-NTA. Values in parentheses are for the highest resolution shell.

LiGLO1 purified on Co-NTA Crystal 1 Crystal 2

Energy (eV) 9950 8600 8000 7500 7500 8000 8600 9950 No. of crystals 1 1 Wavelength (Å) 1.24603 1.44163 1.54975 1.65307 1.65307 1.54975 1.44163 1.24603

Crystal-to-detector distance (mm) 180 150 133 120 120 133 150 180 Rotation range per image (deg) 0.5 0.5 0.5 0.5 0.5 0.5 0.5 0.5 Total rotation range (deg) 180 180 180 180 180 180 180 180 Space group P21212 P21212 Cell dimensions a,b,c (Å) 129.53,

147.38, 50.24

129.54 147.39 50.24

129.58, 147.44, 50.26

129.54, 147.39, 50.24

129.49, 147.41, 50.25

129.54, 147.46, 50.27

129.52, 147.43, 50.26

129.52, 147.42, 50.26

Resolution (Å) 50 - 2.25 (2.30-2.25)

50 - 2.25 (2.30-2.25)

50 - 2.25 (2.30-2.25)

50 - 2.25 (2.30-2.25)

50 - 2.20 (2.25-2.20)

50 - 2.20 (2.25-2.20)

50 - 2.20 (2.25-2.20)

50 - 2.20 (2.25-2.20)

Completeness (%) 99.4 (94.4) 99.7 (98.4) 99.5 (97.0) 99.5 (96.7) 99.5 (96.2) 99.4 (95.2) 99.5 (95.7) 99.5 (96.2) Redundancy 3.8 (3.3) 3.8 (3.2) 3.8 (3.5) 3.8 (3.6) 3.7 (2.9) 3.7 (2.9) 3.7 (2.7) 3.8 (2.9) Mosaicity (deg) 0.167 0.149 0.150 0.144 0.134 0.132 0.131 0.132 I / σ(I) 11.2 (2.9) 19.1 (2.9) 17.6 (2.7) 15.6 (2.1) 14.0 (2.2) 14.4 (2.2) 14.4 (2.1) 15.2 (2.6) Rmerge (%) 7.8 (39.0) 4.7 (39.2) 5.2 (45.3) 6.0 (59.1) 6.0 (48.6) 5.9 (49.4) 5.9 (47.1) 5.6 (40.8)

Rr.i.m. (%) 9.1 (46.3) 5.5 (46.9) 6.0 (53.3) 6.9 (69.3) 7.1 (59.0) 6.9 (59.3) 6.8 (57.8) 6.6 (49.6) Rp.i.m. (%) 4.7 (25.5) 2.8 (26.2) 3.1 (28.5) 3.5 (36.5) 3.7 (34.6) 3.6 (34.8) 3.5 (35.2) 3.4 (29.1) Anomalous Correlation (%) 13 (1) 6(2) 6 (3) 7 (3) 7 (1) 6 (3) 6 (5) 20 (3) B-factor from Wilson plot (Å) 42.21 42.67 43.24 43.95 40.66 41.14 41.62 41.51 Optical resolution (Å) 1.75 1.76 1.76 1.76 1.73 1.74 1.74 1.74

CChhaapptteerr IIII

5511

Table II.3. Data collection and processing from LiGLO1 crystal purified on Ni-NTA. Values in parentheses are for the highest resolution shell.

LiGLO1 purified on Ni-NTA Crystal 1 Crystal 2

Energy (eV) 9950 8600 8000 7500 7500 8000 8600 9950 No. of crystals 1 1 Wavelength (Å) 1.24603 1.44163 1.54975 1.65307 1.65307 1.54975 1.44163 1.24603

Crystal-to-detector distance (mm) 180 150 133 120 120 133 150 180 Rotation range per image (deg) 0.5 0.5 0.5 0.5 0.5 0.5 0.5 0.5 Total rotation range (deg) 180 180 180 180 180 180 180 180 Space group P21212 P21212 Cell dimensions a,b,c (Å) 129.16

147.48 50.30

129.17 147.48 50.30

129.18 147.45 50.29

129.18 147.45 50.28

129.39 147.63 50.30

129.23 147.46 50.24

129.25 147.47 50.24

129.26 147.47 50.24

Resolution (Å) 50-2.17 (2.22-2.17)

50-2.17 (2.22-2.17)

50-2.17 (2.22-2.17)

50-2.17 (2.22-2.17)

50 – 2.18 (2.24-2.18)

50 – 2.18 (2.24-2.18)

50 – 2.18 (2.24-2.18)

50 – 2.18 (2.24-2.18)

Completeness (%) 99.8 (99.1) 99.7 (97.6) 99.7 (98.6) 99.7 (98.5) 99.7 (97.8) 99.6 (96.9) 99.7 (97.7) 99.6 (96.7) Redundancy 3.7 (2.7) 3.7 (2.4) 3.7 (2.6) 3.7 (2.6) 3.7 (2.7) 3.7 (2.7) 3.7 (2.5) 3.7 (2.8) Mosaicity (deg) 0.101 0.109 0.116 0.122 0.114 0.118 0.115 0.107 I / σ(I) 27.9 (5.8) 25.6 (4.2) 24.8 (3.5) 22.4 (2.1) 19.9 (2.0) 19.9 (2.1) 20.4 (2.4) 20.0 (2.9) Rmerge (%) 3.3 (17.2) 3.5 (22.8) 3.6 (29.4) 4.1 (48.8) 5.0 (50.9) 5.0 (50.8) 4.8 (42.1) 4.9 (36.9)

Rr.i.m. (%) Rp.i.m. (%) Anomalous Correlation (%) 25 (4) 12 (2) 8 (5) 11 (3) 10 (7) 7 (6) 9 (3) 15 (4) B-factor from Wilson plot (Å) 31.9 34.8 36.7 40.2 38.0 38.7 37.8 36.6 Optical resolution (Å) 1.67 1.68 1.68 1.68 1.69 1.69 1.69 1.69

CChhaapptteerr IIII

5522

Table II.4. Peaklist of LiGLO1 purified on Co-NTA and Ni-NTA, respectively. Given is the electron density at the metal site (AB1, AB2, CD1, CD2, EF1 and EF2,

respectively) and at the strongest sulfur peak from each dimer. The energy values used for data collection are given in eV.

LiGLO1 purified on Co-NTA LiGLO1 purified on Ni-NTA

Crystal 1 Crystal 2 Crystal 1 Crystal 2

Energy (eV) 9950 8600 8000 7500 7500 8000 8600 9950 9950 8600 8000 7500 7500 8000 8600 9950

Electron density at metal sites (σ units):

AB1 25.6 6.2 5.6 7.4 8.9 6.8 5.7 31.7 34.1 8.7 8.4 8.7 6.0 7.4 6.9 25.9

AB2 19.6 6.7 5.6 5.9 6.2 6.5 4.6 23.7 32.1 16.0 7.4 7.4 8.4 6.7 12.4 24.8

CD1 20.1 7.7 6.3 6.7 6.2 4.9 7.4 26.1 34.4 22.6 9.5 7.5 7.0 7.2 15.3 24.5

CD2 26.0 7.7 6.7 4.4 6.8 6.9 7.1 33.9 34.5 12.5 8.4 8.7 7.6 7.0 8.0 26.8

EF1 16.3 5.3 6.2 5.1 6.1 4.7 5.9 21.7 27.9 17.5 7.4 7.3 7.1 6.9 11.4 21.1

EF2 13.0 6.4 5.7 4.3 5.0 4.0 4.9 17.5 22.0 18.6 6.8 4.9 5.5 7.7 13.3 17.4

Electron density at strongest sulfur sites (σ units):

AB 3.9 6.5 5.5 6.4 6.7 6.7 5.8 4.5 7.4 10.0 10.1 10.5 8.2 7.3 6.9 6.1

M29B M135A M29B M10B M135A M29B M29B M10A M29B M29B M10A M10A M10A M29A M10A M29B

CD 4.6 7.6 7.7 5.9 8.0 7.1 6.4 4.7 7.1 10.3 11.1 11.0 10.3 8.4 8.6 5.5

M10C M29C M29C M29C M135C M10D M29C M10C M29C M10D M29C M29C M29C M29C M10D M29C

EF 4.2 5.4 6.2 5.2 4.9 6.6 5.4 4.0 5.8 7.3 8.5 8.7 7.1 6.4 6.4 4.8

M127E M10F M10E M29E M29E M10E M10E M128F M10E M10E M10E M10F M10E M10E M10F M10E

CChhaapptteerr IIII

5533

The final coordinates of the native structure were used. For the analysis of the anomalous

scattering data, only one round of refinement in Refmac5 (Murshudov et al. 1997) was carried out.

The resulting models and the anomalous differences at each wavelength were used to calculate an

anomalous difference map and to assign the peaks to surrounding atoms of the native coordinates

using programs from the CCP4 suite (FFT, MAPMASK,PEAKMAX and WATPEAK) (Bailey 1994).

The sigma levels of the anomalous difference peaks at the two metal binding sites of each of the

three dimers in the asymmetric unit as well as the strongest anomalous difference peak of one

sulfur from each dimer, are given in Table II.4.

The occupancies of metal binding sites scaled to the intrinsic anomalous difference of sulfur

are presented in Table II.5. Results suggest that zinc is the main binder at the metal binding site, in

agreement with the information from the ICP and the fluorescence based metal analysis, showing

67.5 % and 73.1 % occupancy for Co-NTA batch crystals 1 and 2, respectively, and 45.5 % and 38.8 %

for Ni-NTA batch crystals 1 and 2, respectively. For all binding sites, the cobalt amount in Ni-NTA

crystals is significantly lower than in Co-NTA ones. Nickel is present in Co-NTA crystals in small

amounts (up to 6.8 %), while in Ni-NTA crystals its quantity is increased of a maximum of around

20 %, showing that the enzyme metal-content depends to some extent on the affinity column metal

used in the purification procedure, but not enough to completely shift it. These results confirm that

zinc is the physiological LiGLO1 preferential metal. No significant difference was observed when

collecting data in opposite directions of energy for crystals 1 (from higher energy to the lowest) and

2 (from lower energy to the highest) (Table II.6), showing that the crystal metal-content is

independent from data collection strategy. Radiation damage affects the overall crystal diffraction,

as well as the sulphur peaks, used as a scaling reference for the metal peaks. Data collection in both

directions assures there is no associated error to the calculated values.

CChhaapptteerr IIII

5544

Table II.5. Occupancies of metal binding sites scaled to sulfur. Metal binding sites are named AB1, AB2, CD1,

CD2, EF1 and EF2.

Binding site LiGLO1 purified on Co-NTA LiGLO1 purified on Ni-NTA

Crystal 1 Crystal 2 Crystal 1 Crystal 2 AB1 Zn (%) Ni (%) Co (%)

67.5 0.0 2.3

73.1 0.0 1.5

45.0 0.6 4.2

38.8 0.0 8.1

AB2 Zn (%) Ni (%) Co (%)

48.4 0.2 6.4

52.7 0.0 3.7

32.6 13.2 3.2

27.9 13.3 6.9

CD1 Zn (%) Ni (%) Co (%)

41.1 2.9 4.3

52.3 6.8 0.0

31.1 20.4 4.3

31.9 14.0 5.1

CD2 Zn (%) Ni (%) Co (%)

55.0 2.2 2.6

72.1 2.2 0.9

43.7 7.0 2.3

47.3 1.5 3.6

EF1 Zn (%) Ni (%) Co (%)

35.2 0.0 8.5

52.5 5.8 0.2

28.8 23.2 4.6

32.1 10.6 8.9

EF2 Zn (%) Ni (%) Co (%)

23.4 4.0 9.1

42.1 4.6 0.7

14.3 26.6 5.8

18.8 13.2 13.0

CChhaapptteerr IIII

5555

44..77.. LLiiGGLLOO11 KKiinneettiicc AAnnaallyyssiiss

Recombinant LiGLO1 activity was assayed for the hemithioacetals formed between

methylglyoxal and either glutathione or trypanothione. A Km for trypanothione-derived HTA of

0.27 mM and a Km for glutathione-derived HTA of 0.97 mM were determined (Table II.6.). The

obtained Km values are consistent with our previous results using L. infantum extracts (Km of 0.24

mM for trypanothione-derived HTA and Km of 1.85 mM for glutathione-derived HTA) (Sousa Silva

et al. 2005). The kcat/Km values of 6.60x103 mM-1s-1 and 0.72x103 mM-1.s-1 for trypanothione- and

glutathione-derived HTA, respectively, indicate rapid turnover of these substrates.

Table II.6. Kinetic parameters of recombinant LiGLO1 and comparison to GLO1 from L. infantum total protein

extracts and to recombinant GLO1 from L. donovani, L. major and human.

Hemithioacetal

Substrate Km (mM)

kcat (s-1)

kcat/Km (mM-1.s-1)

LiGLO1 recombinant

T(SH)2-derived 0.270 1800 6.60x103

GSH-derived 0.970 698 0.72x103 LiGLO1

in total protein extractsa T(SH)2-derived 0.240 - - GSH-derived 1.850 - -

L. major GLO1b T(SH)2-derived 0.032 800 25x103

GSH-derived >1900 - 0.13x103

L. donovani GLO1c T(SH)2-derived 0.028 - - Human GLO1d GSH-derived 0.071 - 0.22x103

aValues from Sousa Silva et al. 2005; bValues from Vickers et al. 2004; cValues from Padmanabhan et al. 2005; dValues from Ridderstrom & Mannervik 1996.

Our results confirm that LiGLO1 shows affinity towards both trypanothione and

glutathione-derived substrates, although it preferentially reacts with the trypanothione-derived

hemithioacetal. LiGLO1 shows a greater turnover for the trypanothione hemithioacetal (kcat of

1.8x103 s-1) than LiGLO2 for S-D-lactoyltrypanothione (kcat of 3.52 s-1, see chapter III of this thesis),

consistent with previous obtained values for both enzymes from the human glyoxalase system (Rae

et al. 1990).

Together with the solved structure and the metal and kinetic analysis of LiGLO2 later

described on this work, the availability of the LiGLO1 structure, kinetics and metal-content,

CChhaapptteerr IIII

5566

reported here, assigns a better understanding of the glyoxalase pathway in trypanosomatids,

revealing the structural features concerning its exclusive substrate specificity and inducing its

uniqueness.

44..88.. LLiiGGLLOO11 eevvoolluuttiivvee ccoonnssiiddeerraattiioonnss

The LiGLO1 detailed metal analysis comes as one more clue to the much discussed metal-

content subject. In general, GLO1 from eukaryotes contain zinc in their active site, differing from

nickel-dependent GLO1 from prokaryotes. So far, there is only one example in literature where an

eukaryotic GLO1, LmGLO1 (Ariza et al. 2006), uses nickel instead of zinc. In our study, LiGLO1

contains zinc in the active site, despite the affinity metal used in the purification process. This

indicates an earlier evolutive divergence of LiGLO1 from the other eukaryotes than its structurally

very close L. major homologue enzyme. Hence, the predicted similarity by sequence homology is

relinquished, as a critical difference is established between these two structurally similar enzymes

(97 % identity) and enhancing the importance of studying LiGLO1.

55.. AAcckknnoowwlleeddggmmeennttss

The authors acknowledge the European Synchrotron Research Facility (ESRF, Grenoble,

France) and the EMBL Hamburg at the Deutsches Elektronen-Synchrotron (DESY, Hamburg,

Germany) for access to synchrotron beamtime. The work was supported by projects

POCTI/ESP/48272/2002 and POCI/QUI/62027/2004 (Fundação para a Ciência e Tecnologia,

Portugal). LB was supported by the doctoral grant SFRH/BD/28691/2006 from the Fundação para

a Ciência e Tecnologia (Portugal) and by an EMBO short-term fellowship ASTF 318-2008.

Trincão, J.‡, Sousa Silva, M.‡, Barata, L., Bonifácio, C., Carvalho, S., Tomás, A. M., Ferreira, A., Cordeiro, C.,

Ponces Freire, A., Romão, M. J. (2006) Purification, Crystallization and Preliminary X-ray Diffraction Analysis

of the Glyoxalase II from Leishmania infantum, Acta Crystallographica Section F 62, 805-807. (‡ both authors

contributed equally for the work)

Sousa Silva, M. ‡, Barata, L.‡, Ferreira, A. , Romão, S., Tomás, A. M., Ponces Freire, A. and Cordeiro, C.

(2008) Catalysis and Structural Properties of Leishmania infantum Glyoxalase II: Trypanothione Specificity and

Phylogeny, Biochemistry 47, 195-204. (‡ both authors contributed equally for the work)

Manuscript on mutated LiGLO2 in preparation.

CChhaapptteerr IIIIII GGllyyooxxaallaassee IIII ffrroomm LLeeiisshhmmaanniiaa iinnffaannttuumm

CChhaapptteerr IIIIII

5599

11.. SSuummmmaarryy

The glyoxalase pathway catalyses the formation of D-lactate from methylglyoxal, a toxic by-

product of glycolysis. In trypanosomatids, trypanothione replaces glutathione in this pathway,

making it a potential drug target, since its selective inhibition might increase methylglyoxal

concentration in the parasites. Of the two enzymes involved in the glyoxalase pathway, glyoxalase I

and glyoxalase II, the latter shows absolute specificity towards trypanothione thiolester, making

this enzyme an outstanding model to understand the molecular basis of trypanothione binding.

Cloned glyoxalase II from Leishmania infantum was over-expressed in E. coli, purified and

crystallised. Crystals belong to space group C2221 (a = 65.6, b = 88.3, c = 85.2 Å) and diffract beyond

2.15 Å using synchrotron radiation Two glyoxalase II structures were solved by Molecular

Replacement using the human glyoxalase II structure as a search model. One with a bound

spermidine molecule (1.8 Å) and the other with D-lactate at the active site (1.9 Å). The second

structure was obtained by crystal soaking with the enzyme substrate S-D-lactoyltrypanothione.

Overall structure of L. infantum is very similar to its human counterpart, with important differences

at the substrate binding site. The crystal structure of L. infantum glyoxalase II (LiGLO2) is the first

structure of this enzyme from trypanosomatids. The differential specificity of glyoxalase II towards

glutathione and trypanothione moieties was revealed by the differential substrate binding.

Evolutionary analysis shows that trypanosomatid glyoxalases II diverged early from eukaryotic

enzymes, being unrelated to prokaryotic proteins.

Native LiGLO2 revealed crucial differences relatively to the human homologue, namely at

the substrate-binding residues. Here we report the identification of the essential residues for S-D-

lactoyltrypanothione binding, Tyr291 and Cys294, and their mutation to the corresponding residues

in the human enzyme interacting with S-D-lactoylglutathione, Arg249 and Lys252, respectively.

LiGLO2 substrate-specificity changed and the mutated enzyme was able to hydrolyse the

glutathione-derived thiolester. New kinetic parameters for both glutathione- and trypanothione-

derived substrates were determined and metal analysis was undertaken. This study allowed a

detailed analysis of a model trypanosomatid glyoxalase II concerning the essential residues for

substrate specificity.


6600


The trypanosomatids are the etiological agents of several human and animal diseases,

widespread in the third world and in the Mediterranean basin. Emergent target populations for

leishmaniasis are HIV patients and people following immunosupressor therapies. No curative

drugs or vaccines currently exist and actual therapeutic approaches are becoming limited given

their undesirable side effects and the evolution of resistant forms of trypanosomatids. Novel and

effective therapeutic approaches are much needed and these must rely on unique physiological and

biochemical properties of trypanosomatids. These intracellular eukaryotic parasites have a complex

life cycle, requiring an insect vector for transmission to a mammalian host. Unique cytological

features are the presence of a single large mitochondrion containing the kinetoplast DNA and a

singular compartment, the glycosome, where the major part of glycolysis takes place (Michels et al.

2000; Hannaert et al. 2003). However, the most remarkable biochemical characteristic of

trypanosomatids is the functional replacement of glutathione by trypanothione (N1,N8-

bis(glutathionyl)-spermidine), a spermidine-glutathione conjugate (Muller et al. 2003; Flohe et al.

1999). This thiol fulfils the role of glutathione in the detoxification of metals, drugs, hydroperoxides,

peroxynitrite, and ketoaldehydes (Krauth-Siegel et al. 2005). Glutathione-dependent enzymes in

trypanosomatids are replaced by functionally analogue enzymes that specifically use

trypanothione. For instance, trypanothione reductase replaces glutathione reductase, while

thioredoxin dependent processes are replaced by the tryparedoxin system (Flohe 1999). Not

surprisingly, trypanothione is essential and therefore, targeting its biosynthesis or trypanothione

dependent enzymes with inhibitors will provide a synergistic effect with deleterious consequences

to the parasite, while leaving unaffected the host glutathione dependent processes. To achieve this

goal, the focus should be placed on researching the molecular basis of trypanothione specificity. An

ideal model is glyoxalase II, an enzyme from the glyoxalase system. Through the sequential action

of glyoxalase I (lactoylglutathione lyase, EC 4.4.1.5) and glyoxalase II (hydroxyacyl glutathione

hydrolase, EC 3.1.2.6), D-lactate is produced from methylglyoxal using glutathione in every living

cell (Thornalley 1990), except in trypanosomatids where the thiol is trypanothione (Vickers et al.

2004; Irsch & Krauth-Siegel 2004; Sousa Silva et al. 2005). Glyoxalase I catalyses the formation of

lactoyltrypanothione from the hemithioacetal formed non-enzymatically from methylglyoxal and

trypanothione, while glyoxalase II hydrolyses this thiolester forming D-lactate, regenerating

trypanothione. Both enzymes catalyse virtually irreversible reactions and glyoxalase II shows


6611

absolute specificity towards the trypanothione moiety in lactoyltrypanothione (Irsch & Krauth-

Siegel 2004; Sousa Silva et al. 2005).

In the present study, recombinant L. infantum GLO2 (LiGLO2) was cloned, purified,

crystallised and kinetically characterised. Its crystal structure was solved by molecular replacement,

using the crystal structure of the glutathione-dependent human glyoxalase II (Cameron et al. 1999).

LiGLO2 is a 295 amino acid monomeric metalloprotein, arranged in two domains. Its structure is

similar to the whole structure of the human homologue (PDB entry 1QH3 (Cameron et al.

