Exportação de mRNAs do núcleo para o citoplasma: análise do ...
UNIVERSIDADE DE LISBOA · mRNAs que dão origem às proteínas de superfície de oocinetos (o...
Transcript of UNIVERSIDADE DE LISBOA · mRNAs que dão origem às proteínas de superfície de oocinetos (o...
UNIVERSIDADE DE LISBOA
FACULDADE DE CIÊNCIAS
DEPARTAMENTO DE BIOLOGIA VEGETAL
GENE EXPRESSION DURING PLASMODIUM
TRANSMISSION
Dissertação
Neuza Arrimar Duarte
Mestrado em Biologia Molecular e Genética
2013
UNIVERSIDADE DE LISBOA
FACULDADE DE CIÊNCIAS
DEPARTAMENTO DE BIOLOGIA VEGETAL
GENE EXPRESSION DURING PLASMODIUM
TRANSMISSION
Dissertação orientada por:
Doutor Jorge Miguel L. Marques da Silva, Faculdade de Ciências, Universidade de Lisboa
Doutora Patrícia Agostinho Gonçalves Costa da Silva, Instituto Medicina Molecular
Mestrado em Biologia Molecular e Genética
2013
1
Acknowledgments
To all the UPAMOL team, a sincere thank you for having me during this last year.
To Patrícia who kindly accepted me as her student and diligently helped me in everything I
needed. To Jorge, whom I’m already picturing as a P.I….for giving me the opportunity of
working with him these last months. Two both for all the time you took teaching me
everything I needed… and for this long correction marathon.
To Ana, the “always on top of things” lab manager, who always has a solution for everything,
and who would always narrate to you the online news the funniest way.
To Gunnar, who gave me the opportunity of working in his group, whose work is an
inspiration for everyone in this field. Sorry for any inconvenience I may have caused you.
Most importantly, thank you UPAMOL for showing me how a group is supposed to be like.
UPAMOL fighting!
To Prof. Jorge Silva, my internal supervisor, for helping me with all the thesis issues.
To everyone in UPAR, our neighbours, for always being hyper, enthusiastic and a mood
raiser. In particular to Leonor, former UPAMOL member, and current UPAR lab manager, for
being a one-of-kind person and for the promptly assistance you would give me, and
everyone else, when needed.
To everyone in UMA, who were always nice and helpful to me. To Vanessa, for the liver
samples. To Ana Parreira just because you’re the coolest insectary technician ever! To
Joana Dias, wish you great luck in your future!
To our friendly invaders, Miguel Prudêncio’s lab, even though our cohabitation was short,
you were always nice to me. Inês, your geekiness and personality always makes you a nice
presence to have around.
To Patrícia Meireles, my “sister”, flat mate, and former companion in the trenches of the
Biochemistry battlefield in Porto… well, there’s no need for words, you rock! さいこう!
Also, to my other “sister” Sarinha, for all these years of friendship. Good luck in your PhD!
Most importantly, to my family, mom, dad, sista, grandma and grandpa… for whom I always
did my best. Even though things haven’t always turned out the way we wanted…we are
gonna make it! Mamy, you are going to be a published writer, for sure!
To all, thanks!
2
Abbreviations used 3’UTR: 3’ untranslated region
5’UTR: 5’ untranslated region
cDNA: complementary DNA
CITH: CAR-I and fly Trailer Hitch Homolog
DHHC-CRD: Asp-His-His-Cys Cystein rich domain
DNA: Deoxyribonucleic acid
DOZI: Development of Zygote Inhibited
DTT: Dithiothreitol
EEF: Exo-erythtrocytic forms
EPSF: Essential Protein for Sporozoite Formation
Fig.: Figure
GFP: Green fluorescent protein
HIV/AIDS: Human immunodeficiency virus infection / acquired
immunodeficiency syndrome
HRP: Horseradish peroxidase
Hsp70: 70 kDa heat shock protein
IFA: Immunofluorescence assay
IP: Immunoprecipitation
IPET: Invasion Protein Essential for Transmission
iRBC: infected RBC
kDa: kilodalton
LB medium: Lysogeny Broth medium
MG Spz: Midgut sporozoites
mRNA: messenger RNA
mRNP: messenger ribonucleoprotein
ook: ookinete
PAT: Protein S-acyl transferase
PbSR: Plasmodium berghei scavenger receptor-like protein
PBS: Phosphate buffered saline
p.i.: post-infection
PCR: Polymerase chain reaction
PTM: Post-translational modification
PUF: Pumilio protein
RNA: Ribonucleic acid
RBC: Red blood cell
RT: Room temperature
SDS: Sodium dodecyl sulfate
3
SDS-PAGE: Sodium dodecyl sulfate Polyacrylamide gel
electrophoresis
SG Spz: Salivary glands sporozoites
SOC: Super Optimal Broth