1999).Several highly conserved residues are shared by the trypanosomatid and human glyoxalases

II at the active site. This is not surprising since the catalysed reaction is chemically identical and

both are metallo-β-lactamases containing zinc or iron at the active site. However, some residues are

unique to the trypanosomatid enzyme and their location close to the active site explains the

differential substrate specificity. Trypanosomatids lack the Lys143, Arg249, and Lys252 responsible

for glutathione binding in human GLO2, while LiGLO2 has Ile171 (absent from the human enzyme)

and both Phe219 and Phe266 strategically positioned to bind the spermidine moiety of the thiolester

(Sousa Silva et al. 2008) and absent from the binding site in the human structure. Two of the

residues identified as determinant for glutathione binding, Arg249 and Lys252 in the human

homologue enzyme, correspond to the L. infantum substrate binding site residues Tyr291 and

Cys294, respectively. In this work, we also report the double mutation, Y291R and C294K in

LiGLO2. The mutant LiGLO2 was subsequently cloned, expressed, purified and kinetically

characterised.

This is the first report of the glyoxalase II structure from a trypanosomatid. The presence of

an extra density compatible with a spermidine molecule bound close to the active site and the

characterization of the mutated form of the enzyme allowed us to understand why trypanosomatid

glyoxalases II are specific towards trypanothione-derived substrates, approaching a full insight into

the glyoxalase pathway along evolution.


6622

33.. MMaatteerriiaall aanndd MMeetthhooddss

33..11.. LLiiGGLLOO22 cclloonniinngg:: nnaattiivvee aanndd mmuuttaanntt ffoorrmmss

The native (LiGLO2) and the mutant form (LiGLO2m) of glyoxalase II gene were amplified

from L. infantum (clone MHOM/MA67ITMAP263) genomic DNA by PCR with specific primers.

The sense primer (5’-ccgcgcacatatgcgcaactactgcac-3’) contained the Nde I site (underlined) and the

start ATG (italic). The anti-sense primer (5’-caccgctcgagtcagtcgcaggcgttgt-3’ for the native form, and

5’-caccgctcgagtcagtccttggcgttgcgaaggtacatcatcagcgc-3’ for the mutant form, with the altered

nucleotides indicated in bold) contained the Xho I site (underlined) immediately after the stop

codon. The genes were amplified using the PWO polymerase (GibcoBRL), as follows: 94 °C for 2

min, 48 ºC for 1 min, 72 °C for 1 min – 2 cycles; 94 °C for 45 sec, 62 °C for 1 min, 72 °C for 1 min – 30

cycles; 72 °C for 10 min. Both genes were cloned into the prokaryotic expression vector pET-28a

(Novagen), using the referred restriction sites, and E. coli BL21-codon plus (Stratagene) were

transformed with the pET-28a/His6-LiGLO2 and pET-28a/His6-LiGLO2m plasmids. Sequencing of

both open reading frames was carried out prior to protein expression.

33..22.. PPrrootteeiinn eexxpprreessssiioonn aanndd ppuurriiffiiccaattiioonn

For over-expression of His6-LiGLO2 and His6-LiGLO2m (fusion proteins, with an N-terminal

tail of six histidines and a thrombin cleavage site; total tag sequence including linker and cleavage

site (underlined) is MGSSHHHHHHSSGLVPRGSH), transformants were grown in 3 L of LB

medium containing 50 µg.ml-1 kanamycin and 34 µg.ml-1 chloramphenicol, at 37 ºC. When the

culture reached an OD600nm of 0.6, expression was induced with 0.2 mM isopropyl-β-D-

thiogalactopyranoside (IPTG), for 3 hours at 37 °C. After induction, cells were harvested by

centrifugation at 7800 g for 30 min at 4 °C, and the cell pellets were frozen at -20 °C.

LiGLO2 cell pellet was resuspended in 120 ml 500 mM NaCl, 20 mM Tris-HCl pH 7.6, lysed

by sonication and the cell debris removed by centrifugation at 10.000 ×g for 30 min at 4°C. The

fusion protein was purified at 4 °C by chromatography on a His Bind resin (Novagen) column (XK

26/20; Amersham Pharmacia Biotech, Uppsala, Sweden). His-LiGLO2 was eluted with an imidazole

gradient from 5 mM to 1 M at a flow rate of 2.5 ml.min-1. Fractions confirmed to contain LiGLO2 by


6633

SDS-PAGE were pooled, applied to PD-10 columns (Amersham Biosciences) and eluted with 1x PBS

pH 7.4. His6-LiGLO2 was concentrated using Amicon® Ultra-4 filters (10,000 NMWL, Millipore

Corporation) and further purified by FPLC, with a LKB 2050 pump (LKB-Bromma) using a

SuperdexTM 75 10/300 GL column (Amersham Biosciences), and a Jasco UV-2075 Plus detector at

280 nm, with a flow of 0.4 mL.min-1, in 150 mM NaCl and 20 mM KH2PO4. Protein concentration

was determined using the Bio-Rad protein assay dye reagent (Bio-Rad).

Ressuspension of LiGLO2m required an optimised buffer. The cell pellet of LiGLO2m was

suspended in 10 ml of buffer A (30 mM Tris pH 8.5, 100 mM NaCl, 5mM β-mercaptoethanol, 5mM

MgCl2, all chemicals were obtained from Carl Roth) per g of wet cell pellet. Buffer A was optimised

by ligand-assisted monitoring of thermal protein unfolding in a ThermoFluor (Biorad) experiment

(Ericsson et al. 2006), which showed to be crucial for purification improvement. 5 µl 50 × Sypro

Orange (fluorophore; Invitrogen), 5 µl of 1 mg/ml protein and 40 µl of each buffer were mixed in a

96-well thin-wall PCR plate (Bio-Rad). The plate was heated (4 to 95 °C) in increments of 0.5 °C and

fluorescence detected in a ThermoFluor ICycler IQ thermal cycler (Bio-Rad). Two screens were

performed: a pH versus NaCl concentration screen and an additives screen using 50mM Tris-HCl

pH 8.5 as the basis buffer. After ressuspension, cells were lysed by sonication. The soluble fraction

obtained by centrifugation at 38000 g for 40 min at 4°C was filtered through a 0.22 µm membrane,

before being applied to a cobalt-charged affinity column for purification at room temperature. The

fusion protein was eluted in buffer A supplemented with an optimised concentration of 300 mM

imidazole, and then directly applied to a gel filtration column (Superdex S75 16/60, GE Healthcare)

equilibrated with buffer A for further purification. The protein was concentrated using a Vivaspin15

(molecular weight cutoff 10000) concentrator (Sartorius Stedim Biotech, Göttingen, Germany).

Protein concentration was determined using a Peqlab Biotechnologie GmbH NanoDrop® ND-1000

Spectrometer at 280 nm, assuming an estimated extinction coefficient of 22015 M-1 cm-1 for the

mutant form of LiGLO2, as calculated by ProtParam tool (Gasteiger et al., 2005) for a protein

molecular weight of 33.4 kDa.

The purity of His6-LiGLO2 and His6-LiGLO2m was ≥95 %, as estimated by SDS-PAGE and

gel filtration chromatography. To confirm the mutated protein identity, protein bands

corresponding to the mutated LiGLO2 were manually excised from SDS-PAGE gels. Trypsin

digestion and peptide mixture analysis by MALDI-TOF-MS were performed at the EMBL

Proteomics Core Facility.


6644

33..33.. CCrryyssttaalllliizzaattiioonn

Crystallization conditions were obtained for native LiGLO2 with an in house screen of 80

conditions, at 20 °C, applying the hanging-drop vapour-diffusion method using the crystallization

tools from Nextal Biotechnologie. Drops were prepared by mixing 2 µl of protein solution with 2 µl

of each precipitant solution. Several conditions in the crystallization screen produced crystals.

Crystals were obtained in various conditions including PEG ranging from 400 to 8000, MES or

MOPS with pH between 5.5 and 7.0 and sodium or ammonium acetate. The best crystals were

obtained by mixing 1 µl of 25 mg.ml-1 recombinant glyoxalase II in 10 mM Hepes pH 7.0 with 2 µl of

a reservoir solution containing 30 %(w/v) PEG 8000, 0.2 M magnesium chloride and 0.1 M acetate

pH 5.5. This final crystallization conditions resulted in thick plates, which grew within 2 days to

their maximum dimension, approximately 0.16 x 0.06 x 0.02 mm at 15 °C (Figure III.2.).

33..44.. DDaattaa ccoolllleeccttiioonn aanndd ccrryyssttaall ssttrruuccttuurree ddeetteerrmmiinnaattiioonn

All data was collected at 100K. A low-resolution data set was collected in-house, using a

MAR-Research image plate detector. A high resolution native data set was collected at 100K at

beamline ID14-1 and at beamline ID23-1, at the European Synchrotron Radiation Facility (ESRF) in

Grenoble (France) using an ADSC Quantum4R CCD detector. The crystal diffracted beyond 2.15 Å.

The diffraction experiments showed that glyoxalase II crystals belong to space group C2221, with

unit-cell parameters a = 65.7, b = 88.3 and c = 85.2 Å. The data were processed using MOSFLM 6.2.5.

(Leslie 1992) and scaled using SCALA from the CCP4 program package version 6.0 (The CCP4 suite:

programs for protein crystallography 1994). In order to estimate the protein content of the

asymmetric unit, the Matthews coefficient, VM (Matthews 1968) and solvent content were calculated

based on a subunit molecular weight of 32.5 kDa (predicted from sequence). The structures were

solved by molecular replacement using the structure of the human homologue (PDB code 1QH3

(Cameron et al. 1999)) as a search model and the program Phaser (Read 2001) from the CCP4 suite.

Manual model-building was performed using COOT (Emsley & Cowtan 2004). Refmac5

(Murshudov et al. 1998) and all data were used for refinement. TLS refinement cycles (using TLS

Motion Determination (Painter & Merritt 2006) were combined with validation and model-building.

Water molecules were located with COOT and refined using ArpWarp from the CCP4 suite. All

molecular graphic images were generated using the UCSF Chimera (Pettersen et al. 2004).


6655

33..55.. MMeettaall aannaallyyssiiss ooff rreeccoommbbiinnaanntt nnaattiivvee aanndd mmuuttaanntt ggllyyooxxaallaassee IIII

Metal analysis was carried out by Inductively-Coupled Plasma (ICP) emission spectroscopy

(Faires 1993). Both native and mutant protein forms of LiGLO2 were analysed for iron and zinc

using a Jobin Yvon-Ultima ICP spectrometer available at the Atomic Emission Spectrometry Service

(ICP) from the Faculdade de Ciências e Tecnologia, Universidade Nova de Lisboa, Portugal. A total

of 30 crystals of the native protein were harvested, dissolved in 1 ml type I-H2O and analysed. The

mutant LiGLO2 was analysed in solution at a concentration of 50 µg/ml.

33..66.. EEnnzzyymmee aaccttiivviittyy aassssaayyss

High purity methylglyoxal was prepared by acid hydrolysis of methylglyoxal 1,1-dimethyl

acetal, followed by fractional distillation under reduced pressure in nitrogen atmosphere, as

described (Sousa Silva et al. 2005). Oxidised trypanothione (TS2, Bachem) and glutathionyl-

spermidine (GspdSH, Bachem) were reduced with dithiothreitol, in the proportion of 1 mM of thiol

to 3.2 mM dithiothreitol, as reported (Sousa Silva et al. 2005), immediately prior to reaction. S-D-

Lactoyltrypanothione (SDL-TSH) and S-D-lactoylglutathionylspermidine (SDL-GspdSH) were

immediately prepared from the correspondent reduced thiol (T(SH)2 or GspdSH) and

methylglyoxal, using yeast glyoxalase I (2.5 U, Sigma). Methylglyoxal was added in excess (3.34

mM in a 2-ml reaction system), and the hemithioacetal concentration was calculated using the value

of 3.0 mM for the dissociation constant (Vander Jagt et al. 1972). Glyoxalase I assay was performed

at 30 ºC in a 2-ml reaction volume, in 0.1 M potassium phosphate buffer, pH 7.0. The assay was

performed on an Agilent HP 8453 diode array spectrophotometer, with temperature control and

magnetic stirring in the cuvette. The reaction was started by the addition of yeast Glx I. The

formation of the thiolester was followed at 240 nm, and its concentration was calculated using a ε240

of 6.5 mM-1cm-1 for SDL-TSH, a ε240nm of 3.3 mM-1cm-1 for SDL-GspdSH (the same values reported

for bis-lactoylglutathione and for mono-lactoyltrypanothione, respectively (Irsch & Krauth-Siegel

2004)), and a ε240nm of 2.86 mM-1cm-1 for SDL-GSH (Vander Jagt et al. 1975). For the native LiGLO2

concentrations of SDL-T(SH)2 between 0.025 and 0.26 mM, and of SDL-GspdSH between 0.05 and

0.48 mM, were prepared. Activity with SDL-GSH (Sigma) was also assayed for the native form of

the enzyme, with two thiolester concentrations (0.5 and 1.0 mM). For the mutant LiGLO2

concentrations of SDL-T(SH)2 between 0.05 and 0.20 mM, and of SDL-GSH (SDL-GSH, Sigma)


6666

between 0.05 and 1.0 mM were prepared. Glyoxalase I was removed after completing the reaction

using Amicon® Ultra-4 filters (10,000 NMWL, Millipore Corporation). The recovered solution was

used for the activity assay of both forms of L. infantum recombinant glyoxalase II (2 µg), in the same

reaction conditions. The hydrolysis of all thiolesters was followed at 240 nm.

33..77.. DDeetteerrmmiinnaattiioonn ooff kkiinneettiicc ppaarraammeetteerrss

Single-substrate Michaelis-Menten equation parameters for glyoxalase II (Km and V) were

determined by initial-rate and time-course analysis. Non-weighted hyperbolic regression by the

method of least squares was performed with the program Hyper32 (J.S. Easterby, University of

Liverpool, UK, available from: www.liv.ac.uk/~jse/software.html) and the limiting rate was

calculated by time-course analysis (in-house developed software, Ferreira, AEN).

33..88.. AAccttiivviittyy iinn ccrryyssttaallss

Crystals were soaked with the substrate S-D-lactoyltrypanothione. This was prepared from

5 mM of reduced trypanothione and 30 mM of methylglyoxal, in a 0.9-ml reaction system, using

commercial yeast glyoxalase I (10 U). The enzyme was removed using an Amicon® Ultra-4 filter

(10,000 NMWL, Millipore Corporation, Molsheim, France) and substrate solution was concentrated

to 100 mM. Soaking solution contained the substrate (0.5 µl) in 5 µl of 40 % PEG 8000, 2 M MgCl2

and 1M acetate pH 5.5. An intact crystal was placed in each drop of the soaking solution 30 min,

after which they were frozen in liquid nitrogen.

33..99.. EEvvoolluuttiioonnaarryy aannaallyyssiiss

Phylogenetic relationships were inferred from multiple protein sequence alignment by

ClustalW (Thompson et al. 1994), slow/accurate algorithm, using the protein weight matrix Gonnet

series (available at MegAlign from DNASTAR Lasergene package version 7). Protein sequences

used in this analysis were: L. infantum glyoxalase II characterised in this work (GenBank acc. nr.

ABC41261), L. donovani glyoxalase II (AAW52503), L. major putative glyoxalase II (CAJ02466), T.

cruzi glyoxalase II (AAL96759), T. brucei brucei glyoxalase II (CAD37800), H. sapiens glyoxalase II

(CAA62483), A. thaliana glyoxalase II (AAF19564), E. coli probable hydroxyacylglutathione

hydrolase (P0AC84), S. cerevisiae glyoxalase II (CAA71335), Canis familiaris protein similar to


6677

hydroxyacylglutathione hydrolase (XP_537013), Anopheles gambiae putative member of the metallo-

β-lactamase superfamily (XP_310681), Glossina morsitans protein fragment (Gmm-6805), Lutzomyia

longipalpis putative protein containing the conserved domain of β-lactamase superfamily (NSFM-

159f08.p1k), Aspergillus fumigatus hydroxyacylglutathione hydrolase (XP_753369),

Schizosaccharomyces pombe predicted hydroxyacylglutathione hydrolase (NP_588246). G. morsitans

and L. longipalpis protein sequences were deduced from blast searches (protein vs. translated DNA),

using the Blast Server available at the Wellcome Trust Sanger Institute web page (The Pathogen

Sequencing Unit). Sequence alignments and evolutionary analysis was performed by Marta Sousa

Silva, at the Enzymology Group, FCUL, Portugal.

44.. RReessuullttss

44..11.. TThhee LL.. iinnffaannttuumm ggllyyooxxaallaassee IIII ggeennee aanndd ddeedduucceedd pprrootteeiinn

Blast searches in the L. infantum genome on GeneDB (Hertz-Fowler et al. 2004) revealed only

one putative hydroxyacylglutathione hydrolase gene with 888 bp in length, in chromosome 12

(Table III.1). The complete LiGLO2 gene was amplified from genomic DNA of clone

MHOM/MA67ITMAP263 and the sequence was confirmed by sequencing in both directions. The

LiGLO2 sequence (GenBank acc. nr. DQ294972) shows 99.5 % identity to Leishmania donovani

(GenBank acc. nr. AY851655), 96.5 % identity to Leishmania major (GeneDB, LmjF12.0220), and 53.5

% identity with human glyoxalase II (GenBank acc. nr. Q16775).

The deduced protein sequence of 295 amino acid residues clearly identified it as a

hydroxyacylglutathione hydrolase, belonging to the metallo-β-lactamase superfamily. The

predicted molecular mass of 32.5 kDa is comparable to other trypanosomatid enzymes (L. major, L.

donovani and T. brucei), but larger than the 29 kDa human glyoxalase II.

The isoelectric point (pI) of L. infantum glyoxalase II, calculated from the protein sequence, is

6.2 (Table III.1), similar to the 6.0-6.5 from T. brucei (Irsch & Krauth-Siegel 2004), 6.0 for L. donovani

(Padmanabhan et al. 2005) and 6.2 for Arabidopsis thaliana (Crowder et al. 1997). The obtained value

differs from the 8.5 pI for the human glyoxalase II, determined by isoelectric focusing (Ridderstrom

et al. 1996).


6688

The L. infantum deduced protein contains the highly conserved metal binding motif

THXHXDH, common to all glyoxalases II (Figure III.1.), including human, yeast, Arabidopsis and

also present in the metallo-β-lactamase family, which are known to require Zn(II) (Concha et al.

1996; Crowder et al. 1997; Zang et al. 2001).

Table III.1. Properties of L. infantum glyoxalase II gene and protein.

*Deduced from the DNA or protein sequence. **Experimental data from purified recombinant His-tagged

protein. †Previously obtained value (Sousa Silva et al. 2005).

GenBank accession numbers

Gene: Protein:

DQ294972 ABC41261

Location in the L. infantum genome

Chromosome: 12 Location: bp 98258-99145 Length: 888 bp

mRNA (start and stop codons included) * 888 bp

Amino acids * 295

Isoelectric point (without His-tag) * 6.21

Molecular mass (without His-tag) * 32.5 kDa

Bound metal ion ** Zn2+ and/or Fe2+

Substrate: S-D-lactoyltrypanothione **

Km 0.091 mM

Specific activity 0.497 U.mg-1 enzyme

kcat 1.0x103 s-1

kcat /Km 1.1x107 M-1.s-1

Activity in L. infantum promastigote extracts † 0.18 U.mg-1 protein

Substrate: S-D-lactoyl-glutathionylspermidine **

Km 0.324 mM

Specific activity 6.3 U.mg-1 enzyme

kcat 12.7x103 s-1

kcat /Km 13.9x107 M-1.s-1


6699

L. infantum - - - - M R N Y C T K T F G S A F S V T V V P T - - - - L K D N F S Y L I N D H T T H T L A A V D V 42

L. donovani - - - - M R N Y C T K T F G S A F S P T V V P T - - - - L K D N F S Y L I N D H T T H T L A A V D V 42

L. major - - - - M R N Y C T K T F G S T F S V T V V P T - - - - L K D N F S Y L I N D H T T H T L A A V D V 42

T. cruzi M H T N T M E V V V K H M G A A F S V A V I P V - - - - L K D N Y T Y I I H D K T T N T M A A V D V 46

T. brucei - - - - - M E V V V K S I G T A F T V A V I P V - - - - L K D N Y S Y V I H D K A T N T L A A V D V 41

H. sapiens - - - - - - - - - - - - - - - - M K V E V L P A - - - - L T D N Y M Y L V I D D E T K E A A I V D P 30

C. familiaris - - - - - - - - - - - - - - - - M K V E L L P A - - - - L T D N Y M Y L I I D D E T K E A G V V D P 30

A. thaliana - - - - - - - - - - - - - - - - M K I F H V P C - - - - L Q D N Y S Y L I I D E S T G D A A V V D P 30

A. gambiae - - - - - - - - - - - - - - - - M T V T K I P A - - - - L K D N F M Y L V V C N A T R Q A A V I D P 30

G. morsitans - - - - - - - - - - - - - - - - M Q V K I L P A - - - - L Q D N Y M Y L I I C G S T R E A A I V D P 30

L. longipalpis - - - - - - - - - - - - - - - - M D V K I L P A - - - - L Q D N Y M Y L I V D K A T K D A A I V D P 30

S. cerevisiae - - - - - - - - - - - - - - - - M Q V K S I K M R W E S G G V N Y C Y L L S D S K N K K S W L I D P 34

A. fumigates - - - - - - - - - - - - - - - - M H V Q S I P I - W T G K G N N Y A Y L V T D E P T K E S V I I D P 33

S. pombe - - - - - - - - - - - - - - M S F Q I L P I P M - W V G T Q D N Y A Y L L L C E E T R Q A A I V D P 35

E. coli - - - - - - - - - - - - - - - - M N L N S I P A - - - - F D D N Y I W V L N D E A G R C L I V D P G 30

E. carotovora - - - - - - - - - - - - - - - - M N L I S I P A - - - - L Q D N Y I W L L S N K A N R C V I V D P G 30

L. infantum N A D Y K P I L T Y I E E H L K Q Q G N - A D V T Y T F S T I L S T H K H W D H S G G N A K L K A E 91

L. donovani N A D Y K P I L T Y I E E H L K Q Q G N - A D V T Y T F S T I L S T H K H W D H S G G N A K L K A E 91

L. major N A D Y K P I L T Y I E E H L K Q Q G N - A D V T Y T F S T I L S T H K H W D H S G G N A K L K A E 91

T. cruzi S A D T T P I V D Y V E R I R R S I D E R G A G A M S F S T I F S T H K H W D H A G G N V V L P K A 96

T. brucei S V D I D P V I D Y V R R L G - G V D R - - - - T T D L R T I L S T H K H H D H S G G N I S L Q K K 86

H. sapiens - V Q P Q K V V D A A R K H G - - - - - - - - - - V K L T T V L T T H H H W D H A G G N E K L V K L 69

C. familiaris - V Q P Q K V V E A V K K H G - - - - - - - - - - V R L T T V L T T H H H W D H A G G N E K L V K L 69

A. thaliana - V D P E K V I A S A E K H Q - - - - - - - - - - A K I K F V L T T H H H W D H A G G N E K I K Q L 69

A. gambiae - V E P A R V L E V A R E Q G - - - - - - - - - - C K L N Q L L T T H H H W D H A G G N E A L C E Q 69

G. morsitans - V Y P D T V L Q A V K D E N - - - - - - - - - - V K L K K V L T T H H H W D H A G G N E K L L Q M 69

L. longipalpis - V D P P S V L Q A V E E E K - - - - - - - - - - V N L V K V L T T H H H W D H A G G N E K L V K D 69

S. cerevisiae - A E P P E V L P E L T E D E - - - - - - - - - K I S V E A I V N T H H H Y D H A D G N A D I L K Y 74

A. fumigatus - A N P P E V A P E L D A Q I K A G - - - - - - K I K L S A I V N T H H H W D H A G G N N E M L K H 76

S. pombe - A E V N V V M P I L K K K L K N K - - - - - - E I D L Q A I L T T H H H A D H S G G N L N L K K E 78

E. coli - - D A E P V L N A I A A N N - - - - - - - - - - W Q P E A I F L T H H H H D H V G G - - - V K E L 65

E. carotovora - - E A S P V L N A L D Q N A - - - - - - - - - - L L P E A I L L T H H H N D H V G G - - - V S E I 65

M

2

M

2

M

1

M

1

L. infantum L E A M N S T V P V V V V G G A N D S I P A V T K P V R E G D R V Q V G D - L S V E V I D A P C H T 140

L. donovani L E A M N S T V P V V V V G G A N D S I P A V T K P V R E G D R V Q V G D - L S V E V I D A P C H T 140

L. major L E A M N S M V P V M V V G G A N D G I P A V T K P V R E G D R V Q V G N - L S V E V I D A P C H T 140

T. cruzi L K A A G A F R - - - I I G G V N D N I S G V T Q T V R E G D R L S L G A - L Q V E V L E A P C H T 142

T. brucei L N A M G A F R - - - I I G G A N E P I P G V T E K V R E G D H F S I G E - L K V D V L D A P C H T 132

H. sapiens E S - - - - - - G L K V Y G G D D - R I G A L T H K I T H L S T L Q V G S - L N V K C L A T P C H T 111

C. familiaris E P - - - - - - G L K V C G G D D - R I G A L T Q K V T H L S T L Q V G S - L N V K C L S T P C H T 111

A. thaliana V P - - - - - - D I K V Y G G S L D K V K G C T D A V D N G D K L T L G Q D I N I L A L H T P C H T 113

A. gambiae Y R Q H A D W G Q L T V Y G G D D E R I P G L T N R V G Q D D T F A I G Q - L R V R C L A T P C H T 118

G. morsitans F S - - - - - L P L E V Y G G D N - R I G G L N C M V K Q N D H L K I G N - L D V T C L F T P C H T 112

L. longipalpis F Q K - - - - G P L E V F G G D D - R I G A L T K K V G D G D T F K I G N - L S V R C L F T P C H T 113

S. cerevisiae L K E K N P T S K V E V I G G S K - D C P K V T I I P E N L K K L H L G D - L E I T C I R T P C H T 122

A. fumigatus F G - - - - - - K L P V I G G - R - N C Q S V T Q T P A H G E T F K I G E R I S V K A L H T P C H T 118

S. pombe F P - - - - - - H V T I Y G G - S - D Q N G V S H V L Q D K E T L R I G N - V Q I E A L H T P C H T 119

E. coli V E K F P Q I V - - - V Y G P Q E T Q D K G T T Q V V K D G E T A F V L G - H E F S V I A T P G H T 111

E. carotovora L N H Y P N L P - - - V F G P K E T A K C G A T Y L V E E G N T V S L L N - S E F S V I E V P G H T 111

M

2

L. infantum R G H V L Y K V Q H P Q H P N D G V A L F T G D T M F I A G I G A F F E G D E K D M C R A M E K V Y 190

L. donovani R G H V L Y K V Q H P Q H P N D G V A L F T G D T M F I A G I G A F F E G D E K D M C R A M E K V Y 190

L. major R G H V L Y K V Q H P Q H P N D G V A L F T G D T M F I A G I G A F F E G D E K D M C R A M E K V Y 190

T. cruzi R G H V L Y K V Y H P Q A E K D G V A L F T G D T M F V G G I G A F F E G D A A H M C R A L R K V Y 192

T. brucei S G H V L Y K V Y H P Q K A E N G I A L F T G D T M F V G G I G A F F E G D A V L M C S A L R K V Y 182

H. sapiens S G H I C Y F V S K P G G S E - P P A V F T G D T L F V A G C G K F Y E G T A D E M C K A L L E V L 160

C. familiaris S G H I C Y F V S K P N S S E - P P A V F T G D T L F V A G C G K F Y E G T A D E M Y R A L L E V L 160

A. thaliana K G H I S Y Y V N G K E G E - - N P A V F T G D T L F V A G C G K F F E G T A E Q M Y Q S L C V T L 161

A. gambiae T S H V C Y Y V E G G D R G - - E R A V F T G D T L F L A G C G R F F E G T P D Q M Y D A L I G K L 166

G. morsitans W G H I C Y Y V Q S S T G - - - D R Y V L T G D T L F H G G C G 141

L. longipalpis T G H I C Y Y V Q S N D - - - - E G A V F T G D T L F S A G C G R F F E G T P E Q M Y A A L V D K L 159

S. cerevisiae R D S I C Y Y V K D P T - - T D E R C I F T G D T L F T A G C G R F F E G T G E E M D I A L N N S I 170

A. fumigatus Q D S I C Y Y M Q D - - - - G D E K V V F T G D T L F I A G C G R F F E G N A Q E M H K A L N E T L 164

S. pombe R D S I C F Y A H S - - - - S N E H A V F T G D T L F N A G C G R F F E G T A A E M H I A L N A V L 165

E. coli L G H I C Y F S K P - - - - - - - - Y L F C G D T L F S G G C G R L F E G T A S Q M Y Q S L K K L S 153

E. carotovora S G H I A Y Y N A P - - - - - - - - F L F C G D T L F S A G C G R I F E G T P K Q M Y E S I Q K I A 153

M

1

2

‡


7700

Figure III.1. Sequence comparison between L. infantum and other GLO2 enzymes. The sequences were

aligned using ClustalW (Thompson et al. 1994), available at MegAlign from DNASTAR Lasergene package

version 7. GLO2 sequences used in this alignment are mentioned in section 3.9. from this chapter. Residues in

grey boxes are conserved in at least twelve of the sixteen sequences. Residues of conserved binding motif

THXHXDH are in bold and in a box. Residues responsible for spermidine fixation in L. infantum sequence are

marked (*). M1, M2 and M1,2 indicate the residues in L. infantum binding the metal (Zn or Fe) 1, 2 or both,

respectively. Residues marked with † are responsible for the GSH binding in H. sapiens GLO2. The indicated

secondary structure is LiGLO2.

L. infantum H I H - - - - - - - - K G N D - Y A L D K V T F I F P G H E Y T S G F M T F S E K T F P D R A S D D 231

L. donovani H I H - - - - - - - - K G N D - Y A L D K V T F I F P G H E Y T S G F M T F S E K T F P D R A S D D 231

L. major H I H - - - - - - - - K G N D - Y A L D K V T F I F P G H E Y T A G F M T F S E K T F P D R A S N E 231

T. cruzi N L H - - - - - - - H N A T D K E E A D R R T F V F P G H E Y T V N F L Q F A R D T I P P - A H P D 234

T. brucei N L N G A C E S S A C D A T D V Q K R D N H T Y I F P G H E Y T V N F L R F S R D A L P A - S H P D 231

H. sapiens G R L P - - - - - - - - - - - - - - - - P D T R V Y C G H E Y T I N N L K F A R H V E P G - - - - - 189

C. familiaris G R L P - - - - - - - - - - - - - - - - P D T R V Y C G H E Y T I N T F K F A R H V E P S - - - - - 189

A. thaliana A A L P - - - - - - - - - - - - - - - - K P T Q V Y C G H E Y T V K N L E F A L T V E P N - - - - - 190

A. gambiae S A L P - - - - - - - - - - - - - - - - D D T R V Y C G H E Y A L Q N L R F G H Q V E P D - - - - - 195

G. morsitans 141

L. longipalpis S A L P - - - - - - - - - - - - - - - - D E T K V F C G H E Y T A S N L K Y A K H V E P A - - - - - 188

S. cerevisiae L E T V G - - - - - - - - - - - R Q N W S K T R V Y P G H E Y T S D N V K F V R K I Y P Q - - - - - 204

A. fumigatus A S L P - - - - - - - - - - - - - - - - D D T R V Y P G H E Y T R S N V K F C - - - L - T - - - - - 189

S. pombe S S L P - - - - - - - - - - - - - - - - N N T V I Y P G H E Y T K S N V K F A S - - - - K - - - - - 190

E. coli A L P - - - - - - - - - - - - - - - D D - - T L V C C A H E Y T L S N M K F A L S I L P H - - D - - 182

E. carotovora E L P - - - - - - - - - - - - - - - D D - - T V V C C A H E Y T L S N L R F S N D I W P E - - D - - 182

M

1

*‡

+ ‡

L. infantum L A F I Q A Q R A K Y A A A V K T G - D P S V P S S L A E E K R Q N L F L R V A D P A F V A K M N Q 280

L. donovani L A F I Q A Q R A K Y A A A V K T G - D P S V P S S L A E E K R Q N L F L R V A D P A F V A K M N Q 280

L. major L A F I Q A Q R A K Y A A A V K T G - D P S V P S S L A E E K L Q N L F L R V A D P A F V A K M N Q 280

T. cruzi A T F I A S Q L E R Y K E S V A Q R - K P T V P S T L A E E K R Q N L F L R T C D E S F V R E M K H 283

T. brucei V S F V E A Q L R R Y T E S V A G N - V P T V P S T L A E E K R Q N L F L R T C D E A F V R V M N K 280

H. sapiens N A A I R E K L A W A K E K Y S I G - E P T V P S T L A E E F T Y N P F M R V R E K T V Q Q H A G E 238

C. familiaris N A A V Q E K L A W A K E K Y S I G - E P T V P S T I A E E F T Y N P F M R V R E K T V Q Q H A G E 238

A. thaliana N G K I Q Q K L A W A R Q Q R Q A D - L P T I P S T L E E E L E T N P F M R V D K P E I Q E K L G C 239

A. gambiae N A D T R A L L E R A Q A A D L E G R R A L V P S T I G Q E K R I N V F M R V H Q P A V Q A Y V G K 245

G. morsitans 141

L. longipalpis N P A V E E R I Q W T K E R R D A K - L P T V P S T I G A E K S F N P F M R V N E K S V Q E H A N A 237

S. cerevisiae - V G E N K A L D E L E Q F C S K H E V T A G R F T L K D E V E F N P F M R L E D P K V Q K A A G D 253

A. fumigatus - V S Q S E P I K K L E A Y A N Q H Q Q T Q G K F T I G D E - - - - - - - - - K D P E I Q K K T G K 229

S. pombe - H L Q S E A L N H L E G L C N H N Q F I A G H I T M G Q E K Q F N P F M R V T D P E L Q K H L G L 239

E. coli - L S I N D Y Y R K V K E L R A K N - Q I T L P V I L K N E R Q I N V F L R T E D I D L I N V I N E 230

E. carotovora - P D I E S Y L H K I S Q I R E K S - Q S S L P T T L G L E R R I N L F L R C H E I D L K R K I S N 230

L. infantum G - - - - N A H A L M M Y L Y N A C D 295

L. donovani G - - - - N A H A L M M Y L Y N A C D 295

L. major G - - - - S A H A L M M Y L Y N A C D 295

T. cruzi G D - - - T A E T L M Q H L Y D T C P 299

T. brucei G E - - - T A V K L M D F L Y N T C P 296

H. sapiens T - - - - D P V T T M R A V R R E K D Q F K M P R D 260

C. familiaris T - - - - D P V T T M R A I R K E K D H F K V P R D 260

A. thaliana K - - - - S P I D T M R E V R N K K D Q W R G 258

A. gambiae G - - - - T P L E T M Q A L R A A K D K F 262

G. morsitans 141

L. longipalpis S - - - - D G V T T M G F L R R E K D S F 254

S. cerevisiae T N N S W D R A Q I M D K L R A M K N R M 274

A. fumigatus T - - - - D P V E V M A A L R E M K N A M 246

S. pombe N - - - - D P I K V M D E L R T L K N Q G 256

E. coli E T L L Q Q P E E R F A W L R S K K D R F 251

E. carotovora E P E N I E N W Q V F K M L R S K K D C F 251

‡ *‡


7711

Figure III.2 – Crystals of L. infantum

glyoxalase II.

44..22.. OOvveerr--eexxpprreessssiioonn aanndd ppuurriiffiiccaattiioonn ooff rreeccoommbbiinnaanntt ggllyyooxxaallaassee IIII

The L. infantum LiGLO2 gene was cloned into the pET-28a expression vector and this

construct transformed into E. coli BL21-codon plus cells. Small scale growth cultures were used to

optimise over-expression conditions for His-tagged glyoxalase II. Purification was performed by

metal affinity chromatography and yielded 25 mg of pure protein from 3 litres of culture. The

purity of the recombinant His-LiGLO2 was ≥95 %, as estimated by SDS-PAGE and gel-filtration

chromatography (data not shown), and the apparent molecular weight of 32 kDa was in accordance

with the 32.5 kDa deduced from the protein sequence.

44..33.. FFiinnaall ssttrruuccttuurreess

The purified protein produced thick plate crystals

within 2 days (Figure III.2.) which diffracted beyond 2.15 Å

resolution using synchrotron radiation. The crystals belong to

the space group C2221, with unit-cell parameters a = 65.7, b =

88.3 and c = 85.2 Å. Data-collection and processing statistics

are shown in Table III.2.

After further optimization of the crystal growth process, the L. infantum glyoxalase II structure

with spermidine (LiGLO2-spermidine) was refined against data extending to a dmin of 1.8 Å in space

group C2221, to an R factor of 17.2 % and a corresponding Rfree (Brunger 1992) of 19.6 %. The final

enzyme structure has 287 residues and the Matthews coefficient is 1.95 Å3Da-1, corresponding to a

solvent content of ~37 %, assuming the presence of a single molecule in the asymmetric unit (PDB

entry 2P18). Data-collection and processing statistics are given in table III.3.

0.1 mm


7722

Table III.2. – Crystal data and data-collection statistics for first used crystals. Values in parentheses are for the

highest resolution shell.

Data set In-house ESRF

Space group C2221

Unit-cell parameters (Å) a = 66.6, b = 90.1, c = 85.8 a = 65.7, b = 88.3, c = 85.2

Source in-house CuKα ID14-1

Wavelength (Å) 1.542 0.934

No. of observed reflections 170772 209900

No. of unique reflections 7294 13574

Resolution limits (Å) 30.0 - 2.7 (2.85 – 2.7) 30.0 - 2.15 (2.27 - 2.15)

Redundancy 6.0 (5.7) 5.4 (5.2)

R sym (%) 14.2 (47.7) 10.6 (42.5)

Completeness (%) 99.9 (99.9) 98.4 (98.4)

<I/σ (I)> 5.3 (1.6) 5.7 (1.7)

| |∑ ∑− (j)II(j)(j)I=R iisym / , where Ii(j) is the ith measurement of reflection j and I(j) is the overall

weighted mean of j measurements.

Table III.3. Crystallographic data collection and refinement statistics for further optimised native glyoxalase

II crystals and crystals with the product D-lactate.

Data set LiGLO2-spermidine LiGLO2-D-lactate

Space group C2221

Unit Cell Parameters (Å) a = 66.7, b = 89.0, c = 85.9 a = 67.2, b = 89.1, c = 86.0

Source ID23-1 ID23-1

Wavelength (Å) 0.954 0.954

No. of unique reflexions 23962 20692

Resolution limits (Å) 53.4 – 1.8 53.6 – 1.9

Redundancy 5.7 (5.8) 13.8 (14.1)

Rmerge † (%) 6.9 (46.8) 8.7 (48.8)

Completeness (%) 99.8 (100) 100 (100)

⟨I/σ (I)⟩ 6.5 (1.6) 5.1 (1.5)

† ∑∑∑∑ −ll lerge III=R hhhhhm / , where Il is the lth observation of reflection h and hI is the

weighted average intensity for all observations l of reflection h.


7733

Molecular replacement was done using the human glyoxalase II structure (PDB code 1QH3

Cameron et al. 1999)), which shows 35 % sequence identity with the L. infantum glyoxalase II, as a

search model and the molecular-replacement program Phaser (Read 2001). One clear solution was

obtained and the calculated phases were improved using Pirate (Cowtan 2000). A preliminary Cα

trace was manually built from the search model and is currently being rebuilt using COOT (Emsley

& Cowtan 2004) and refined with Recfmac5 from the CCP4 suite (The CCP4 suite: programs for

protein crystallography).

Associated with each protein molecule there are two metal ions, an acetate molecule and a

spermidine molecule. A total of 188 water molecules were found in the structure. The average

temperature factor of the protein is 23.9 Å2. For the final structure, the rmsd from ideal bond lengths

and bond angles was 0.015 Å and 1.519º respectively, and no outlier residues were found in the

Ramachandran plot.

L. infantum glyoxalase II is a 295 amino acid metalloprotein. Like the previously described

human glyoxalase II structure (Cameron et al. 1999), the L. infantum glyoxalase II monomer is

arranged in two domains. The N-terminal domain, including residues 1-209, has a topology of four-

layered β sandwich with two mixed β sheets of four and seven β-strands flanked by 2 long α-

helices. The first half of the sandwich folds as a ββββαβαββ motif and the second half as a ββββαβ

motif. Thus, the unit ββββαβ is common to the two halves (β1β2β3β4α1β5 and β8β9β10β11α3β12). The C-

terminal domain, including residues 210-295, is an all α-helical domain located at the edge of the N-

terminal domain. Preceding helix α6, a section of chain extends the second sheet of the N-terminal

domain by hydrogen bonding to β11. A β hairpin loop of the N-terminal domain, situated after β11,

protrudes into the C-terminal domain, making hydrogen-bonding and hydrophobic interactions

with residues on helices α4 and α6 (Figure III.3.).

The L. infantum glyoxalase II structure is similar to the whole structure of the human

homologue (PDB 1QH3 (Cameron et al. 1999)), being these structures superimposed with an rmsd

of 1.60 Å (using 191 Cα atoms). Compared to the human glyoxalase II, L. infantum glyoxalase II has

one extra β strand at the N-terminal and an extra α helix at the C-terminal domain. As a

consequence, the referred ββββαβ motif, common to the two halves of the sandwich, is slightly

longer than the human homologue, but identical to the one on other metallo-β-lactamases (Carfi et

al. 1995).


7744

Figure III.3. Comparison of the overall structure and active site of L. infantum and human glyoxalase II. L.

infantum (A, rainbow colour) and human glyoxalase II (grey) superimpose (B) with a root mean square

deviation of 1.60 Å (using 191 Cα atoms); arrows point the β-sheet and α-helix present in LiGLO2-spermidine

and not in the human glyoxalase II. (C) Detail of superposition of the active site of the two structures showing

the high homology of the active site. Metals (M1 and M2) are coordinated by the same residues; identified

residues are from L. infantum. The figure was prepared using UCSF Chimera (Pettersen et al. 2004).

C

A B

M2

M1

Asp80

His139

His78

His76

His81

His210 Asp164


7755

A crystal structure containing D-lactate in the active site (LiGLO2-D-lactate), one of the

reaction products, was obtained after soaking 30 minutes with the substrate (Figure III.4.).

Figure III.4. Detail of the structure of L. infantum with D-lactate (LiGLO2-D-lactate) located at the active site.

Residues from the active site interacting with the metals (M1 and M2) and with the D-lactate molecule are

shown. The figure was prepared in UCSF Chimera (Pettersen et al. 2004).

Hence, the protein remained active in the crystal form. As the previous crystals, this crystal

belonged to the space group C2221, with unit-cell parameters approximately identical to the ones

reported previously: a = 67.2 Å, b = 89.1 Å e c = 86.0 Å. Matthews coefficient was 1.97 Å3Da-1,

corresponding to a solvent content of ~38 %, assuming the presence of a single molecule in the

asymmetric unit (PDB 2P1E). The L. infantum glyoxalase II structure containing D-lactate was

refined against data extending to a dmin of 1.9 Å to an R factor of 18.3 %, and corresponding Rfree of

22.0 %. The final structure containing D-lactate is very similar to the native L. infantum glyoxalase II

model and has an average temperature factor of 26.2 Å2. The average temperature factor of the D-

lactate molecule was 30.1 Å2 and this molecule was located between the two metal ions, separated

by 3.58 Å. It was bound to both metals through its O3 atom, at distances 2.30 Å and 2.68 Å from

metal 1 and 2, respectively. The bridge established by this latter atom replaces the water molecule

present in the LiGLO2-spermidine structure. The D-lactate was also bound to metal 1 through its O1

and O2 atoms, at distances 2.87 Å and 2.14 Å, respectively, which replaces the bridge established by

the acetate molecule oxygen atoms in the LiGLO2-spermidine structure. This is the only major

change provoked by the insertion of D-lactate in the structure. There are a total of 102 water

Asp80

His139

His78

His76

His81

D-Lactate

M1

M2

His210

Asp164


7766

molecules in this structure. For the final structure, the rmsd from ideal bond lengths and angles

distances was 0.016 Å and 1.540º, respectively, and no outlier residues were found in a stringent

boundary Ramachandran plot.