TAE: Tris-acetate-EDTA
TAP: Transcription associated protein
TBV: Transmission blocking vaccine
TE: Tris-EDTA
TF: Transcription factor
tgdhfr/ts: Toxoplasma gondii dihydrofolate reductase/ thymidylate
synthase
TMD: Transmembrane domain
uis4: upregulated in infectious sporozoites gene 4
WT: Wild type
4
Abstract
Malaria is an infectious disease caused by the Plasmodium parasite that is transmitted
by the bite of a female Anopheles mosquito to its host. Nowadays, malaria still constitutes to
be a major burden despite the enormous progression made in different strategies of
prevention and treatment. Plasmodium exhibits a complex life cycle whose mechanisms of
regulation are still a matter of intense research and debate. Translational repression is a
post-transcriptional mechanism that allows regulation of transcripts translation both spatially
and temporally. In the P. berghei female gametocytes, DOZI- (Development of Zygote
Inhibited) and CITH- (CAR-I and fly TrailerHitch Homology) defined translational repressor
complexes have a vital role in maintaining in a quiescent state certain messenger RNAs
(mRNAs) that will be translated later on, during post-fertilization development. On the other
hand, PUF2 (Pumilio 2) protein was found to have a similar vital role but at the sporozoite
stage in maintaining their latency by translationally repressing certain transcripts. In addition,
P. falciparum PUF2 protein was shown to regulate sexual development and differentiation,
although in P. berghei it has not been possible to confirm such role for PUF2 protein. Our
findings suggest that dhhc10 (Asp-His-His-Cys cysteine-rich domain – DHHC-CRD family
member), ipet (Invasion Protein Essential for Transmission) and epsf (Essential Protein for
Sporozoite Formation) transcripts are translationally repressed by the DOZI- and CITH-
defined repressor complexes. In the ookinetes, they are translated and apparently stored in
crystalloid bodies. Protein palmitoylation mediated by DHHC10 will have then a vital role in
sporozoite formation. Lack of EPSF also leads to the absence of oocyst sporulation. Our
results further confirm the dynamic and complex nature of post-transcriptional gene
regulation in the Plasmodium life cycle, and its importance in the parasite transmission.
Keywords: CITH, development, DOZI, gametocytes, mRNPs, ookinete, oocyst,
Plasmodium, PUF proteins, sporozoite, translational repression, transmission
5
Resumo
A malária é uma doença infecciosa causada por parasitas do género Plasmodium
pertencente ao filo Apicomplexa, cujo modo de transmissão requer um vector, um mosquito
fêmea do género Anopheles. A espécie responsável pela forma mais mortífera de malária
denomina-se Plasmodium falciparum, que possui uma incidência mais prevalente nas
regiões de África. De acordo com o World Malaria Report (WMR) de 2012, as populações
com um maior risco de contrair malária estão localizadas nas regiões a sul do Sahara. As
estimativas indicam que o número de pessoas em risco de contrair malária em 2011 seria de
3,3 biliões de pessoas no mundo inteiro. Nos últimos anos diferentes estratégias foram
desenvolvidas para combater esta doença, ainda considerada como uma das três grandes
doenças infecciosas, a par com HIV/AIDS (Human Immunodeficiency Virus/ Acquired
Immunodeficiency Syndrome) e tuberculose. Exemplos dessas estratégias incluem métodos
de prevenção, como é o caso das redes impregnadas com insecticidas de longa duração, e
também as várias formas de tratamento com diferentes combinações de fármacos.
Actualmente, o problema que se considera difícil de contornar na luta contra a malária é a
capacidade que o parasita tem de adquirir resistência aos fármacos antimaláricos, como é o
caso da artemisinina; mas para além disso, a aquisição de resistência estende-se também
aos insecticidas.
O parasita da malária possui um ciclo de vida complexo que é caracterizado pela
presença de um hospedeiro humano, ou no caso do modelo usado no nosso estudo, um
morganho, e de um vector. A reprodução sexual ocorre na fase do ciclo de vida em que o
parasita se encontra no interior do mosquito e é um evento que ocorre apenas uma vez por
ciclo. Os mecanismos de regulação responsáveis pelo desenvolvimento e diferenciação
sexual do parasita permanecem por deslindar.