44..44.. TThhee aaccttiivvee ssiittee

Previous sequence analysis revealed the presence of the highly conserved metal binding

motif THXHXDH in trypanosomatid and all other glyoxalase II proteins (Figure III.1.). The active

site extends across the domain interface and harbours a metal binding-site. There was clear electron

density for a binuclear metal binding-site in the domain interface. The average temperature factor of

each zinc atom was 17 and 18 Å2, whereas for each iron atom was 15 Å2. Metal analysis (ICP)

showed a 1:2 zinc:iron ratio, suggesting that iron could be the main metal present in the active site,

contrary to the results obtained by measuring the temperature factor. Both data indicate that this

enzyme is able to bind either zinc or iron. In T. brucei glyoxalase II, sequence analysis pointed to

zinc as the main metal (Irsch & Krauth-Siegel 2004), as well as metal analysis in glyoxalase II from

A. thaliana, being this zinc:iron binuclear centre, essential for substrate binding and catalysis, was

reported (Zang et al. 2001). Although the human glyoxalase II structure revealed the presence of two

zinc ions, it was also not possible to discriminate between zinc and iron (Cameron et al. 1999).

The two metals from the L. infantum glyoxalase II structure, separated by 3.32 Å, are

coordinated by seven amino acid residues from 3 different regions of the N-terminal domain, and

bridged by an acetate molecule, a water molecule and Asp164. This latter residue seems to be in a

more favourable position for metal 1 coordination than for metal 2, as the Asp164 oxygen atom is

further away from metal 2 (2.51 Å) than from metal 1 (2.09 Å). Metal 1 interacts with Asp80 (2.26 Å),

His81 (2.10 Å), Asp164 (2.09 Å), His210 (2.08 Å), whereas metal 2 is coordinated by His76 (2.27 Å),

His78 (2.13 Å), His139 (2.06 Å) and Asp164 (2.51 Å), (Figure III.5.). This characteristic tetrahedral

coordination to each metal is identical to the one reported to the human glyoxalase II structure

when bound to a glutathione analogue (Cameron et al. 1999).


7777

Figure III.5. L. infantum glyoxalase II substrate binding site (LiGLO2-spermidine). Detail of the active site

showing the residues interacting with the metals (M1 and M2) and the spermidine molecule (SPD), with

overlaid electron density contoured at 1 σ (omit map computed without both metals and the spermidine

molecule. The figure was prepared in CCP4mg (Potterton et al. 2002; Potterton et al. 2004).

44..55.. TThhee ssuubbssttrraattee--bbiinnddiinngg ssiittee

The thiol replacement in the glyoxalase system of trypanosomatids suggests that these

enzymes are different from all other eukaryotic glyoxalases. Indeed, the human glyoxalase II

structure revealed three conserved basic residues involved in thiolester binding, Arg249, Lys143

and Lys252 (Cameron et al. 1999), also present in almost all eukaryotic glyoxalases II. These residues

are neither found in L. infantum protein, nor in the proteins from T. brucei or other kinetoplastid

organisms (Irsch & Krauth-Siegel 2004). L. infantum glyoxalase II does not use lactoylglutathione as

substrate, as confirmed by direct assay at 240 nm and by the more sensitive DTNB assay. A

spermidine molecule was bound to the recombinant L. infantum enzyme and crystallised close to the

active site. This molecule has an average temperature factor of 25.8 Å2 and interacts with Ile171,

Ala173, Tyr212, Phe219 and Phe266 (Figure III.4.). Curiously, the Phe266 residue, interacting with


7788

the spermidine, is present in the extra α helix at the C-terminal domain from the L. infantum

glyoxalase II. Although it also exists in the human glyoxalase II (Phe224), this residue does not seem

to interact with the substrate in this enzyme.

44..66.. LLiiGGLLOO22 kkiinneettiiccss:: ssppeecciiffiicciittyy ffoorr tthhiioolleesstteerrss ooff SSPPDD--GGSSHH ccoonnjjuuggaatteess

In cell-free extracts, L. infantum glyoxalase II is highly specific for S-D-lactoyltrypanothione

and does not show activity with S-D-lactoylglutathione (Sousa Silva et al. 2005). Structural data

revealed a spermidine molecule accommodated in the substrate-binding site. It might be possible

that the glutathionyl-spermidine derived thiolester is also a substrate. Recombinant LiGLO2 was

assayed for both trypanothione- and glutathionyl-spermidine-derived thiolesters. With

bis(lactoyl)trypanothione as substrate, a Km of 0.091 mM and a kcat of 1.0x103 s-1 were determined

(Table III.1), in good agreement with results obtained in cell free extracts (Sousa Silva et al. 2005).

When the substrate is the glutathionyl-spermidine-derived thiolester, a Km of 0.32 mM and a kcat of

1.27x104 s-1 were obtained (Table III.1). As expected, no activity was detected with S-D-

lactoylglutathione. Results confirmed that the LiGLO2 shows specific affinity towards spermidine-

glutathione conjugate-derived thiolesters. Although kinetics point to the glutathionyl-spermidine-

derived thiolester as the preferred substrate, glutathionyl-spermidine exists in L. infantum in much

lower concentration than trypanothione (unpublished results), being the lactoyltrypanothione the

most probable physiological substrate for LiGLO2.

44..77.. MMuuttaanntt ffoorrmm ooff LLiiGGLLOO22

A mutant form of LiGLO2 was produced in order to evaluate the importance of residues

Tyr291 and Cys294 in the catalytic mechanism of L. infantum glyoxalase II and investigate substrate

specificity in this enzyme. Therefore, these residues were replaced by arginine and lysine,

respectively, by direct mutagenesis.

The purification process of mutated LiGLO2 yielded 11.4 mg of protein per litter of culture,

high enough to make the protein available for further biochemical and structural studies. The

enzyme was purified by cobalt-affinity chromatography and gel filtration, achieving about 95 %

purity and the expected molecular mass, as estimated by SDS–PAGE (Figure III.6.).


7799

Figure III.6. Analysis of purified recombinant LiGLO2 by SDS-PAGE. From total cell content (T), the soluble fraction

(S) containing expressed protein was loaded into a cobalt-NTA affinity column. Flow-through (FT), eluted fraction (E)

and purified mutated LiGLO2 fractions collected from the gel filtration column (GF Fractions) were analysed by

Coomassie-stained 12 % SDS-PAGE. M, Molecular weight marker (Carl Roth) positions are indicated on the left in kDa.

The ThermoFluor experiment consists on a miniaturised high-throughput protein stability

assay based on monitoring the thermally induced unfolding of a protein in presence of diverse

buffers, by measuring the temperature midpoint of the protein-unfolding transition (Tm)

(Pantoliano et al. 2001). It was a crucial step in mutated LiGLO2 stability improvement, as shown by

protein thermal high instability in different buffers (Figure III.7.). The pH-NaCl concentration

screen performed showed the protein to be most stable in 30 mM Tris pH 8.5 with 100 mM NaCl

(Figure III.7.), while the addictive screen evidenced a significant increase on protein stability when

adding a divalent metal chloride, especially MgCl2, or PEG to the buffer (Figure III.8.). These results

are in agreement with the crystallization condition used for the native LiGLO2, which contained

both MgCl2 and PEG (Trincão et al. 2006).


8800

Figure III.7. Protein stability accessed by ThermoFluor. Protein stability is higher in Tris-HCl pH 8.5 buffer

with 100 mM NaCl (buffer A) comparing to others assayed. Tm is the temperature midpoint of the protein-

unfolding transition.

Figure III.8. Stability of purified mutant LiGLO2. ThermoFluor screen with different additives showed that

the 50 mM Tris-HCl pH 8.5 buffer containing divalent metal chloride or PEG improved protein stability

relatively to the control buffer without additive (//).


8811

Protein identification and successfully mutated residues were confirmed by MALDI-FTICR-

MS. A protein band corresponding to the mutated LiGLO2 was excised and digested for peptide

mass fingerprinting analysis. Only 16.0 % of protein sequence was covered, but it included the two

mutated residues (Y291R and C294K), confirming the enzyme’s identity and mutation and

validating the correct expression of the mutant protein.

Pure mutated LiGLO2 showed to be kinetically active when assayed for thiolesters of

trypanothione and glutathione. The respective Km and V parameters are indicated in Table III.4. The

Km was maintained towards S-D-lactoyltrypanothione (0.098 mM) when compared to the native

enzyme (0.091 mM). However, a kcat of 143 s-1 was determined for this substrate, being the specific

activity higher than for the native enzyme (kcat of 16.7 s-1).

In contrast to the native LiGLO2, the mutated form of the protein had activity in presence of S-D-

lactoylglutathione, with a Km of 0.255 mM and a kcat of 695 s-1, showing similar affinity towards this substrate

to the human homologue (Km 0.187 mM, Ridderstrom et al. 1996). This is consistent with the fact that these

two mutated residues are crucial to glutathione binding, being able to shift the enzyme’s specificity and place

its affinity towards SDL-GSH. Mutated LiGLO2 kcat was higher for SDL-GSH than for SDL-T(SH)2, in

agreement with the fact that the enzyme has to catabolise both glutathione moieties of the thiolester derived

from trypanothione.

ICP metal analysis confirmed the presence of zinc and iron, similarly to the native enzyme (Zn:Fe

31:1) (Silva et al. 2008), showing that the mutation did not change metal affinity, an expected result since

mutated residues position far from the metal binding site.

Table III.4. Kinetic parameters for the double mutant and native LiGLO2.

GLO2 Substrate Km

(mM) V

(mmol.s-1.mg-1) kcat (s-1)

kcat /Km (mM-1.s-1)

Mutant LiGLO2 SDL-T(SH)2 0.098 6.93x10-5 143 1.46x10-3

SDL-GSH 0.255 33.6x10-5 695 2.72x10-3

Native LiGLO2a SDL-T(SH)2 0.091 0.828x10-5 16.66 0.18x10-3

SDL-GSH ND ND ND ND Human GLO2b SDL-GSH 0.187 - 780 4.17x10-3

ND – not determined; aValues from Table III.1. from this chapter; bValues from Ridderstrom et al. 1996.


8822

Glyoxalase II in trypanosomatids evolved to efficiently use a specific and efficient substrate derived

from trypanothione, a unique thiol in these parasites. Residues Tyr291 and Cys294 are conserved in all

trypanosomatid glyoxalase II sequences known to date. Cys294 had been previously identified as one of the

residues responsible for the spermidine binding in LiGLO2 (Silva et al. 2008), suggesting that it has an

important role in the enzyme function. Tyr291 corresponds to Arg249, determinant for glutathione binding in

the human enzyme. Evidence suggests that, the replacement of these two residues in L. infantum by the

human corresponding ones resulted in a change on substrate specificity, showing that these residues are

indeed important for substrate selectivity.

44..88.. TTrryyppaannootthhiioonnee ssppeecciiffiicciittyy:: ssttrruuccttuurraall aanndd eevvoolluuttiioonnaarryy aannaallyyssiiss

Kinetoplastida are protozoan organisms that diverged early in evolution from other

eukaryotes (Hannaert et al. 2003). One particular characteristic shared by theses parasites is the

functional replacement of glutathione by a glutathione-spermidine thiol conjugate, trypanothione

(Muller et al. 2003). Consequently, their enzymes depend on trypanothione and replace the

glutathione-dependent ones from all other eukaryotic organisms and prokaryotes. Examples are the

enzymes of the glyoxalase pathway, which preferably use trypanothione as cofactor, being the

glyoxalase II exclusively dependent on the trypanothione thiolester (Irsch & Krauth-Siegel 2004;

Vickers et al. 2004; Sousa Silva et al. 2005; Ariza et al. 2006).

Trypanosomatid glyoxalases II follow kinetoplastida evolution, diverting early from other

eukaryotic organisms into a separate group (Figure III.9.). The other branch for eukaryotes is

divided into two other major groups, one including fungi and the second containing other

eukaryotes, including trypanosomatid’s hosts (human and dog) and vectors Glossina morsitans

(tsetse fly), Lutzomyia longipalpis (the phlebotomine sandfly responsible for the transmission of

Leishmania in the New World) and Anopheles gambiae (malaria mosquito) proteins (Figure III.9.). The

prokaryotic glyoxalases II analysed, E. coli and Erwinia carotovora, are clearly separated from

eukaryotic proteins, and the highest divergence obtained between them and trypanosomatid

proteins clearly eliminates a prokaryotic origin for the parasite’s enzymes (between 167 and 170 %

divergence, with only 29 % of identity; the percent identity compares sequences directly, without

accounting for phylogenetic relationships, and divergence is calculated by comparing sequence

pairs in relation to the reconstructed phylogeny).


8833

Figure III.9. Phylogenetic tree of alignment from figure III.1., between L. infantum glyoxalase II and other

glyoxalase II or putative (hydroxyacyl)-glutathione hydrolase enzymes. Rectangular phylogram, performed

from the alignment using MegAlign from DNASTAR Lasergene (branches are proportional to genetic

distance). Species are the same as indicated in Figure III.1.

55.. DDiissccuussssiioonn

On the basis of the three-dimensional structures of the L. infantum (this work) and human

glyoxalases II (Cameron et al. 1999), and taking into account the protein sequence alignment

between other homologous proteins, amino acid substitutions in the various sequences were

analysed in a structural and functional context. In all species, the residues involved in metal binding

are absolutely conserved (Figure III.1., residues marked M1, M2 and M1,2). These residues are

common to all species and correspond exactly to the same metal, 1, 2, or both, in human glyoxalase

II (Cameron et al. 1999). Concerning substrate binding, residue conservation is not observed

between trypanosomatid and other eukaryotic glyoxalase II enzymes. This is an expectable result,

since trypanosomatids use a trypanothione-derived thiolester as substrate, whereas all other

eukaryotic glyoxalases II hydrolyse lactoylglutathione.

Comparing both enzymes (Figure III.10.), differences at the substrate binding-sites are

clearly observed. Trypanosomatids lack the Lys143, Arg249 and Lys252 (Figure III.10b’., in orange)

responsible for the glutathione binding in human glyoxalase II (Cameron et al. 1999). On the other

hand, L. infantum glyoxalase II has the Ile171 (absent from the human enzyme, Figure III.10a’., in

G. morsitans L. longipalpis A. gambiae

H. sapiens

C. familiaris

A. thaliana

S. cerevisiae

S. pombe

A. fumigatus

L. infantum L. donovani L. major

T. cruzi T. brucei

E. coli E. carotovora

Amino Acid Substitutions (x100)


8844

orange) and both Phe219 and Phe266 strategically positioned to bind the spermidine moiety of the

thiolester (Figure III.10a’.). These two phenylalanine residues, although present in the human GLO2

at positions 182 and 224, respectively, are absent from the substrate binding site. In L. infantum,

superposition of both structures containing the spermidine and the molecule of D-lactate located

between the two metal ions, allow us to speculate on the possible position of the glutathione moiety

of trypanothione (Figure III.10.a., a’.), being clear how the trypanosomatid enzyme evolved to

accommodate the thiolester spermidine moiety.

The crystal structure of glyoxalase II from L. infantum presented here is the first structure

from a trypanosomatid. Previously, only the human (PDB 1QH5), Arabidopsis (PDB 1XM8 and PDB

2Q42) and Salmonella thyphimurium (PDB 2OBW) structures were determined. The most remarkable

feature is the electron density found close to the active centre that is consistent with a spermidine

molecule. This means that the recombinant glyoxalase II was able to bind a molecule that is part of

the physiological substrate. Since the enzyme is absolutely specific for lactoyltrypanthione

substrates and shows no activity with lactoylglutathione, it was possible to elucidate the molecular

mechanism of trypanothione specificity for glyoxalase II. This discovery has far reaching

consequences regarding the design of specific inhibitors for trypanothione dependent enzymes.

Given its uniqueness and importance in trypanosomatids, these enzymes are by far the most

promising therapeutic targets. The sequence and structure of glyoxalase II from L. infantum also

provide hints regarding the evolution of trypanosomatids. They diverged early from other

eukaryotes and are not related at all to prokaryotic enzymes.

The production of a highly pure and active double mutant form of LiGLO2 will allow further

biochemical and X-ray crystallography studies. The future investigation of this mutant enzyme from a

structural point of view will provide a complete understanding of glyoxalase II structure–function

relationship and evolution.


8855

Figure III.10. Molecular surfaces of L. infantum and human glyoxalase II proteins. (a) Superposition of the

LiGLO2-spermidine (PDB 2P18) with the LiGLO2-D-lactate structure (PDB 2P1E). (a’) Detail of the active and

substrate binding sites, showing the spermidine and D-lactate molecules in the pocket that could easily

harbour the lactoyltrypanothione; metals M1 and M2 are indicated; residues in the pocket are coloured in

yellow and orange; orange coloured residues, Ile171 and Ala173, are absent from the human enzyme. (b)

Human glyoxalase II containing a glutathione molecule (GSH) at the substrate binding site (PDB 1QH5, chain

A). (b’) Detail of the active and substrate binding sites; metals M1 and M2 are indicated; the cavity harbouring

the glutathione (in yellow and orange) is clearly different from the LiGLO2. Orange coloured residues,

Lys143, Arg249 and Lys252, are absent from trypanosomatid enzymes. Figures prepared in UCSF Chimera

(Pettersen et al. 2004).

a. b.

a.’ b.’

GSH M1

M2

D- Lactate

SPD

M1

M2


8866

66.. AAcckknnoowwlleeddggeemmeennttss

The authors thank the European Synchrotron Radiation Facility (ESRF) in Grenoble, France,

for the data collection support. The authors also acknowledge Dr. Maria João Romão for providing

crystallographic data from the Laboratório de Cristalografia de Raios-X at the Faculdade de

Ciências e Tecnologia, Universidade Nova de Lisboa, Portugal.

Work was supported by projects POCTI/ESP/48272/2002 and POCI/QUI/62027/2004 from

Fundação para a Ciência e Tecnologia, Portugal. The authors acknowledge the support from EMBO

short-term fellowship ASTF 318-2008 award and grant SFRH/BD/28691/2006 from Fundação para

a Ciência e Tecnologia, Portugal (both to L. Barata).

Lídia Barata, Marta Sousa Silva, Gonçalo da Costa, António E. N. Ferreira, Linda Schuldt, Ana M. Tomás,

Manfred S. Weiss, Ana Ponces Freire, Carlos Cordeiro. A novel methylglyoxal catabolising aldose reductase

from Leishmania infantum: Co-expression with molecular chaperones and kinetic characterization. Manuscript

in preparation.

CChhaapptteerr IIVV AAllddoossee RReedduuccttaassee ffrroomm LLeeiisshhmmaanniiaa iinnffaannttuumm

CChhaapptteerr IIVV

8899

11.. SSuummmmaarryy

Aldose reductase (EC 1.1.1.21), a NADPH-dependent oxidoreductase, is implicated in the

catabolism of methylglyoxal, a toxic glycolysis by-product. Structure-function analysis of aldose

reductase from Leishmania infantum (LiAKR), a trypanosomatid responsible for visceral

leishmaniasis, by purification of the enzyme following common bacteria systems proved

inappropriate. Soluble and active enzyme could only be obtained upon over-expression in

engineered E. coli strains containing chaperone systems that optimize de novo folding as reported

here.

LiAKR is a newly identified enzyme in this infectious organism. Its cloning, expression,

purification and kinetic characterisation, accomplished for the first time, will be useful to

understand methylglyoxal catabolism in trypanosomatids and to unearth crucial differences

towards its human counterpart.

CChhaapptteerr IIVV

9900


Leishmaniasis, widespread diseases in the Third World and the Mediterranean basin, affect

nearly 12 million of the world population (Leishmaniasis. Burden of disease, WHO 2010).. Since no

curative drugs or vaccines are available and the existing therapies lead to undesirable side effects

and are limited by the evolution of trypanosomatids’ resistance, effective therapeutic approaches

are much needed. These may rely on unique biochemical characteristics which set trypanosomatids

apart from all other eukaryotic cells. One of the most specific biochemical feature is the functional

replacement of glutathione by trypanothione (N1,N8-bis(glutathionyl)spermidine) (Flohé et al. 1999;

Muller et al. 2003). One of these trypanothione-dependent systems is the glyoxalase pathway,

deemed essential for methylglyoxal catabolism. Since methylglyoxal is toxic and an unavoidable

non-enzymatic by-product of glycolysis (Leoncini et al. 1980; Westwood et al. 1997), hampering the

glyoxalase pathway might cause a methylglyoxal concentration increase and the selective death of

the parasites.

However, the glyoxalase pathway is not the only catabolic route for methylglyoxal in

eukaryotic cells. Aldose reductase (EC 1.1.1.21) was found to be equally important for

methylglyoxal detoxification in other organisms, namely human and yeast (Gomes et al. 2005). This

enzyme reduces methylglyoxal to 1,2-propanediol in a NADPH-dependent two-steps reaction

(Keegan & Blum 1995). A sequence homology based search for the human and yeast aldose

reductase homologue in the L. infantum genome revealed a suitable gene candidate, named L.

infantum aldo-keto reductase (LiAKR). In this work, the identified LiAKR gene was cloned into a

suitable expression vector for recombinant protein expression in E. coli. Attempts to obtain pure

recombinant LiAKR were hampered due to the formation of insoluble inclusion bodies when

expressing the protein in different E. coli strains. This problem was overcome by co-expressing

LiAKR in engineered E. coli strains that simultaneously overproduce different chaperone

combinations (de Marco et al. 2007). The LiAKR was produced in a soluble, enzymatically functional

and stable protein, enabling the realization of further biochemical and future structural studies.

CChhaapptteerr IIVV

9911

33.. MMaatteerriiaallss aanndd MMeetthhooddss

33..11.. CClloonniinngg ooff LLiiAAKKRR

The LiAKR gene was amplified by PCR (Polymerase Chain Reaction) from L. infantum

genomic DNA using as specific forward and reverse primers: 5’

CCGCGCACATATGTCCGCCAACGTGCT 3’ and 5’CACCGCTCGAGTCAAGAACGCGGCGATG

3’, containing NdeI and XhoI site (underlined), respectively. PCR was performed using PWO

polymerase (Promega) under standard conditions (94 °C for 2 min, 55 °C for 1 min, 72 °C for 1 min

(2 cycles); 94 °C for 45 sec, 65°C for 1 min, 72 °C for 1min (30 cycles); 72 °C for 10 min; 4°C). The

purified PCR product was digested by NdeI and XhoI and ligated to the similarly restricted pET-

28a expression vector (Novagen), giving rise to pET28a/His6-LiAKR. Final protein sequence was

preceded by MGSSHHHHHHSSGLVPRGSH, containing a His6-tag (bold) and a Thrombin cleavage

site (underlined). Plasmid purification was performed using standard protocols.

33..22.. EExxpprreessssiioonn ooff LLiiAAKKRR iinn ddiiffffeerreenntt EE.. ccoollii ssttrraaiinnss aanndd pprrootteeiinn ssoolluubbiilliittyy

E. coli strains BL21-codon Plus, BL21 (DE3), BL21 (DE3)-codon Plus-RIL, BL21 (DE3)-codon

Plus-RP, BL21 (DE3) pLysS, BL21 (DE3) star, Rosetta (DE3), Rosetta (DE3) pLysS and five E.coli

BL21 (DE3) strains containing a different chaperone system (DnaK/DnaJ/GrpE,

DnaK/DnaJ/GrpE/ClpB, GroESL, low and high expression DnaK/DnaJ/GrpE/ClpB/GroESL (De

Marco et al. 2007)) were used to analyse the over-expression potential of LiAKR. Trial liquid

cultures of these strains harbouring pET28a/His6-LiAKR were grown at 37 °C in LB (Luria-Bertani)

medium, supplemented with 30 µg/ml kanamycin (Carl Roth) and the adequate antibiotics for

each strain (34 µg/ml chloramphenicol (Carl Roth) and/or 30 µg/ml spectinomycin (Sigma-

Aldrich)) until an OD600nm of 0.6 was reached. LiAKR expression was induced by addition of IPTG

(isopropyl-β-D-thiogalactopyranoside, Carl Roth). Expression temperature and growth time were

optimised (15 °C and 20 °C overnight, 28 °C for 1.5 h and 3.0 h, and 37 °C from 1 to 4 h), as well as

the induction levels by varying IPTG concentration (0.2, 0.5 and 1.0 mM). Cells were harvested,

suspended in buffer A (50 mM Tris pH 7.4, 200 mM NaCl, 2 mM β-mercaptoetanol, all from Carl

Roth) and lysed by sonication. Soluble and insoluble fractions of cell lysates were recovered by

CChhaapptteerr IIVV

9922

centrifugation at 3000 xg, 4 °C, 10 min and analysed for LiAKR expression and solubility using a 12

% SDS-PAGE.

33..33.. PPuurriiffiiccaattiioonn bbuuffffeerr ooppttiimmiizzaattiioonn bbyy TThheerrmmooFFlluuoorr

Purification buffer A was optimised in a ThermoFluor experiment (Ericsson et al. 2006). 5 µl

of 50 × Sypro Orange (fluorophore, Invitrogen), 5 µl of 1 mg/ml LiAKR and 40 µl of each buffer

were added to the wells of a 96-well thin-wall PCR plate (Bio-Rad). Fluorescence was detected

while heating the plate from 4 to 95 °C in increments of 0.5 °C using a ThermoFluor ICycler IQ

thermal cycler (Bio-Rad). Two screens were performed: a pH versus NaCl concentration screen and

an additives screen, including various compounds (nucleotides, metal ions, salts and others)

supplemented to the basis buffer 50 mM Tris-HCl pH 8.5.

33..44.. LLaarrggee ssccaallee pprroodduuccttiioonn aanndd ppuurriiffiiccaattiioonn ffrroomm ssoolluubbllee ffrraaccttiioonn

For protein over-expression, E. coli BL21 (DE3) expressing the chaperone system GroESL and

transformed with pET28a/His6-LiAKR was cultured in 750 mL of LB medium containing

kanamycin (30 µg/mL), chloramphenicol (34 µg/mL) and spectinomycin (30 µg/mL) at 37 °C, until

the culture reached an OD600nm of 0.6. Protein expression was induced with 0.2 mM IPTG at 20 °C,

overnight. Cells were harvested by centrifugation at 7800 xg for 30 min at 4 °C, suspended in 10 ml

of buffer B (50 mM Tris pH 8.5, 200 mM NaCl, 2 mM β-mercaptoethanol, 10 % (v/v) glycerol) per g

of wet cell pellet and lysed by sonication. The soluble fraction obtained by centrifugation at 38000

xg for 40 min at 4 °C was filtered through a 0.22 µm Millex membrane filter (Millipore), before being

applied to a Co-NTA beats (Qiagen) column for purification at room temperature. LiAKR was

eluted in buffer B supplemented with 500 mM imidazole. Fractions containing LiAKR (as confirmed

by 12 % SDS-PAGE analysis) were applied to a gel filtration column (Superdex 75, Amersham

Biosciences) and eluted with buffer B. Vivaspin15 (molecular weight cutoff 30000) concentrator

(Sartorius Stedim Biotech) was used to concentrate the protein. Protein concentration was

determined using a Peqlab Biotechnologie GmbH NanoDrop® ND-1000 Spectometer at 280 nm,

considering an aldose reductase extension coefficient of 42400 M-1 cm-1, as calculated by the

ProtParam tool (Gasteiger E., et al., The Proteomics Protocols Handbook, Humana Press (2005)).

CChhaapptteerr IIVV

9933

33..55.. PPrrootteeiinn aannaallyyssiiss bbyy mmaassss ssppeeccttrroommeettrryy

Protein bands corresponding to the putative LiAKR were manually excised from gels and

digested with trypsin (modified porcine trypsin, sequencing grade, Promega), as previously

reported (Shevchenko et al. 2006). Peptide mixtures were analysed by MALDI-FTICR-MS in a

Bruker Apex Qe 7 Tesla magnet Monoisotopic peptide masses were determined using the Snap 2.0

algorithm in Data analysis 4.0 software (Bruker Daltonics). The Mascot search engine

(www.matrixscience.com) was used for protein identification. This mass spectrometry analysis was

performed by Gonçalo da Costa at the FTICR and Advanced Proteomics Laboratory, FCUL,

Portugal.

33..66.. RReeccoommbbiinnaanntt LLiiAAKKRR aaccttiivviittyy aassssaayy

Recombinant LiAKR activity was assayed by following NADPH oxidation at 340 nm in the

presence of methylglyoxal (Gomes et al. 2005). Assays were performed by varying NADPH

concentration between 0.001 and 0.025 mM at a constant methylglyoxal concentration (5 mM), and

varying methylglyoxal concentration (0.2 to 5 mM) at a constant NADPH concentration (0.025 mM).

Additionally, an assay using methylglyoxal and NADH was performed, and the known substrate

glyceraldehyde was also used in the presence of NADPH. All reactions were monitored at 30 °C in

1.5 mL of 25 mM potassium phosphate buffer pH 7.4, on an Agilent HP 8453 diode array

spectrophotometer, with stirring. NADPH concentration was calculated using the ε340 nm of 6.22 mM-

1.cm-1 and its auto-oxidation rate was considered in all reactions monitored. Km values for NADPH

and methylglyoxal and the limiting rate were calculated by time-course analysis (Ferreira, A.E.N.,

in house developed software). Enzyme stability was also investigated by monitoring the activity of

aliquots of LiAKR stored at 4 ºC, -20 ºC and -80 ºC. High-purity methylglyoxal was prepared by acid

hydrolysis of methylglyoxal 1,1-dimethyl acetal (Sigma-Aldrich), as described previously (Sousa

Silva et al. 2005).

33..77.. LLiiAAKKRR ccrryyssttaalllliizzaattiioonn ttrriiaallss

Commercially available crystal screens and the sitting-drop vapor-diffusion method were

used to perform initial crystallization screening, at the High Throughput Crystallization facility at

CChhaapptteerr IIVV

9944

the EMBL-Hamburg Outstation (Mueller-Dieckmann, 2006). Drops contained 0.5 µl of protein

solution at 20 mg/ml and 0.5 µl of reservoir solution and were equilibrated over 80 µl reservoir

solutions in 96-well format Greiner plates. Crystal needles were obtained (Figure IV.1a.) from the

crystallization condition 1.5 M sodium malonate pH 6. The hanging-drop vapour-diffusion method

was applied using the tools from Nextal Biotechnology to further improve the crystals. Drops were

prepared by mixing 2 µl protein solution (20 mg/ml) with 2 µl reservoir solution containing 1.2 M

sodium malonate pH 5.5, and equilibrated over 1 ml reservoir solution.

44.. RReessuullttss aanndd ddiissccuussssiioonn

44..11.. CClloonniinngg,, eexxpprreessssiioonn aanndd ppuurriiffiiccaattiioonn ooff LLiiAAKKRR

A BLAST search was performed on the L. infantum genome database (GenBank accession no.

AM502219:AM502254) and a gene coding for an aldo-keto reductase-like protein, present in L.

infantum chromosome 27 , was identified and isolated from L. infantum genomic DNA. The LiAKR

gene (GenBank accession no. FJ489648) shows 51 % sequence identity with human aldose reductase

mRNA (AKR1B1, GenBank accession no. NM001628) and 43 % sequence identity with Gre3 from S.

cerevisiae (Locus tag YHR104W), both coding for aldose reductases involved in methylglyoxal

catabolism. The deduced protein, with 372 residues and an apparent molecular weight of 41034 Da,

shares 37 % and 29 % sequence identity with human aldose reductase and yeast Gre3, respectively.

Standard expression techniques, using pET28a expression system in different E. coli strains and a

wide range of induction conditions (IPTG concentration, temperature and induction duration), were

not successful (Figure IV.1.).

Figure IV.1. LiAKR expression conditions trial.

Coomassie-stained 12 % SDS-PAGE shows total crude

lysates of cultures grown at 37 °C for 3h carrying pET28a-

LiAKR (T), fractionated as insoluble (I) and soluble (S)

under culture conditions containing 0.2 and 0.5 mM

IPTG. A culture sample was collected before induction

(T0) for control. Molecular mass marker (M) positions are

given in kDa.

CChhaapptteerr IIVV

9955

LiAKR appeared only in the insoluble fraction. Protein solubilisation required the use of 8 M

urea and produced an unstable enzyme (data not shown), unsuitable for biochemical studies. The

protein was expressed in a ∆GRE3 yeast mutant, lacking methylglyoxal dependent aldose

reductase activity, being possible to obtain an active enzyme in yeast cell free extract (data not

shown). This expression system revealed the likely need of a more complex protein producing and

processing machinery, including chaperones. This led us to follow a strategy involving LiAKR over-

expression in E. coli strains engineered to co-ordinately overproduce different chaperone systems

(DnaK/DnaJ/GrpE, DnaK/DnaJ/GrpE/ClpB, GroESL, and low and high expression

DnaK/DnaJ/GrpE/ClpB/GroESL (De Marco et al. 2007)). Significant quantities of soluble active

enzyme were produced when using any of the chaperone systems (Figure IV.2.).

Figure IV.2. Chaperone co-expression effect on LiAKR over-expression (GroESL (1), low expression

DnaK/DnaJ/GrpE/ClpB/GroESL (2), DnaK/DnaJ/GrpE (3), DnaK/DnaJ/GrpE/ClpB (4) and high

expression DnaK/DnaJ/GrpE/ClpB/GroESL (5)). Crude lysates of cultures grown at 20 °C overnight

carrying pET28a-LiAKR (T), fractionated as insoluble (I) and soluble (S) under culture conditions containing

0.5 mM IPTG. A culture sample was collected before induction (T0) for control. Molecular mass marker (M)

positions are given in kDa and the arrow indicates LiAKR expression.

E. coli co-expressing the GroESL chaperone system was used for large-scale improved

expression and LiAKR protein was purified to near homogeneity as shown by SDS-PAGE analysis

(Figure IV.3.). The yield was about 30 mg of protein per litter of cell culture, allowing us to proceed

to biochemical studies.

CChhaapptteerr IIVV

9966

Figure IV.3. Analysis of purified recombinant LiAKR.

From total cell content (T), the soluble fraction

containing expressed protein (S) was loaded into a Co-

NTA beats column. Both flow-through (FT) and eluted

fraction (E) were analysed by Coomassie-stained 12 %

SDS-PAGE, as well as the highly purified LiAKR

fractions collected from the gel filtration

chromatography (GF Fractions).

44..22.. PPuurriiffiiccaattiioonn bbuuffffeerr ooppttiimmiizzaattiioonn bbyy TThheerrmmooFFlluuoorr

The purification buffer was optimised by ThermoFluor (Ericsson et al. 2006), a miniaturised

high-throughput protein stability assay based on monitoring the thermally induced unfolding of a

protein in presence of diverse buffers by determining the temperature midpoint of the protein-

unfolding transition curve (Tm) (Pantoliano et al. 2001). ThermoFluor investigation combined with

observation of protein behaviour in the buffer during the purification process provided a detailed

picture of the linkage between buffer, additives and protein stability. The systematic study of buffer

effects on protein stability is a very useful tool in purification process optimization.

A pH-NaCl concentration screen was performed showing that the protein was most stable in

50mM Tris pH 8.5 with 200 mM NaCl (Figure IV.4.). The additive screen showed a significant

increase on protein stability when glycerol was added to the buffer (Figure IV.5.). Based on these

results, buffer B (50 mM Tris pH 8.5, 200 mM NaCl, 2 mM β-mercaptoethanol, 10 % (v/v) glycerol)

was selected for the purification procedure.

Figure IV.4. Protein stability accessed by

ThermoFluor. Tris-HCl pH 8.5 with 200

mM NaCl (buffer B) is the buffer allowing

higher protein stability. Tm is the

midpoint of temperature of the protein-

unfolding transition.

CChhaapptteerr IIVV

9977

Figure IV.5. LiAKR stability. ThermoFluor screen with

different additives showed that glycerol improves LiAKR

stability relatively to the control buffer without additive (//).

44..33.. PPrrootteeiinn aannaallyyssiiss bbyy mmaassss ssppeeccttrroommeettrryy

A protein band corresponding to the purified recombinant protein was excised and digested

for peptide mass fingerprinting analysis. A significant MASCOT score was obtained, with 40 % of

LiAKR sequence coverage, thus confirming the enzyme identity and validating the correct

expression of the protein.

44..44.. AAccttiivviittyy ooff rreeccoommbbiinnaanntt LLiiAAKKRR

Recombinant LiAKR was assayed for activity. Following the NADPH oxidation, in presence

of methylglyoxal, a Km for methylglyoxal of 0.59 mM and a Km for NADPH of 0.0022 mM were

determined. kcat/Km values of 0.21 mM-1s-1 and 55.6 mM-1s-1 for methylglyoxal and NADPH,

respectively, were obtained. Additionally, no activity was observed when using methylglyoxal and

NADH. DL-glyceraldehyde was also a substrate for this enzyme, using NADPH as reported for

other aldose reductase enzymes (Ryle & Tipton 1985; Grimshaw et al. 1990; Del Corso et al. 1990).

The effect of storage on enzyme activity was investigated again for the following conditions:

at 4 °C, -20 °C and -80 °C, for 1 day, 1 week and 1 month. LiAKR showed to be highly stable and

functionally active when conserved at -20 °C or -80 °C (data not shown).

CChhaapptteerr IIVV

9988

44..55.. PPrreelliimmiinnaarryy ccrryyssttaalllliizzaattiioonn ttrriiaallss

Our purpose is to investigate LiAKR from a structural point of view, to obtain a complete

understanding of this important methylglyoxal catabolising enzyme and to evaluate its potential as

an anti-leishmaniasis drug target.

The first crystallization screens for the purified recombinant LiAKR protein were successful.

Crystals needles were grown (Figure IV.6.a.). Crystal optimization resulted in rod-shape crystals

(Figure IV.6.b.) which grew within 2 days at 20°C. LiAKR crystals did not diffract at any of the

synchrotrons ESRF-Grenoble or DESY-Hamburg. Further crystal optimization is still required.

Figure IV.6. LiAKR crystals. (a) Crystal

needles from the initial screen. Picture

from the High Throughput

Crystallization facility robot, EMBL-

Hamburg. (b) Improved crystals by

vapour-diffusion method.

55.. CCoonncclluuddiinngg rreemmaarrkkss

In the present work, highly pure, active and stable trypanosomatid aldose reductase was

purified for the first time. The production yield in E. coli co-expressing chaperones is large enough

to allow further X-ray crystallography and biochemical analysis. This novel L. infantum enzyme

was kinetically characterised with methylglyoxal and NADPH as substrates. We are currently

investigating LiAKR from a structural point of view, already having preliminary crystallization

results. We look forward to obtain a detailed understanding of this important methylglyoxal

catabolising enzyme and to evaluate its potential as an anti-leishmaniasis drug target.

CChhaapptteerr IIVV

9999

66.. AAcckknnoowwlleeddggmmeennttss

The work was supported by projects POCTI/ESP/48272/2002, POCI/QUI/62027/2004 and

REDE/1501/REM/2005 from Fundação para a Ciência e Tecnologia, Portugal. The authors

acknowledge the support from EMBO short-term fellowship ASTF 318-2008 award (to L. Barata)

and grants SFRH/BD/28691/2006 (to L. Barata) and PDTC/QUI/70610/2006 (to G. Costa) from

Fundação para a Ciência e Tecnologia. We thank Dr. Arie Geerlof (EMBL-Hamburg) for providing

the E. coli BL21 Star (DE3) chaperone system cells.

CChhaapptteerr VV CCoonncclluuddiinngg RReemmaarrkkss

CChhaapptteerr VV

110033

CCoonncclluuddiinngg RReemmaarrkkss

Leishmaniasis have long been considered neglected diseases for the poor investment in

research on the development of both vaccines and drugs, although it is directly responsible for the

death of 57000 people per year (WHO 2008). Presently there are no vaccines against these diseases,

and both visceral and cutaneous leishmaniasis are traditionally treated with pentavalent

antimonials, which are toxic especially in the presence of HIV co-infections. The latter co-infections

add an increased risk associated to leishmaniasis both in developed countries and in the third

world. Additionally, resistance to these compounds has been reported. For instance, antimonial

resistance has strongly arisen in India, where visceral leishmaniasis is endemic (Sundar 2001). There

are some alternative drugs: Amphotericin B, requiring intravenous administration; Pentamine, less

and less effective; and Miltefosine, the only oral antileishmanial agent. However, these drugs’

inefficiencies, high costs and emergence of resistant trypanosomatids demand the development of

new therapeutic approaches towards these parasites. Considering that the most adequate

therapeutic targets are likely to be based on biochemical differences between parasite and host,

trypanothione metabolism and dependent enzymes, which exist only in Kinetoplastida, arise as

promising candidates.

Invasion and persistence of L. infantum within macrophages is ensured by several survival

strategies. One of these is the anti-oxidant defence system involving the unique thiol trypanothione.

Another important trypanothione function is the detoxification of ketoaldehydes such as

methylglyoxal (Krauth-Siegel et al. 2005), an unavoidable toxic compound for all living cells. The

most common methylglyoxal formation pathway is the often overlooked chemical instability of the

glycolytic dihydroxyacetone phosphate and D-glyceraldehyde-3-phosphate (Lohman & Meyerhof

1934). Concerning methylglyoxal detoxification, multiple catabolic pathways have been described,

being the glyoxalase system and the aldose reductase the most important and physiologically

relevant. The glyoxalase pathway catalyses the formation of D-lactate from methylglyoxal, being

considered the main pathway involved in this compound’s detoxification. The aldose reductase,

another methylglyoxal catabolising enzyme, gains importance in some organisms’ life stages

(Samaras et al. 1988).

The glyoxalase pathway was studied in L. infantum protein extracts and its potential as a

drug target was evaluated by modelling and computer simulation (Sousa Silva et al. 2005). Despite

the findings revealing that this pathway might be a poor drug target, this system is still considered

CChhaapptteerr VV

104

a potential antileishmanial therapeutic target by some authors (Fairlamb et al. 2006; Padmanabhan

et al. 2005; Padmanabhan et al. 2006; Opperdoes & Michels 2008). In these studies, however,

methylglyoxal catabolism through the enzyme aldose reductase or the methylglyoxal flux

distribution between both pathways was not considered. Hence, the main objective of the present

work was to study both systems from L. infantum. The structure determination of all three enzymes

involved in methylglyoxal catabolism, together with their detailed kinetic characterization and

complementary biochemical studies, allowed a comprehensive recognition of the enzymes in L.

infantum and likely place us a step further in this parasite knowledge.

In the present work, glyoxalase I, glyoxalase II and aldose reductase from L. infantum were

kinetically and structurally characterised. The three proteins were over-expressed, purified and

further studied in detail by X-ray crystallography, enzyme kinetics and biochemical analysis.

Available kinetic data and X-ray structures from other organisms’ homologues were used for

comparison and also as structural search models. Relevant glyoxalase I X-ray structures used were

from L. major (LmGLO1; PDB entry 2C21 (Ariza et al. 2006)), H. sapiens (HsGLO1; PDB entries 1FRO;

(Cameron et al. 1997, 1999; Ridderstrom et al. 1998)) and E. coli (EcGLO1; PDB entries 1F9Z; (He et al.

2000)). Concerning the glyoxalase II, only the human structural model (HsGLO2; PDB entry 1QH5;

(Cameron et al. 1999)) was used in structure analysis. Several aldose reductase human structures

have been determined considering its high impact in diseases like diabetes (HsAKR; PDB entries

1ADS (Wilson et al. 1992); 1ABN (Borhani et al. 1992)), useful in future structure determination and

comparison.

L. infantum GLO1 was identified and both kinetic and structural studies were undertaken.

This is the first detailed report of GLO1 in this parasite, and this study allowed a throughout

comparison to the human and the L. major homologues. The L. infantum and L. major (Ariza et al.

2006) GLO1 structures revealed to be very alike, as expected for the high sequence homology

observed (97 % identity). Furthermore, LiGLO1 showed to preferentially use trypanothione,

similarly to LmGLO1. Despite these similarities, LiGLO1 showed a different metal-content,

relatively to its L. major counterpart. Based on the metal-content of the available GLO1 structures, it

was assumed (Vickers et al. 2004) that prokaryotic enzymes are Ni2+-dependent, while eukaryotic

GLO1 contain Zn2+ at the active site. Eukaryotic Zn2+-dependent enzymes include H. sapiens

(Ridderstrom et al. 1998) and S. cerevisiae (Aronsson et al. 1978). Prokaryotic Ni2+-dependent GLO1

include E. coli, Pseudomonas aeruginosa, Yersinia pestis and Neisseria meningitides (Sukdeo et al. 2004)

enzymes. However, this topic is highly controversial since some enzymes do not follow this pattern,

CChhaapptteerr VV

110055

as Pseudomonas putida (prokaryotic) GLO1 was reported to be Zn2+-dependent (Saint-Jean et al.

1998), and LmGLO1 (eukaryotic) shown to contain divalent nickel at the active site (Ariza et al.

2006). In spite of its similarities to LmGLO1, LiGLO1 has zinc at its active site, like other eukaryotic

GLO1 enzymes. Metal content in LiGLO1 was determined by ICP analysis, fluorescence-based

metal analysis and anomalous scattering. These methodologies allowed the metal identification and

quantification. LiGLO1 zinc-dependence would suggest a later divergence from the other

trypanosomatid throughout evolution, consistent with sequence data analysis. However, a detailed

metal analysis of GLO1 from other trypanosomatids would be required to validate this hypothesis.