Devido ao facto dos hospedeiros e do vector possuírem ambientes fisiológicos muito
discrepantes, é imprescindível que haja uma rápida adaptação a nível celular e molecular
por parte do parasita e um controlo exacto da expressão génica ao longo do seu ciclo de
vida. No entanto, a forma como é regulada a expressão génica no parasita ainda tem de ser
elucidada. Com a sequenciação do genoma de Plasmodium verificou-se que este possui
uma menor quantidade de proteínas associadas à transcrição (TAPs) do que seria de se
esperar para um genoma do seu tamanho. Este facto levou a que se colocasse a hipótese
de que a regulação transcricional em Plasmodium difere da de outros sistemas eucarióticos,
como por exemplo, a levedura.
A repressão da tradução é um mecanismo no qual um conjunto de mRNAs é movido
selectivamente para complexos ribonucleoproteicos (mRNPs) onde são armazenados,
sendo apenas traduzidos mais tarde no ciclo de vida. Este processo permite tanto uma
6
regulação temporal como uma regulação espacial da expressão das proteínas. Estudos
demonstraram que uma região rica em uridinas (designada U-rich region) encontrada nas
regiões 3’ ou 5’ não traduzidas (UTRs) dos mRNAs reprimidos, é um factor-chave neste
mecanismo de regulação. Ao longo dos últimos anos, a repressão da tradução tem vindo a
estabelecer-se como um mecanismo essencial no desenvolvimento sexual em Plasmodium.
Em gametócitos (as células percursoras sexuais) de P. berghei, demonstrou-se que os
mRNAs que dão origem às proteínas de superfície de oocinetos (o estadio seguinte após a
fertilização) P25 e P28 colocalizam com a DEAD-box RNA helicase DOZI (Development of
Zygote Inhibited) e com a Sm-like factor CITH (CAR-I/Trailer Hitch Homolog). DOZI e CITH
definem um complexo ribonucleoproteico composto por 16 factores principais, que incluem
eIF4E, um factor de iniciação da tradução e uma proteína de ligação à cauda poli-(A)
(PABP). Os complexos repressores definidos por DOZI e CITH reprimem a tradução de
certos mRNAs em gametócitos, que só irão ser utilizados mais tarde, após a fertilização.
A família PUF consiste em proteínas de ligação a RNA cujo papel principal é a
regulação pós-transcricional dos RNAs aos quais se ligam. A investigação incidente nesta
família de proteínas teve uma importância fulcral no desenvolvimento do conhecimento
sobre os mecanismos pós-transcrição. Em P. falciparum, PfPUF2 desempenha um papel
importante na regulação do desenvolvimento e diferenciação sexual. Em gametócitos, a
proteína PUF2 reprime a tradução de determinados transcritos, reprimindo assim a
diferenciação sexual. Por outro lado, em P. berghei, esporozoítos puf2-KO desenvolvem-se
precocemente dentro das glândulas salivares do mosquito, exibindo uma morfologia
característica de estadios posteriores, nomeadamente de estadios do fígado. PUF2 parece
ser então de extrema importância para a latência dos esporozoítos de P. berghei. Para além
disso, estes resultados demonstram que a repressão da tradução é um mecanismo
essencial para o controlo do desenvolvimento dos esporozoítos e da sua transmissão ao
hospedeiro.
O principal objectivo deste trabalho é obter uma compreensão mais aprofundada sobre
o papel dos complexos de repressão da tradução em gametócitos. Em gametócitos pbdozi-
KO, um número elevado de mRNAs estão sob e sobre-expressos em relação ao wild type
(WT). Usando uma análise por RIP-Chip foi possível confirmar que muitos desses transcritos
estão fisicamente ligados aos complexos repressores definidos por DOZI e CITH, sugerindo
que a sua tradução está a ser reprimida. Por outro lado, em P. berghei, a expressão de
PUF2 em gametócitos ainda não foi demonstrada. O estudo de mRNAs potencialmente
reprimidos pelos complexos definidos por DOZI e CITH, e também o estudo da proteína
PUF2, permitir-nos-á compreender mais aprofundadamente qual a importância destes
complexos repressores na expressão génica em gametócitos.
7
A immunoprecipitação (IP) de proteínas é uma técnica que permite o isolamento de
uma proteína em particular, através de anticorpos específicos, e de qualquer parceiro
(proteína ou ácido nucleico) que esteja fisicamente ligado à proteína alvo. Utilizou-se esta
técnica para confirmar a expressão de PUF2 em gametócitos de P. berghei e isolar
potenciais parceiros; infelizmente, não fomos bem-sucedidos nesta tarefa.