L. major and L. infantum are far enough in evolution to cause different forms of Leishmaniasis, being

understandable to find differences in their respective biochemistry, resulting from different

evolutionary pressures. The importance of studying LiGLO1 was undoubtly enhanced by this

enzyme uniqueness revealed in the present work.

Glyoxalase II from L. infantum is absolutely specific towards the thiolester derived from

trypanothione. Its native structure was the first GLO2 structure reported from a trypanosomatid.

When compared to the human enzyme, their general structures are very similar, being the metals at

the active site coordinated by the same residues. The native LiGLO2 structure superimposed to a

LiGLO2 D-lactate containing structure at the active site, obtained by a crystal-soaking with

substrate, showed a distinctive substrate binding pocket relatively to its human homologue, a very

attractive feature for further docking studies. A spermidine molecule was serendipitously co-

purified with the native LiGLO2, allowing the identification of the substrate interacting residues. It

is noteworthy that the LiGLO2 residues involved in S-D-lactoyltrypanothione binding, through its

spermidine moiety, are absent from the human homologue. Furthermore, the human enzyme

residues binding the S-D-lactoylglutathione are absent from the LiGLO2 protein. These results

steered to the step of mutating two of the LiGLO2 residues involved in the substrate-binding pocket

(Tyr291 and Cys294), by the correspondent human enzyme residues, interacting with the

glutathione moiety (Arg249 and Lys252, respectively). The mutation caused protein structural

stability loss, a hardship in achieving the mutated LiGLO2 purification and further crystallization.

Pure recombinant mutated LiGLO2 was finally obtained after optimization of many purification

conditions, especially buffer optimization through ThermoFluor experiments. The kinetic analysis

of the mutated enzyme, performed immediately after purification to avoid protein precipitation,

revealed a substrate shift for this enzyme. The mutation of only two residues of the substrate

binding pocket was not enough to completely shift the enzyme’s specificity towards the

trypanothione-derived thiolester. However, a loss of affinity was observed for the Leishmania

CChhaapptteerr VV

106

glyoxalase II physiological substrate, with an increased affinity for the S-D-lactoylglutathione,

showing that the chosen residues are crucial for substrate selectivity.

In this work, the first Leishmania aldose reductase (LiAKR) was identified in the genome and

the recombinant enzyme was made available for further biochemical and structural studies.

Previously, a gene from L. major coding for a protein from the reductase superfamily was reported

(Samaras et al. 1988). Also, activity of a methylglyoxal reductase and an aldehyde reductase from L.

donovani was detected (Goshal et al. 1989; Keegan & Blum 1995). Recently, it was described the

identification and purification of a L. donovani prostaglandin-f2-alpha-synthase (Rath et al. 2009),

another enzyme included in the AKR superfamily, incorrectly classified as an aldose reductase. The

LiAKR gene codes for an aldose reductase involved in methylglyoxal catabolism. Its hampered

expression was overcame by co-expression with different chaperone systems in E. coli. Additionally,

ThermoFluor experiments were critical for buffer optimization and purification of pure and active

protein in large amounts. The recombinant enzyme was characterised by kinetic analysis and

identified by mass spectrometry. LiAKR crystals were also grown, although further optimization of

this process is required for structure determination.

Indeed, protein structure determination by X-ray crystallography is a long process and not

fully automatic. The protein purity is critical to protein crystal’s growth and its conditions

optimization is not always trivial. In the present project, these methods took much longer that

foreseen for the mutated LiGLO2 and the aldose reductase, postponing these structures’ solution.

From a future perspective, it would be interesting to obtain the mutated LiGLO2 structure model, in

order to observe the structural basis for this enzyme’s affinity change towards the glutathione-

derived substrate. Aldose reductase crystals still require further optimization for a better diffraction

and structure solution. Despite LiAKR catabolising the same substrates as the human aldose

reductase, their sequence identity of only 51 % attaches an additional interest to solving the

parasite’s enzyme structure and compare both proteins. Moreover, it would be interesting to

perform drug-design studies in all three enzymes’ structures. The different potential inhibitors

would be used in kinetic analysis and further co-crystallization experiments.

L. infantum methylglyoxal catabolising systems seem to be quite robust and controlled.

Studies in the group revealed that enzymes’activities vary along the parasite’s life cycle. In total

protein extracts of promastigotes (either exponential or stationary phase) and amastigote forms of L.

infantum, specific activity of both glyoxalase enzymes increase during stationary growth phase and

further in amastigote forms of the parasite (M. Sousa Silva, data not published). Aldose reductase

CChhaapptteerr VV

110077

shows an opposite behaviour, as its specific activity is higher in exponentially growing

promastigotes than in promastigotes stationary phase and amastigotes (M. Sousa Silva, data not

published). The author suggests that, during amastigote phase, the parasite requires an increase in

reduced thiols and anti-oxidative defences, which are NADPH-dependent. Therefore, in this life

cycle stage, the aldose reductase activity is lowered to decrease NADPH consumption, and the

glyoxalase enzymes’ activity antagonistically increased in order to keep methylglyoxal

concentration at low levels (M. Sousa Silva, data not published). The opposite is observed in

exponentially growing promastigotes. Considering the latter compensation system, it should be

required the inhibition of both glyoxalase and aldose reductase pathways, targeting the enzymes’

potentially different substrate binding sites relatively to the respective human counterparts, in order

to achieve an effective increase of methylglyoxal concentration with harmful effects to the parasite.

In fact, metabolic pathways, such as glycolysis (El Fakhry et al. 2002) and trypanothione-dependent

pathways (M. Sousa Silva, data not published), seem to be efficiently regulated in L. infantum.

The integrative study of both glyoxalase enzymes and aldose reductase performed

throughout the present work, is a step further in the structural and biochemical knowledge of both

L. infantum in general and trypanothione specificity. Although none of these enzymes might be

considered as attractive drug targets per se the three enzymes can be synergistically exploited in the

hunt for new anti-leishmanial drug targets.

RReeffeerreenncceess


111111


Abordo, E. A., Minhas, H. S. & Thornalley, P. J. (1999) Accumulation of alpha-oxoaldehydes during oxidative stress: a role in cytotoxicity. Biochem Pharmacol 58, 641-648.

Aguilera, J. & Prieto, J.A. (2001) The Saccharomyces cerevisiae aldose reductase is implied in the metabolism of methylglyoxal in response to stress conditions. Curr Genet 39(5-6), 273-283.

Akopyants, N. S., Matlib, R. S., Bukanova, E. N., Smeds, M. R., Brownstein, B. H., Stormo, G. D. & Beverley, S. M. (2004) Expression profiling using random genomic DNA microarrays identifies differentially expressed genes associated with three major developmental stages of the protozoan parasite Leishmania major. Mol Biochem Parasitol 136, 71-86.

Aleksandrovskii, Y.A. (1992) Antithrombin III, C1 inhibitor, methylglyoxal, and polymorphonuclear leukocytes in the development of vascular complications in diabetes mellitus. Thromb Res 67(2), 179-189.

Allen, R.E., Lo, T.W. & Thornalley, P.J. (1993) Purification and characterisation of glyoxalase II from human red blood cells. Eur J Biochem 213(3), 1261-1267.

Almeida, R., Gilmartin, B. J., McCann, S. H., Norrish, A., Ivens, A. C., Lawson, D., Levick, M. P., Smith, D. F., Dyall, S. D., Vetrie, D., Freeman, T. C., Coulson, R. M., Sampaio, I., Schneider, H. & Blackwell, J. M. (2004) Expression profiling of the Leishmania life cycle: cDNA arrays identify developmentally regulated genes present but not annotated in the genome. Mol. Biochem.Parasitol. 136, 87–100

Altamirano-Enciso, A. J., Marzochi, M. C. A., Moreira, J. S., Schubach, A. O., Keyla B. Marzochi, K. B. F. (2003) On the origin and spread of cutaneous and mucosal leishmaniasis, based on pre- and post-Colombian historical sources. Hist. cienc. saude-Manguinhos 10(3), 853-882.

Altenberg, B. & Greulich, K.O. (2004) Genes of glycolysis are ubiquitously overexpressed in 24 cancer classes. Genomics 84(6), 1014-20.

Angarano, G., Maggi, P., Rollo, M.A., Larocca, A. M., Quarto, M., Scalone, A. & Gradoni, L. (1998) Diffuse necrotic hepatic lesions due to visceral leishmaniasis in AIDS. J Infect 36, 167-9.

Apple, M. A. & Greenberg, D. M. (1967) Inhibition of cancer growth in mice by a normal metabolite. Life Sci 6, 2157-2160.

Arauzo, S. & Cazzulo, J.J. (1989) The NADP-linked aldehyde reductase from Trypanosoma cruzi: subcellular localization and some properties. FEMS Microbiol Lett 49, 283-186.

Ariza, A., Vickers, T. J., Greig, N., Fairlamb, A. H. & Bond, C. S. (2005) Crystallization and preliminary X-ray analysis of Leishmania major glyoxalase I. Acta Crystallogr Sect F Struct Biol Cryst Commun 61, 769-772.

Ariza, A., Vickers, T. J., Greig, N., Armour, K. A., Dixon, M. J., Eggleston, I. M., Fairlamb, A. H. & Bond, C. S. (2006) Specificity of the trypanothione-dependent Leishmania major glyoxalase I: structure and biochemical comparison with the human enzyme. Mol Microbiol 59, 1239-1248.

Aronsson, A.C. & Mannervik, B. (1977) Characterization of glyoxalase I purified from pig erythrocytes by affinity chromatography. Biochem J 165(3), 503-509.

Aronsson, A. C., Marmstal, E. & Mannervik, B. (1978) Glyoxalase I, a zinc metalloenzyme of mammals and yeast. Biochem Biophys Res Commun 81, 1235-1240.

Bacchi, C. J., Verggara, C., Garofalo, J., Lipschik, G. Y., Hutner, S. H. (2007) Synthesis and Content of Polyamines in Bloodstream Trypanosoma brucei. J Euk Microbiol 26(3), 484 – 488.

Baggetto, L.G. & Lehninger, A.L. (1987) Isolated tumoral pyruvate dehydrogenase can synthesize acetoin which inhibits pyruvate oxidation as well as other aldehydes. Biochem Biophys Res Commun 145(1), 153-159.

Bakker, B. M., Michels, P. A., Opperdoes, F. R. & Westerhoff, H. V. (1997) Glycolysis in bloodstream form Trypanosoma brucei can be understood in terms of the kinetics of the glycolytic enzymes. J Biol Chem 272, 3207-3215.

Bailey, H. & Bishop, W. J. (1959). Leishman-Donovan bodies and donovaniasis; Sir William Boog Leishman, 1865-1926; Charles Donovan, 1863-1951. Br J Vener Dis 35, 8-9.

Bailey, S. (1994) The CCP4 Suite - Programs for Protein Crystallography. Acta Crystallographica Section D-Biological Crystallography 50, 760-763.

Ball, J.C. & Vander Jagt, D.L. (1981) S-2-hydroxyacylglutathione hydrolase (glyoxalase II): active-site mapping of a nonserine thiolesterase. Biochemistry 20(4), 899-905.


112

Barak, E., Amin-Spector, S., Gerliak, E., Goyard, S., Holland, N. & Zilberstein, D. (2005) Differentiation of Leishmania donovani in host-free system: analysis of signal perception and response. Mol Biochem Parasitol 141, 99-108.

Barata, L., Sousa Silva, M., Schuldt, L., Costa, G., Tomás, A. M., Ferreira, A. E. N., Weiss, M. S., Ponces Freire, A., Cordeiro, C. (2010) Cloning, Expression, Purification, Crystallization and Preliminary X-ray Diffraction Analysis of Glyoxalase I from Leishmania infantum. Acta Crystallographica Section F, 66, 571–574.

Baskaran, S. & Balasubramanian, K.A. (1987) Purification and active site modification studies on glyoxalase I from monkey intestinal mucosa. Biochim Biophys Acta 913(3), 377-385.

Bates, P. A. (1993) Characterization of developmentally-regulated nucleases in promastigotes and amastigotes of Leishmania mexicana. FEMS Microbiol Lett 107, 53–58.

Bente, M., Harder, S., Wiesgigl, M., Heukeshoven, J., Gelhaus, C., Krause, E., Clos, J., and Bruchhaus, I. (2003) Developmentally induced changes of the proteome in the protozoan parasite Leishmania donovani. Proteomics 3, 1811–1829

Besteiro, S., Williams, R. A., Morrison, L. S., Coombs, G. H., and Mottram, J. C. (2006) Endosome sorting and autophagy are essential for differentiation and virulence of Leishmania major J Biol Chem 281, 11384-11392

Bito, A., Haider, M., Hadler, I. & Breitenbach, M. (1997) Identification and phenotypic analysis of two glyoxalase II encoding genes from Saccharomyces cerevisiae, GLO2 and GLO4, and intracellular localization of the corresponding proteins. J Biol Chem 272(34), 21509-21519.

Bito, A., Haider, M., Briza, P., Strasser, P. & Breitenbach, M. (1999) Heterologous expression, purification, and kinetic comparison of the cytoplasmic and mitochondrial glyoxalase II enzymes, Glo2p and Glo4p, from Saccharomyces cerevisiae. Protein Expr Purif 17, 456-464.

Blattner, J., Helfert, S., Michels, P. & Clayton, C. (1998) Compartmentation of phosphoglycerate kinase in Trypanosoma brucei plays a critical role in parasite energy metabolism. Proc Natl Acad Sci U S A 95, 11596-11600.

Borhani, D.W., Harter, T.M., Petrash, J.M. (1992) The Crystal Structure of the Aldose Reductase-NADPH Binary Complex*. J Biol Chem 267, 24841-24847.

Bryceson, A. D. M., Bray, R. S., Wolstencroft, R. A. & Dumonde, D. C. (1970) Immunity in cutaneous leishmaniasis of the guinea-pig. Clin Exp Immunol 7(3): 301–341.

Brandao, A. A., Miranda, A., Degrave, W. M. & Sousa, M. A. (2000) The heterogeneity of choanomastigote-shaped trypanosomatids as analyzed by their kDNA minicircle size: taxonomic implicaitons. Parasitol Res 86, 809-812.

Brunger, A. T. (1992) Free R-Value - a Novel Statistical Quantity for Assessing the Accuracy of Crystal-Structures. Nature 355, 472-475.

Bucala, R., Makita, Z., Koschinsky, T., Cerami, A. & Vlassara, H. (1993) Lipid advanced glycosylation: pathway for lipid oxidation in vivo. Proc Natl Acad Sci U S A 90(14), 6434-8.

Burchmore, R.J. and Barrett, M.P. (2001) Life in vacuoles – nutrient acquisition by Leishmania amastigotes. Int J Parasitol 31, 1311–1320.

Burg, M.B., Kwon, E.D. & Kultz, D. (1996) Osmotic regulation of gene expression. Faseb J 10(14), 1598-1606. Cameron, A. D., Olin, B., Ridderstrom, M., Mannervik, B. & Jones, T. A. (1997) Crystal structure of human

glyoxalase I--evidence for gene duplication and 3D domain swapping. Embo J 16, 3386-3395. Cameron, A.D., Ridderstrom, M., Olin, B. & Mannervik, B. (1999) Crystal structure of human glyoxalase II

and its complex with a glutathione thiolester substrate analogue. Structure 7(9), 1067-1078. Carfi, A., Pares, S., Duee, E., Galleni, M., Duez, C., Frere, J. M., and Dideberg, O. (1995) The 3-D structure of

a zinc metallo-beta-lactamase from Bacillus cereus reveals a new type of protein fold. Embo J 14, 4914-4921.

Casazza, J.P., Felver, M.E. & Veech, R.L. (1984) The metabolism of acetone in rat. J Biol Chem 259(1), 231-236. Castro, H., Tomás, A. M. (2008) Peroxidases of Trypanosomatids, Antioxidants & Redox Signaling, 10(9), 1593-

1606. Ciaramella, P., Oliva, G., Luna, R. D., Gradoni, L., Ambrosio, R., Cortese, L., Scalone, A. & Persechino, A.

(1997) A retrospective clinical study of canine leishmaniasis in 150 dogs naturally infected by Leishmania infantum. Vet Rec 141, 539-543.

Clayton, C. E. & Michels, P. (1996) Metabolic compartmentation in African trypanosomes. Parasitol Today 12, 465-471.


111133

Clayton, C. E. (2002) Life without transcriptional control? From fly to man and back again. EMBO J 21, 1881–1888

Clugston, S.L., Barnard, J.F., Kinach, R., Miedema, D., Ruman, R., Daub, E. & Honek, J.F. (1998) Overproduction and characterization of a dimeric non-zinc glyoxalase I from Escherichia coli: evidence for optimal activation by nickel ions. Biochemistry 37(24), 8754-8763.

Concha, N. O., Rasmussen, B. A., Bush, K., and Herzberg, O. (1996) Crystal structure of the wide-spectrum binuclear zinc beta-lactamase from Bacteroides fragilis. Structure 4, 823-836.

Conroy, P. J. (1978) Carcinostatic activity of methylglyoxal and related substances in tumour-bearing mice. Ciba Found Symp, 271-300.

Cooper, R.A. & Anderson, A. (1970) The formation and catabolism of methylglyoxal during glycolysis in Escherichia coli. FEBS Lett 11(4), 273-276.

Cooper, R.A. (1984) Metabolism of methylglyoxal in microorganisms. Annu Rev Microbiol 38, 49-68. Cordell, P.A., Futers, T.S., Grant, P.J. & Pease, R.J. (2004) The Human hydroxyacylglutathione hydrolase

(HAGH) gene encodes both cytosolic and mitochondrial forms of glyoxalase II. J Biol Chem 279(27), 28653-28661.

Cowtan, K. (2000) General quadratic functions in real and reciprocal space and their application to likelihood phasing. Acta Crystallogr D Biol Crystallogr 56, 1612-1621.

Crowder, M. W., Maiti, M. K., Banovic, L., and Makaroff, C. A. (1997) Glyoxalase II from A. thaliana requires Zn(II) for catalytic activity. FEBS Letters 418, 351-354.

Dakin, H.D. & Dudley, H.W. (1913a) An enzyme concerned with the formation of hydroxy acids from ketonic aldehydes. J Biol Chem 14, 155-157.

Dakin, H.D. & Dudley, H.W. (1913b) On glyoxalase. J Biol Chem 14, 423-431. Darling, T. N. & Blum, J. J. (1988) D-lactate production by Leishmania braziliensis through the glyoxalase

pathway. Mol Biochem Parasitol 28, 121-127. Degrave, W., Fernandes, O., Thiemann, O., Wincker, P., Britto, C., Cardoso, A., Pereira, J. B., Bozza, M.,

Lopes, U. & Morel, C. (1994) Detection of Trypanosoma cruzi and Leishmania using the polymerase chain reaction. Mem Inst Oswaldo Cruz 89, 367-368.

Del Corso, A., Barsacchi, D., Giannessi, M., Grazia Tozzi, M.,Camici, M., Houben, J. L., Zandomeneglin, M., and Mura, U. (1990) Aldose Reductase does Catalyse the Reduction of Glyceraldehyde Through a Stoichiometric Oxidation of NADPH. Arch Biochem Biophys 283, 512-518.

de Marco, A., Deuerling, E., Mogk, A., Tomoyasu, T. & Bukau, B. (2007). Chaperone-based procedure to increase yields of soluble recombinant proteins produced in E. coli. BMC Biotechnol 7, 32.

Deponte, M., Sturm, N., Mittler, S., Harner, M., Mack, H. & Becker, K. (2007) Allosteric coupling of two different functional active sites in monomeric Plasmodium falciparum glyoxalase I. J Biol Chem 282, 28419-28430.

Deswal, R. & Sopory, S.K. (1991) Purification and partial characterization of glyoxalase I from a higher plant Brassica juncea. FEBS Lett 282(2), 277-280.

Deswal, R. & Sopory, S.K. (1999) Glyoxalase I from Brassica juncea is a calmodulin stimulated protein. Biochim Biophys Acta 1450(3), 460-467.

Dianzani, M. U. (1978) Biological activity of methylglyoxal and related aldehydes. Ciba Found Symp, 245-270. Dormeyer, M., Reckenfelderbaumer, N., Ludemann, H. & Krauth-Siegel, R. L. (2001). Trypanothione-

dependent synthesis of deoxyribonucleotides by Trypanosoma brucei ribonucleotide reductase. J Biol Chem 276, 10602-10606.

El Fakhry, Y., Ouellette, M. & Papadopoulou, B. (2002) A proteomic approach to identify developmentally regulated proteins in Leishmania infantum. Proteomics 2, 1007-1017.

Emsley, P., and Cowtan, K. (2004) Coot: model-building tools for molecular graphics. Acta Crystallogr D Biol Crystallogr 60, 2126-2132.

Ericsson, U.B., Hallberg, B.M., Detitta, G.T., Dekker, N., Nordlund, P. (2006) Thermofluor-based high-throughput stability optimization of proteins for structural studies. Anal Biochem 357 (2), 289-298.

Esterbauer, H., Cheeseman, K.H., Dianzani, M.U., Poli, G. & Slater, T.F. (1982) Separation and characterization of the aldehydic products of lipid peroxidation stimulated by ADP-Fe2+ in rat liver microsomes. Biochem J 208(1), 129-140.

Faires, L. M. (1993) Methods of analysis by the U.S. Geological Survey National Water Quality Laboratory: determination of metals in water by inductively coupled plasma-mass spectrometry. U.S. Geological Survey Open Report 92, 634.


114

Fairlamb, A. H. & Cerami, A. (1985) Identification of a novel, thiol-containing co-factor essential for glutathione reductase enzyme activity in trypanosomatids. Mol Biochem Parasitol 14, 187-198.

Fareleira, P., Legall, J., Xavier, A.V. & Santos, H. (1997) Pathways for utilization of carbon reserves in Desulfovibrio gigas under fermentative and respiratory conditions. J Bacteriol 179(12), 3972-3980.

Fernandes, O., Bozza, M., Pascale, J. M., de Miranda, A. B., Lopes, U. G. & Degrave, W. M. (1996) An oligonucleotide probe derived from kDNA minirepeats is specific for Leishmania (Viannia) Mem Inst Oswaldo Cruz 91, 279-284.

Flohe, L., Hecht, H. J., and Steinert, P. (1999) Glutathione and trypanothione in parasitic hydroperoxide metabolism. Free Radicals in Biology and Medicine 27, 966-984.

Flohe, L., Steinert, P., Hecht, H. J. & Hofmann, B. (2002). Tryparedoxin and tryparedoxin peroxidase. Methods Enzymol 347, 244-258.

Fraser-L'Hostis, C., Defrise-Quertain, F., Coral, D. & Deshusses, J. (1997). Regulation of the intracellular pH in the protozoan parasite Trypanosoma brucei brucei. Biol Chem 378, 1039-1046.

Freire, A.P., Ferreira, A., Gomes, R. & Cordeiro, C. (2003) Anti-glycation defences in yeast. Biochem Soc Trans 31, 1409–1412.

Frickel, E. M., Jemth, P., Widersten, M. & Mannervik, B. (2001) Yeast glyoxalase I is a monomeric enzyme with two active sites. J Biol Chem 276, 1845-1849.

Frye, E.B., Degenhardt, T.P., Thorpe, S.R. & Baynes, J.W. (1998) Role of the Maillard reaction in aging of tissue proteins. Advanced glycation end product-dependent increase in imidazolium cross-links in human lens proteins. J Biol Chem 273(30), 18714-18719.

Furuya, T., Kessler, P., Jardim, A., Schnaufer, A., Crudder, C. & Parsons, M. (2002) Glucose is toxic to glycosome-deficient trypanosomes. Proc Natl Acad Sci U S A 99, 14177-14782.

Fyfe, P. K., Alphey, M. S. & Hunter, W. N. (2010) Structure of Trypanosoma brucei glutathione synthetase: Domain and loop alterations in the catalytic cycle of a highly conserved enzyme. Mol Biochem Parasitol 170(2-3): 93–99.

Gasteiger, E., Hoogland, C., Gattiker, A., Duvaud, S., Wilkins, M. R., Appel, R. D. & Bairoch, A. (2005) The Proteomics Protocols Handbook, Humana Press.

Ghoshal, K., Banerjee, A. B. & Ray, S. (1989) Methylglyoxal-catabolizing enzymes of Leishmania donovani promastigotes. Mol Biochem Parasitol 35, 21-29.

Ginger, M.L. (2000) Utilization of leucine and acetate as carbon sources for sterol and fatty acid biosynthesis by Old and New World Leishmania species, Endotrypanum monterogeii and Trypanosoma cruzi. Eur. J. Biochem. 267, 2555–2566

Ginger, M.L. (2001) The biosynthetic incorporation of the intact leucine skeleton into sterol by the trypanosomatid Leishmania mexicana. J. Biol. Chem. 276, 11674–11682

Ginsburg, V. & Hers, H.G. (1960) On the conversion of fructose to glucose by guinea pig intestine. Biochim Biophys Acta 38, 427-434.

Gomes, R., Sousa Silva, M., Quintas, A., Cordeiro, C., Freire, A., Pereira, P., Martins, A., Monteiro, E., Barroso, E. & Ponces Freire, A. (2005a) Argpyrimidine, a methylglyoxal-derived advanced glycation end-product in familial amyloidotic polyneuropathy. Biochem J 385(Pt 2), 339-345.

Gomes, R. A., Sousa Silva, M., Vicente Miranda, H., Ferreira, A. E., Cordeiro, C. A. & Freire, A. P. (2005b). Protein glycation in Saccharomyces cerevisiae. Argpyrimidine formation and methylglyoxal catabolism. Febs J 272, 4521-4531.

Gomes, R. A., Vicente Miranda, H., Sousa Silva, M., Graca, G., Coelho, A. V., do Nascimento Ferreira, A. E., Cordeiro, C. & Freire, A. P. (2008) Protein glycation and methylglyoxal metabolism in yeast: finding peptide needles in protein haystacks. FEMS Yeast Res 8, 174-181.

Gonzalez, R.G., Barnett, P., Aguayo, J., Cheng, H.M. & Chylack, L.T., Jr. (1984a) Direct measurement of polyol pathway activity in the ocular lens. Diabetes 33(2), 196-199.

Gonzalez, R.G., Barnett, P., Cheng, H.M. & Chylack, L.T., Jr. (1984b) Altered phosphate metabolism in the intact rabbit lens under high glucose conditions and its prevention by an aldose reductase inhibitor. Exp Eye Res 39(5), 553-562.

Grimshaw, C. E., Shahbaz, M., and Putney, C. G. (1990) Mechanism of Aldose Reductase Inhibition: Binding of NADP+/NADPH and Alrestatin-like Inhibitors. Biochemistry 29, 9936-9946.

Han, L.P., Davison, L.M. & Vander Jagt, D.L. (1976) Purification and kinetic study of glyoxalase-I from rat liver, erythrocytes, brain and kidney. Biochim Biophys Acta 445(2), 486-499.


111155

Hannaert, V., Bringaud, F., Opperdoes, F. R., and Michels, P. A. (2003) Evolution of energy metabolism and its compartmentation in Kinetoplastida. Kinetoplastid Biol Dis 2, 11.

Hannaert, V. & Michels, P. A. (1994) Structure, function, and biogenesis of glycosomes in kinetoplastida. J Bioenerg Biomembr 26, 205-212.

He, M.M., Clugston, S.L., Honek, J.F. & Matthews, B.W. (2000) Determination of the structure of Escherichia coli glyoxalase I suggests a structural basis for differential metal activation. Biochemistry 39(30), 8719-8727.

Henderson, G. B., Yamaguchi, M., Novoa, L., Fairlamb, A. H. & Cerami, A. (1990) Biosynthesis of the trypanosomatid metabolite trypanothione: purification and characterization of trypanothione synthetase from Crithidia fasciculata. Biochemistry 29, 3924-3929.

Hepburn, N. C. (2003) Cutaneous leishmaniasis: current and future management. Expert Review of Anti-Infective

Therapy, 1(4), 563-570. Hers, H.G. (1956) The mechanism of the transformation of glucose in fructose in the seminal vesicles. Biochim

Biophys Acta 22(1), 202-203. Hertz-Fowler, C., Peacock, C. S., Wood, V., Aslett, M., Kerhornou, A., Mooney, P., Tivey, A., Berriman, M.,

Hall, N., Rutherford, K., Parkhill, J., Ivens, A. C., Rajandream, M. A., and Barrell, B. (2004) GeneDB: a resource for prokaryotic and eukaryotic organisms. Nucleic Acids Res 32, D339-D343.

Herwaldt, B. L. (1999). Leishmaniasis. Lancet 354, 1191-1199. Hibi, T., Nii, H., Nakatsu, T., Kimura, A., Kato, H., Hiratake, J. & Oda, J. (2004) Crystal structure of gamma-

glutamylcysteine synthetase: insights into the mechanism of catalysis by a key enzyme for glutathione homeostasis. Proc Natl Acad Sci 101, 15052-15057.

Himo, F. & Siegbahn, P. E. (2001) Catalytic mechanism of glyoxalase I: a theoretical study. J Am Chem Soc 123, 10280-10289.

Hoare, C. A. (1967) Evolutionary trends in mammalian trypanosomes in Ben Dawes, Advances in Parasitology Academic Press, 5, 47.

Hopkins, G. & Morgan, E.J. (1945) On the Distribution of Glyoxalase and Glutathione. Biochem J 39, 320-324. Hopper, D.J. & Cooper, R.A. (1971) The regulation of Escherichia coli methylglyoxal synthase; a new control

site in glycolysis? FEBS Lett 13(4), 213-216. Hopper, D.J. & Cooper, R.A. (1972) The purification and properties of Escherichia coli methylglyoxal synthase.

Biochem J 128(2), 321-329. Hubel, A., Brandau, S., Dresel, A., and Clos, J. (1995) A member of the ClpB family of stress proteins is

expressed during heat shock in Leishmania spp. Mol Biochem Parasitol 70, 107–118 Huynh, C., Sacks, D. L., and Andrews, N. W. (2006) A Leishmania amazonensis ZIP family iron transporter is

essential for parasite replication within macrophage phagolysosomes. J Exp Med 203, 2363–2375 Inoue, Y. & Kimura, A. (1996) Identification of the structural gene for glyoxalase I from Saccharomyces

cerevisiae. J Biol Chem 271(42), 25958-25965. Iozef, R., Rahlfs, S., Chang, T., Schirmer, H. & Becker, K. (2003) Glyoxalase I of the malarial parasite

Plasmodium falciparum: evidence for subunit fusion. FEBS Letters 554, 284-288. Irsch, T. & Krauth-Siegel, R.L. (2004) Glyoxalase II of African trypanosomes is trypanothione-dependent. J

Biol Chem 279(21), 22209-22217. Iwata, K., Matsuno, K., Nishinaka, T., Persson, C. & Yabe-Nishimura, C. (2006) Aldose reductase inhibitors

improve myocardial reperfusion injury in mice by a dual mechanism. J Pharmacol Sci 102(1), 37-46. Izaguirre, G., Kikonyogo, A. & Pietruszko, R. (1998) Methylglyoxal as substrate and inhibitor of human

aldehyde dehydrogenase: comparison of kinetic properties among the three isozymes. Comp Biochem Physiol B Biochem Mol Biol 119(4), 747-754.

Jaeger, T. & Flohe, L. (2006) The thiol-based redox networks of pathogens: unexploited targets in the search for new drugs. Biofactors 27, 109-120.

Jeffery, J. & Jornvall, H. (1983) Enzyme relationships in a sorbitol pathway that bypasses glycolysis and pentose phosphates in glucose metabolism. Proc Natl Acad Sci U S A 80(4), 901-5.

Jez, J. M.., Bennet, M. J., Schlegel, B. P., Lewis, M., Penning, T. M. (1997) Comparative anatomy of the aldo-keto reductase superfamily. Biochem J 326, 625-636.

Jez, J. M. & Penning, T. M. (2001) The aldo-keto reductase (AKR) superfamily: an update. Chem Biol Interact 130-132, 499-525.

Joiner, D. D., Greene, C. E., Latimer, K. S., Bain, P. J., Tarpley, H. L. (2005) An Overview of Leishmaniasis, Class of 2005 (Joiner), Department of Small Animal Medicine (Greene), and Department of Pathology (Latimer, Bain, Tarpley), College of Veterinary Medicine, University of Georgia, USA.


116

Kabsch, W. (1993). Automatic processing of rotation diffraction data from crystals of initially unknown symmetry and cell constants. J Appl Cryst 26, 795-800.

Kalapos, M.P. (1999) Methylglyoxal in living organisms: chemistry, biochemistry, toxicology and biological implications. Toxicol Lett 110(3), 145-175.

Kamhawi, S., Ramalho-Ortigao, M., Pham, V. M., Kumar, S., Lawyer, P. G., Turco, S. J., Barillas-Mury, C., Sacks, D. L. & Valenzuela, J. G. (2004) A role for insect galectins in parasite survival. Cell 119, 329-341.

Kantardjieff, K. A. & Rupp, B. (2003) Matthews coefficient probabilities: Improved estimates for unit cell contents of proteins, DNA, and protein-nucleic acid complex crystals. Protein Sci 12, 1865-1871.

Keegan, F.P. and Blum, J.J. (1995) The NADP-linked aldehyde reductase of Leishmania donovani. J Eukaryot. Microbiol. 42, 255-257.

Kim, N. S., Sekine, S., Kiuchi, N. & Kato, S. (1995) cDNA cloning and characterization of human glyoxalase I isoforms from HT-1080 cells. J Biochem 117, 359-361.

Kleywegt, G. J. & Jones, T. A. (1996) Phi/psi-chology: Ramachandran revisited. Structure 4, 1395-1400. Koop, D.R. & Casazza, J.P. (1985) Identification of ethanol-inducible P-450 isozyme 3a as the acetone and

acetol monooxygenase of rabbit microsomes. J Biol Chem 260(25), 13607-13612. Kratochvil, P. (1987) Classical Light Scattering from Polymer Solutions. Elsevier, Amsterdam. Krauth-Siegel, R. L. & Ludemann, H. (1996) Reduction of dehydroascorbate by trypanothione. Mol Biochem

Parasitol 80, 203-208. Krauth-Siegel, R. L., Bauer, H., and Schirmer, R. H. (2005) Dithiol proteins as guardians of the intracellular

redox milieu in parasites: old and new drug targets in trypanosomes and malaria-causing plasmodia. Angew Chem Int Ed Engl 44, 690-715.

Jaskowski R. A., MacArthur M. W., Moss D. S., Thornton J. M. (1993) PROCHECK - a program to check the stereochemical quality of protein structures. J App Cryst, 26, 283-291.

Leissing, N.C. & McGuinness, E.T. (1983) Kinetic analysis of rat liver sorbitol dehydrogenase. Int J Biochem 15(5), 651-656.

Leoncini, G., Maresca, M. and Bonsignore, A. (1980) The Effect of Methylglyoxal on the Glycolytic-Enzymes. FEBS Lett 117, 17-18.

Leslie, A. G. W. (1992) Recent changes to the MOSFLM package for processing film and image plate data. Joint CCP4 and ESF-EACBM Newsletters on Protein Crystallography 26.

Lo, T.W., Westwood, M.E., McLellan, A.C., Selwood, T. & Thornalley, P.J. (1994) Binding and modification of proteins by methylglyoxal under physiological conditions. A kinetic and mechanistic study with N alpha-acetylarginine, N alpha-acetylcysteine, and N alpha-acetyllysine, and bovine serum albumin. J Biol Chem 269(51), 32299-32305.

Lohman, K. (1932) Beitrag zur enzymatischen Umwandling von synthetischen Methylglyoxal in Milchsaure. Biochem Z 254, 332-354.

Lohman, K. & Meyerhof, O. (1934) Uber die enzymatische umwandlung von phosphoglyzerinsaure in renztraubensaure und phosphorsaure (Enzymatic transformation of phosphoglyceric acid into pyruvic and phosphoric acid). Biochem Z 273, 60–72.

Lyles, G.A. & Chalmers, J. (1992) The metabolism of aminoacetone to methylglyoxal by semicarbazide-sensitive amine oxidase in human umbilical artery. Biochem Pharmacol 43(7), 1409-1414.

Maeta, K., Mori, K., Takatsume, Y., Izawa, S. & Inoue, Y. (2005b) Diagnosis of cell death induced by methylglyoxal, a metabolite derived from glycolysis, in Saccharomyces cerevisiae. FEMS Microbiol Lett 243(1), 87-92.

Maiti, M.K., Krishnasamy, S., Owen, H.A. & Makaroff, C.A. (1997) Molecular characterization of glyoxalase II from Arabidopsis thaliana. Plant Mol Biol 35(4), 471-481.

Mannervik, B., Bartfai, T. & Gorna-Hall, B. (1974) Random pathway mechanism involving parallel one- and two- substrate branches for glyoxalase I from yeast. J Biol Chem 249(3), 901-903.

Marasinghe, G.P., Sander, I.M., Bennett, B., Periyannan, G., Yang, K.W., Makaroff, C.A. & Crowder, M.W. (2005) Structural studies on a mitochondrial glyoxalase II. J Biol Chem 280(49), 40668-40675.

Marinari, U. M., Ferro, M., Sciaba, L., Finollo, R., Bassi, A. M. & Brambilla, G. (1984). DNA-damaging activity of biotic and xenobiotic aldehydes in Chinese hamster ovary cells. Cell Biochem Funct 2, 243-248.

Marmstal, E., Aronsson, A.C. & Mannervik, B. (1979) Comparison of glyoxalase I purified from yeast (Saccharomyces cerevisiae) with the enzyme from mammalian sources. Biochem J 183(1), 23-30.


111177

Marmstal, E. & Mannervik, B. (1978) Subunit structure of glyoxalase I from yeast. FEBS Lett 85(2), 275-278. Martensson, J., Jain, A. & Meister, A. (1990) Glutathione is required for intestinal function. Proc Natl Acad Sci

U S A 87(5), 1715-1759. Martins, A. M., Cordeiro, C., and Freire, A. P. (1999) Glyoxalase II in Saccharomyces cerevisiae: In situ kinetics

using the 5,5'-dithiobis(2-nitrobenzoic acid) assay. Archives of Biochemistry and Biophysics 366, 15-20. Martins, A.M., Cordeiro, C.A. & Ponces Freire, A.M. (2001a) In situ analysis of methylglyoxal metabolism in

Saccharomyces cerevisiae. FEBS Lett 499(1-2), 41-44. Martins, A. M., Mendes, P., Cordeiro, C. & Freire, A. P. (2001b) In situ kinetic analysis of glyoxalase I and

glyoxalase II in Saccharomyces cerevisiae. Eur J Biochem 268, 3930-3936. Matthews, B. W. (1968) Solvent content of protein crystals. J Mol Biol 33, 491-497. Michels, P. A., Hannaert, V., and Bringaud, F. (2000) Metabolic aspects of glycosomes in trypanosomatidae -

new data and views. Parasitol Today 16, 482-489. Migliore, L., Barale, R., Bosco, E., Giorgelli, F., Minunni, M., Scarpato, R. & Loprieno, N. (1990)

Genotoxicity of methylglyoxal: cytogenetic damage in human lymphocytes in vitro and in intestinal cells of mice. Carcinogenesis 11(9), 1503-1507.

Monder, C. (1967) Alpha-keto aldehyde dehydrogenase, an enzyme that catalyzes the enzymic oxidation of methylglyoxal to pyruvate. J Biol Chem 242(20), 4603-4609.

Montalban, C., J.L. Calleja, A. Erice, F. Laguna, B. Clotet, D. Podzamczer, J. Cobo, J. Mallolas, M. Yebra, and A. Gallego. (1990) Visceral leishmaniasis in patients infected with human immunodeficiency virus. Co-operative Group for the Study of Leishmaniasis in AIDS. J Infect 21, 261-270.

Morel, C. & Simpson, L. (1980) Characterization of pathogenic trypanosomatidae by restriction endonuclease fingerprinting of kinetoplast DNA minicircles. Am J Trop Med Hyg 29, 1070-1074.

Moutiez, M.; Meziane-Cherif, D.; Aumercier, M.; Sergheraert, C.; Tartar, A. (1994) Compared reactivities of trypanothione and glutathione in conjugation reactions. Chem. Pharm. Bull. 42: 2641– 2644.

Moyersoen, J., Choe, J., Fan, E., Hol, W. G. & Michels, P. A. (2004) Biogenesis of peroxisomes and glycosomes: trypanosomatid glycosome assembly is a promising new drug target. FEMS Microbiol Rev 28, 603-643.

Muller, S., Liebau, E., Walter, R. D., and Krauth-Siegel, R. L. (2003) Thiol-based redox metabolism of protozoan parasites. Trends in Parasitology 19, 320-328.

Mueller-Dieckmann, J. (2006) The open-access high-throughput crystallization facility at EMBL Hamburg. Acta Crystallogr D Biol Crystallogr 62, 1446-1452.

Murray, H. W., Berman, J. D., Davies, C. R. & Saravia, N. G. (2005) Advances in leishmaniasis. Lancet 366(9496), 1561-1577.

Murshudov, G. N., Vagin, A. A. & Dodson, E. J. (1997) Refinement of macromolecular structures by the maximum-likelihood method. Acta Crystallogr D Biol Crystallogr 53, 240-255.

Myler, P. & Fasel, N. (2008) Leishmania: After the Genome, Caister Academic Press, Norfolk, UK. Naderer, T., Ellis, M. A., Sernee, M. F., De Souza, D. P., Curtis, J., Handman, E., and McConville, M. J.

(2006) Virulence of Leishmania major in macrophages and mice requires the gluconeogenic enzyme fructose-1,6-biphosphate. Proc Natl Acad Sci 103, 5502-5507.

Nagaraj, R.H., Shipanova, I.N. & Faust, F.M. (1996) Protein cross-linking by the Maillard reaction. Isolation, characterization, and in vivo detection of a lysine-lysine cross-link derived from methylglyoxal. J Biol Chem 271(32), 19338-19345.

Neuberg, C. & Kobel, M. (1928) Über die Frage nach der Identität von Mutase und Ketonaldehydemutase. Biochemische Zeitschrift 203, 631-646.

Neuberg, C. (1913) Uber die Zerstorung von Milchsaueraldehyd und Methylglyoxal dursch tierische Organe. Biochem. Z. 49, 573-579.

Nishihara, K., Kanemori, M., Kitagawa, M., Yanagi, H. and Yura, T. (1998) Chaperone coexpression plasmids: differential and synergistic roles of DnaK-DnaJ-GrpE and GroEL-GroES in assisting folding of an allergen of Japanese cedar pollen, Cryj2, in Escherichia coli. Appl Environ Microbiol 64, 1694-1699.

Norton, S.J., Talesa, V., Yuan, W.J. & Principato, G.B. (1990) Glyoxalase I and glyoxalase II from Aloe vera: purification, characterization and comparison with animal glyoxalases. Biochem Int 22(3), 411-418.

Nugent, P. G., Karsani, S. A., Wait, R., Tempero, J., and Smith, D. F. (2004) Proteomic analysis of Leishmania mexicana differentiation. Mol Biochem Parasitol 136, 51–62.

Okado, A., Kawasaki, Y., Hasuike, Y., Takahashi, M., Teshima, T., Fujii, J. & Taniguchi, N. (1996) Induction of apoptotic cell death by methylglyoxal and 3-deoxyglucosone in macrophage-derived cell lines. Biochem Biophys Res Commun 225(1), 219-224.


118

Opperdoes, F. R. & Borst, P. (1977). Localization of nine glycolytic enzymes in a microbody-like organelle in Trypanosoma brucei: the glycosome. FEBS Lett 80, 360-364.

Opperdoes, F. R. (1987). Compartmentation of carbohydrate metabolism in trypanosomes. Annu Rev Microbiol 41, 127-151.

Opperdoes, F. R., and Coombs, G. H. (2007) Metabolism of Leishmania: proven and predicted. Trends Parasitol 23, 149-158.

Opperdoes, F. R., and Michels, P. A. M. (2008) The metabolic repertoire of Leishmania and implications for drug discovery. Research Unit for Tropical Diseases, Christian de Duve Institute of Cellular Pathology, and Laboratory of Biochemistry, Université catholique de Louvain, Belgium.

Oray, B. & Norton, S.J. (1980) Purification and characterization of mouse liver glyoxalase II. Biochim Biophys Acta 611(1), 168-173.

Oya, T., Hattori, N., Mizuno, Y., Miyata, S., Maeda, S., Osawa, T. & Uchida, K. (1999) Methylglyoxal modification of protein. Chemical and immunochemical characterization of methylglyoxal-arginine adducts. J Biol Chem 274(26), 18492-18502.

Oza, S. L., Ariyanayagam, M. R. & Fairlamb, A. H. (2002) Characterization of recombinant glutathionylspermidine synthetase/amidase from Crithidia fasciculata. Biochem J 364, 679-686.

Oza, S. L., Shaw, M. P., Wyllie, S. & Fairlamb, A. H. (2005) Trypanothione biosynthesis in Leishmania major. Mol Biochem Parasitol 139, 107-116.

Padmanabhan, P. K., Mukherjee, A., Singh, S., Chattopadhyaya, S., Gowri, V. S., Myler, P. J., Srinivasan, N., and Madhubala, R. (2005) Glyoxalase I from Leishmania donovani: a potential target for anti-parasite drug. Biochem Biophys Res Commun 337, 1237-1248.

Padmanabhan, P. K., Mukherjee, A. & Madhubala, R. (2006) Characterization of the gene encoding glyoxalase II from Leishmania donovani: a potential target for anti-parasite drugs. Biochemical J 393, 227-234.

Painter, J., and Merritt, E. A. (2006) Optimal description of a protein structure in terms of multiple groups undergoing TLS motion. Acta Crystallogr D Biol Crystallogr 62, 439-450.

Pantoliano, M. W., Petrella, E. C., Kwasnoski, J. D., Lobanov, V. S., Myslik, J., Graf, E., Carver, T., Asel, E., Springer, B. A., Lane, P. (2001) High-Density Miniaturized Thermal Shift Assays as a General Strategy for Drug Discovery. J Biomol Screen 6, 429-440.

Pettersen, E. F., Goddard, T. D., Huang, C. C., Couch, G. S., Greenblatt, D. M., Meng, E. C., and Ferrin, T. E. (2004) UCSF Chimera--a visualization system for exploratory research and analysis. J Comput Chem 25, 1605-1612.

Pischetsrieder, M., Seidel, W., Munch, G. & Schinzel, R. (1999) N(2)-(1-Carboxyethyl)deoxyguanosine, a nonenzymatic glycation adduct of DNA, induces single-strand breaks and increases mutation frequencies. Biochem Biophys Res Commun 264(2), 544-549.

Ponces Freire, A., Ferreira, A., Gomes, R. & Cordeiro, C. (2003) Anti-glycation defences in yeast. Biochem Soc Trans 31(Pt 6), 1409-1412.

Potterton, E., McNicholas, S., Krissinel, E., Cowtan, K., and Noble, M. (2002) The CCP4 molecular-graphics project. Acta Crystallogr D Biol Crystallogr 58, 1955-1957.

Potterton, L., McNicholas, S., Krissinel, E., Gruber, J., Cowtan, K., Emsley, P., Murshudov, G. N., Cohen, S., Perrakis, A., and Noble, M. (2004) Developments in the CCP4 molecular-graphics project. Acta Crystallogr D Biol Crystallogr 60, 2288-2294.

Principato, G.B., Bodo, M., Biagioni, M.G., Rosi, G. & Liotti, F.S. (1982) Glyoxalases and glutathione reductase activity changes in chicken liver during embryo development and after hatching. Acta Embryol Morphol Exp 3(3), 173-179.

Principato, G.B., Rosi, G., Talesa, V., Bocchini, V. & Giovannini, E. (1984) Purification of S-2-hydroxyacylglutathione hydrolase (Glyoxalase II) from calf brain. Biochem Int 9(3), 351-359.

Puttaiah, S., Biswas, A., Staniszewska, M. & Nagaraj, R. H. (2007). Methylglyoxal inhibits glycation-mediated loss in chaperone function and synthesis of pentosidine in alpha-crystallin. Exp Eye Res 84, 914-921.

Racker, E. (1951) The mechanism of action of glyoxalase. J Biol Chem 190(2), 685-696. Rae, C., Berners-Price, S. J., Bulliman, B. T. & Kuchel, P. W. (1990) Kinetic of the human erythrocyte

glyoxalase system using 1H NMR and a computer model. Eur J Biochem 193, 83-90. Rahman, A., Shahabuddin & Hadi, S.M. (1990) Formation of strand breaks and interstrand cross-links in

DNA by methylglyoxal. J Biochem Toxicol 5(3), 161-166.


111199

Ramasamy, R., Oates, P.J. & Schaefer, S. (1997) Aldose reductase inhibition protects diabetic and nondiabetic rat hearts from ischemic injury. Diabetes 46(2), 292-300.

Rath, J., Gowri, V. S., Chauhan, S. C., Padmanabhan, P. K., Srinivasan, N. & Madhubala, R. (2009). A glutathione-specific aldose reductase of Leishmania donovani and its potential implications for methylglyoxal detoxification pathway. Gene 429, 1-9.

Ray, M. & Ray, S. (1984) Purification and partial characterization of a methylglyoxal reductase from goat liver. Biochim Biophys Acta 802(1), 119-127.

Ray, M. & Ray, S. (1987) Aminoacetone oxidase from goat liver. Formation of methylglyoxal from aminoacetone. J Biol Chem 262(13), 5974-5977.

Read, R. J. (2001) Pushing the boundaries of molecular replacement with maximum likelihood. Acta Crystallogr D Biol Crystallogr 57, 1373-1382.

Richard, J.P. (1984) Acid-Base Catalysis of the Elimination and Isomerization-Reactions of Triose Phosphates. Journal of the American Chemical Society 106(17), 4926-4936.

Richard, J.P. (1991) Kinetic-Parameters for the Elimination-Reaction Catalyzed by Triosephosphate Isomerase and an Estimation of the Reactions Physiological Significance. Biochemistry 30(18), 4581-4585.

Richard, J.P. (1993) Mechanism for the formation of methylglyoxal from triosephosphates. Biochem Soc Trans 21(2), 549-553.

Ridderstrom, M. & Mannervik, B. (1996) Optimized heterologous expression of the human zinc enzyme glyoxalase I. Biochem J 314 ( Pt 2), 463-467.

Ridderstrom, M., Saccucci, F., Hellman, U., Bergman, T., Principato, G. & Mannervik, B. (1996). Molecular cloning, heterologous expression, and characterization of human glyoxalase II. Journal Biological Chemistry 271, 319-323.

Ridderstrom, M., Cameron, A.D., Jones, T.A. & Mannervik, B. (1998) Involvement of an active-site Zn2+ ligand in the catalytic mechanism of human glyoxalase I. J Biol Chem 273(34), 21623-21628.

Rosenzweig, D., Smith, D., Opperdoes, F., Stern, S., Olafson, R. W., Zilberstein, D. (2008) Retooling Leishmania metabolism: from and fly gut to human macrophage. FASEB J. 22, 590–602.

Rosypal, A. C., Tripp, S., Kinlaw, C., Hailemariam, S., Tidwell, R. R., Lindsay, D. S., Rajapakse, R. P. V. J.,

Sreekumar, C. & Dubey, J. P. (2010) Surveillance for Antibodies to Leishmania spp. in Dogs from Sri Lanka. J of Parasitol 96(1), 230-231.

Ryle, C. M. & Tipton, K. F. (1985) Kinetic studies with the low-Km aldehyde reductase from ox brain. Biochem. J. 227, 621-627

Saadat D. & Harrison D.H. (1998) Identification of catalytic bases in the active site of Escherichia coli methylglyoxal synthase: cloning, expression, and functional characterization of conserved aspartic acid residues. Biochemistry 37, 10074–10086.

Saar, Y., Ransford, A., Waldman, E., Mazareb, S., Amin-Spector, S., Plumblee, J., Turco, S. J. & Zilberstein, D. (1998) Characterization of developmentally-regulated activities in axenic amastigotes of Leishmania donovani. Mol Biochem Parasitol 95, 9–20.

Saint-Jean, A. P., Phillips, K. R., Creighton, D. J. & Stone, M. J. (1998) Active monomeric and dimeric forms of Pseudomonas putida glyoxalase I: evidence for 3D domain swapping. Biochemistry 37, 10345-10353.

Samaras, N. & Terry, Spithill W. (1989) The developmentally regulated P100/11E gene of Leishmania major shows homology to a superfamily of reductase genes. The Journal of Biological Chemistry 264, No. 7, 4251-4254.

Saxena, A., Lahav, T., Holland, N., Aggarwal, G., Anupama, A., Huang, Y., Volpin, H., Myler, P. J. & Zilberstein, D. (2007) Analysis of the Leishmania donovani transcriptome reveals an ordered progression of transient and permanent changes in gene expression during differentiation. Mol Biochem Parasitol 152, 53-65.

Schmidt, H. & Krauth-Siegel, R. L. (2003) Functional and physicochemical characterization of the thioredoxin system in Trypanosoma brucei. J Biol Chem 278, 46329-46336.

Scire, A., Tanfani, F., Saccucci, F., Bertoli, E. & Principato, G. (2000) Specific interaction of cytosolic and mitochondrial glyoxalase II with acidic phospholipids in form of liposomes results in the inhibition of the cytosolic enzyme only. Proteins 41(1), 33-39.

Shames, S. L., Fairlamb, A. H., Cerami, A. & Walsh, C. T. (1986) Purification and characterization of trypanothione reductase from Crithidia fasciculata, a newly discovered member of the family of disulfide-containing flavoprotein reductases. Biochemistry 25, 3519-3526.

Sharma, U. & Singh, S. (2008) Insect vectors of Leishmania: distribution, physiology and their control. J Vector Borne Dis 45, 255–272.


120

Shaw, J., Lainson, R. (1968) Leishmaniasis in Brazil: II. Observations on enzootic rodent leishmaniasis in the lower amazon region—the feeding habits of the vector, Lutzomyia flaviscutellata in reference to man, rodents and other animals, Transactions of the Royal Society of Tropical Medicine and Hygiene 62(3), 396-405.

Shevchenko, A., Tomas, H., Havlis, J., Olsen, J. V. and Mann, M. (2006) In-gel digestion of mass spectrometric characterization of proteins and proteomes. Nature Protocols 1(6), 2856-2860.

Simpson, L., Neckelmann, N., de la Cruz, V. F., Simpson, A. M., Feagin, J. E., Jasmer, D. P. & Stuart, J. E. (1987) Comparison of the maxicircle (mitochondrial) genomes of Leishmania tarentolae and Trypanosoma brucei at the level of nucleotide sequence. J Biol Chem 262, 6182-6196.

Silva, M. S., Barata, L., Ferreira, A. E., Romao, S., Tomas, A. M., Freire, A. P. & Cordeiro, C. (2008) Catalysis and structural properties of Leishmania infantum glyoxalase II: trypanothione specificity and phylogeny. Biochemistry 47, 195-204.

Sousa Silva, M., Ferreira, A.E., Tomas, A.M., Cordeiro, C. & Ponces Freire, A. (2005) Quantitative assessment of the glyoxalase pathway in Leishmania infantum as a therapeutic target by modelling and computer simulation. Febs J 272(10), 2388-2398.

Stanford University, USA [Internet] (2003) Class on “Vectors and Reservoirs of Leishmania”; May 2010. Available from: www.stanford.edu/class/humbio103/ParaSites2003/Leishmania.

Stark, D., Pett, S., Marriott, D. & Harkness, J. (2006) Post-kala-azar dermal leishmaniasis due to Leishmania infantum in a human immunodeficiency virus type 1-infected patient. J Clin Microbiol 44, 1178-1180.

Sturm, N. R. & Simpson, L. (1990) Kinetoplast DNA minicircles encode guide RNAs for editing of cytochrome oxidase subunit III mRNA. Cell 61, 879-884.

Sturm, N. R., Degrave, W., Morel, C. & Simpson, L. (1989) Sensitive detection and schizodeme classification of Trypanosoma cruzi cells by amplification of kinetoplast minicircle DNA sequences: use in diagnosis of Chagas' disease. Mol Biochem Parasitol 33, 205-214.

Sukdeo, N., Clugston, S. L., Daub, E. & Honek, J. F. (2004) Distinct classes of glyoxalase I: metal specificity of the Yersinia pestis, Pseudomonas aeruginosa and Neisseria meningitidis enzymes. Biochem J 384, 111-117.

Sundar, S. (2001) Drug resistance in Indian visceral leishmaniasis. Trop Med Int Health 6, 849-854. Szent-Gyorgyi, A. (1965) Cell Division and Cancer. Science 149, 34-37. Talesa, V., Uotila, L., Koivusalo, M., Principato, G., Giovannini, E. & Rosi, G. (1988) Demonstration of

glyoxalase II in rat liver mitochondria. Partial purification and occurrence in multiple forms. Biochim Biophys Acta 955(1), 103-110.

Talesa, V., Uotila, L., Koivusalo, M., Principato, G., Giovannini, E. & Rosi, G. (1989) Isolation of glyoxalase II from two different compartments of rat liver mitochondria. Kinetic and immunochemical characterization of the enzymes. Biochim Biophys Acta 993(1), 7-11.

Talesa, V., Principato, G.B., Norton, S.J., Contenti, S., Mangiabene, C. & Rosi, G. (1990a) Isolation of glyoxalase II from bovine liver mitochondria. Biochem Int 20(1), 53-58.

Talesa, V., Rosi, G., Bistoni, F., Marconi, P., Norton, S.J. & Principato, G.B. (1990b) Presence of a plant-like glyoxalase II in Candida albicans. Biochem Int 21(3), 397-403.

The CCP4 suite (1994) Programs for protein crystallography. Acta Crystallogr D Biol Crystallogr 50, 760-763. Tesh, R. B. (1995) Control of zoonotic visceral leishmaniasis: is it time to change strategies? Am J Trop Med

Hyg 52, 287-292. Thompson, J. D., Higgins, D. G., & Gibson, T. J. (1994) CLUSTAL W: improving the sensitivity of

progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res 22, 4673-4680.

Thornalley, P.J. (1990) The glyoxalase system: new developments towards functional characterization of a metabolic pathway fundamental to biological life. Biochem J 269(1), 1-11.

Thornalley, P.J. (1993) The glyoxalase system in health and disease. Mol Aspects Med 14(4), 287-371. Thornalley, P.J. (1996) Pharmacology of methylglyoxal: formation, modification of proteins and nucleic acids,

and enzymatic detoxification--a role in pathogenesis and antiproliferative chemotherapy. Gen Pharmacol 27(4), 565-573.

Thornalley, P. J. (1998) Glutathione-dependent detoxification of alpha-oxoaldehydes by the glyoxalase system: involvement in disease mechanisms and antiproliferative activity of glyoxalase I inhibitors. Chemico-Biological Interactions 111-112, 137-151.


112211

Thornalley, P. J. (2003). Glyoxalase I-structure, function and a critical role in the enzymatic defence against glycation. Biochem Soc Trans 31, 1343-1348.

Tovar, J., Cunningham, M. L., Smith, A. C., Croft, S. L. & Fairlamb, A. H. (1998) Down-regulation of Leishmania donovani trypanothione reductase by heterologous expression of a trans-dominant mutant homologue: effect on parasite intracellular survival, Proc Natl Acad Sci 95, 5311-5316.

Tressel, T., Thompson, R., Zieske, L.R., Menendez, M.I. & Davis, L. (1986) Interaction between L-threonine dehydrogenase and aminoacetone synthetase and mechanism of aminoacetone production. J Biol Chem 261(35), 16428-16437.

Trincao, J., Sousa Silva, M., Barata, L., Bonifacio, C., Carvalho, S., Tomas, A.M., Ferreira, A.E., Cordeiro, C., Ponces Freire, A. & Romao, M.J. (2006) Purification, crystallization and preliminary X-ray diffraction analysis of the glyoxalase II from Leishmania infantum. Acta Crystallogr Sect F 62, 805-807.

Turk, Z., Nemet, I., Varga-Defteardarovic, L. & Car, N. (2006) Elevated level of methylglyoxal during diabetic ketoacidosis and its recovery phase. Diabetes Metab 32(2), 176-180.

Uotila, L. (1973) Purification and characterization of S-2-hydroxyacylglutathione hydrolase (glyoxalase II) from human liver. Biochemistry 12(20), 3944-3951.

Urzhumtsev, A., Tete-Favier, F., Mitschler, A., Barbanton, J., Barth, P., Urzhumtseva, L., Biellmann, J. F., Podjarny, A. & Moras, D. (1997) A 'specificity' pocket inferred from the crystal structures of the complexes of aldose reductase with the pharmaceutically important inhibitors tolrestat and sorbinil. Structure 5, 601-612.

Vander Jagt, D.L., Han, L.P. & Lehman, C.H. (1972) Kinetic evaluation of substrate specificity in the glyoxalase-I-catalyzed disproportionation of -ketoaldehydes. Biochemistry 11(20), 3735-3740.

Vander Jagt, D.L., Daub, E., Krohn, J.A. & Han, L.P. (1975) Effects of pH and thiols on the kinetics of yeast glyoxalase I. An evaluation of the random pathway mechanism. Biochemistry 14(16), 3669-3675.

Vander Jagt, D.L., Robinson, B., Taylor, K.K. & Hunsaker, L.A. (1990) Aldose reductase from human skeletal and heart muscle. Interconvertible forms related by thiol-disulfide exchange. J Biol Chem 265(34), 20982-20987.

Vander Jagt, D.L., Robinson, B., Taylor, K.K. & Hunsaker, L.A. (1992) Reduction of trioses by NADPH-dependent aldo-keto reductases. Aldose reductase, methylglyoxal, and diabetic complications. J Biol Chem 267(7), 4364-4369.

Vander Jagt, D.L. (1993a) Glyoxalase II: molecular characteristics, kinetics and mechanism. Biochem Soc Trans 21(2), 522-527.

Vander Jagt, D.L., Hunsaker, L.A. (1993b) Substrate specificity of reduced and oxidized forms of human aldose reductase. Adv Exp Med Biol 328, 279-288.

Vagin, A. & Teplyakov, A. (1997) An approach to multi-copy search in molecular replacement. J Appl Cryst 30, 1022-1025.

Vaguine, A. A., Richelle, J. & Wodak, S. J. (1999) SFCHECK: a unified set of procedures for evaluating the quality of macromolecular structure-factor data and their agreement with the atomic model. Acta Crystallogr D Biol Crystallogr 55, 191-205.

Verbruggen, C., DeCraecker, S., Rajan, P., Jiao, X. Y., Borloo, M., Smith, K., Fairlamb, A. H. & Haemers, A. (1996) Phosphonic acid and phosphinic acid tripeptides as inhibitors of glutathionylspermidine synthetase. Bioorganic & Medicinal Chemistry Letters 6, 253-258.

Vickers, T.J., Greig, N. & Fairlamb, A.H. (2004) A trypanothione-dependent glyoxalase I with a prokaryotic ancestry in Leishmania major. Proc Natl Acad Sci 101(36), 13186-13191.

Visser, N., Opperdoes, F. R. & Borst, P. (1981) Subcellular compartmentation of glycolytic intermediates in Trypanosoma brucei. Eur J Biochem 118, 521-526.

Walker, J., Vasquez, J. J., Gomez, M. A., Drummelsmith, J., Burchmore, R., Girard, I., & Ouellette, M. (2006) Identification of developmentally-regulated proteins in Leishmania panamensis by proteome profiling of promastigotes and axenic amastigotes. Mol Biochem Parasitol 147, 64–73.

Weiss, M. S. (2001). Global indicators of X-ray data quality. J Appl Cryst 34, 130-135. Westwood, M.E., Argirov, O.K., Abordo, E.A. & Thornalley, P.J. (1997) Methylglyoxal-modified arginine

residues--a signal for receptor-mediated endocytosis and degradation of proteins by monocytic THP-1 cells. Biochim Biophys Acta 1356(1), 84-94.

WHO [Internet] (2003) Leishmaniasis. Essential leishmaniasis maps; May 2010. Available from: www.who.int/leishmaniasis/leishmaniasis_maps/en/index.

WHO [Internet] (2010) Leishmaniasis. A brief history of the disease; May 2010. Available from: www.who.int/leishmaniasis/history_disease/en/index.


122

WHO [Internet] (2010) Leishmaniasis. Initiative for Vaccine Research; May 2010. Available from: www.who.int/vaccine_research/diseases/leishmaniasis/en.

WHO [Internet] (2010) Leishmaniasis. The disease and its epidemiology; May 2010. Available from: www.who.int/leishmaniasis/disease_epidemiology/en/index.

WHO [Internet] (2010) Leishmaniasis. Burden of disease; May 2010. Available from: www.who.int/leishmaniasis/burden/en/

Wiese, M. (1998) A mitogen-activated protein (MAP) kinase homologue of Leishmania mexicana is essential for parasite survival in the infected host. EMBO J 17, 2619–2628.

Wilson, D.K., Bohren, K.M., Gabbay, K.H., Quiocho, F.A. (1992) An unlikely sugar substrate site in the 1.65 A structure of the human aldose reductase holoenzyme implicated in diabetic complications. Science 257(5066), 81-84.

Yabe-Nishimura, C. (1998) Aldose reductase in glucose toxicity: a potential target for the prevention of diabetic complications. Pharmacol Rev 50(1), 21-33.

Yabe-Nishimura, C., Nishinaka, T., Iwata, K. & Seo, H.G. (2003) Up-regulation of aldose reductase by the substrate, methylglyoxal. Chem Biol Interact 143-144, 317-323.

Ye, Q., Hyndman, D., Green, N. C., Li, L., Jia, Z. & Flynn, T. G. (2001) The crystal structure of an aldehyde reductase Y50F mutant-NADP complex and its implications for substrate binding. Chem Biol Interact 130-132, 651-658.

Yoshida, N. and Camargo, E.P. (1978) Ureotelism and ammonotelism in trypanosomatids. J Bacteriol 136, 1184–1186.

Zang, T. M., Hollman, D. A., Crawford, P. A., Crowder, M. W. & Makaroff, C. A. (2001) Arabidopsis glyoxalase II contains a zinc/iron binuclear metal center that is essential for substrate binding and catalysis. J Biol Chem 276, 4788-4795.

Zhang, W. W., Charest, H., Ghedin, E., Matlashewski, G. (1996) Identification and overexpression of the A2 amastigote-specific protein in Leishmania donovani. Mol Biochem Parasitol 78, 79 –90.

UNIVERSIDADE DE LISBOArepositorio.ul.pt › bitstream › 10451 › 2032 › 1 ›...

Documents

Transcript of UNIVERSIDADE DE LISBOArepositorio.ul.pt › bitstream › 10451 › 2032 › 1 ›...