Foram também alvo de estudo neste projecto um conjunto de proteínas, denominadas
DHHC2 e DHHC10, enzimas da família das S-aciltransferase de Proteínas (PATs), IPET
(Invasion Protein Essential for Transmission) e EPSF (Essential Protein for Sporozoite
Formation). Foi proposto que a tradução destas proteínas seria reprimida pelos complexos
repressores definidos por DOZI e CITH, em gametócitos, tal como acontece com P25 e P28.
Para além disso, o facto de todas elas possuírem péptidos sinal e domínios
transmembranares, é uma forte indicação de que possam ser proteínas de superfície. Esta
possibilidade gera interesse adicional neste conjunto de proteínas já que, ao longo dos anos
foram descobertas várias proteínas de superfície com função essencial para a transmissão
do parasita, tendo muitas delas, tornado-se candidatos promissores a vacinas de bloqueio
de transmissão (TBVs). Estas vacinas têm como objectivo principal a diminuição do número
de mosquitos infectados, cessando o desenvolvimento do parasita no mosquito.
Os nossos resultados sugerem que os transcritos de dhhc10, ipet e epsf estão num
estado quiescente nos gametócitos, sendo a sua tradução reprimida nesta fase. Ao contrário
de dhhc2, cuja expressão proteica já existe nos gametócitod, não sendo por isso, a sua
tradução reprimida, como inicialmente previsto, pelos complexos repressores definidos por
DOZI e CITH. Mais tarde, já no interior do mosquito, a produção das proteínas DHHC10,
IPET e EPSF começa nos oocinetos, onde são armazenadas nos corpos cristalóides, e
usadas posteriormente, durante o desenvolvimento no mosquito. Os corpos cristalóides são
um organelo tipicamente encontrado em oocinetos e oocistos maduros, que se supõe
constituir um reservatório de proteínas que serão usadas pelo parasita durante o
desenvolvimento de oocistos. Para além disso, sabe-se que DHHC10 tem como função a
palmitoilação de proteínas – uma modificação pós-traducional de extrema importância no
controlo da actividade, localização e transporte de proteínas. Os parasitas KO desta
proteína não desenvolvem esporozoítos apesar do número de oocistos permanece normal
quando comparado com wild type (WT). Estes oocistos ∆dhhc10 apresentam contudo uma
morfologia aberrante, com oocistos não esporulados e vacuolados. Estes resultados indicam
que a palmitoilação de proteínas mediada por DHHC10 é essencial para o processo de
formação de esporozoítos. Paralelamente, os parasitas KO de EPSF também não
desenvolvem esporozoítos, indicando que esta proteína será essencial para a sua formação.
No geral, os nossos resultados confirmam o papel vital do mecanismo de repressão da
tradução no desenvolvimento sexual em Plasmodium. Para além disso, fornecem indicações
8
adicionais sobre a elevada e complexa estruturação dos mecanismos pós-transcricionais e
pós-traducionais que regulam o ciclo de vida deste parasita.
Palavras-chave: CITH, desenvolvimento, DOZI, esporozoíto, gametócitos, mRNPs,
oocineto, oocisto, Plasmodium, proteínas PUF, repressão da tradução, transmissão
9
Table of Contents
Acknowledgements…………………………………………………………………………………...1
Abbreviations…..………………………………………………………………………………………2
Abstract……….………………………………………………………………………………………..4
Resumo……………………………………………………………………………………………...…5
1 – Introduction……………………………………………………………..………………………..11
1.1. Malaria disease…………………………………………………………..……………………..11
1.2. Plasmodium life cycle………………………………………………………………………….12
1.3. Plasmodium regulation of gene expression…………………………………………………13
1.3.1. Translational repression in Plasmodium…………………………………………………..15
1.3.2. Translational repression and Plasmodium PUF2 protein………………………………..16
1.4. Aims of this work………………………………………………………………………………..17
2 – Materials and Methods………………………………………………………………………….18
2.1. Experimental animals…………………………………………………………………………..18
2.2. Reference P. berghei ANKA lines used……………………………………………………...18
2.3. Immunoprecipitation of PUF2 protein in P. berghei gametocytes………………………...19
2.3.1. puf2::gfp line………………………………………….……………………………………… 19
2.3.2. puf2::gfp sequencing…………………………………………………………………………19
2.3.3. IP of PUF2::GFP and DOZI::GFP in gametocytes and mixed blood stages…………..20
2.3.3.1. Nycodenz method………………………………………………………………………….20
2.3.3.2. Nycodenz method with enhanced gametocytaemia……………………………………20
2.3.3.3. PUF2::GFP and DOZI::GFP mixed blood stages IP using GFP-Trap® Kit………….20
2.3.4. Detection of PUF2::GFP and DOZI::GFP proteins in gametocytes and mixed blood
stages by Western blot analysis……………………………………………………………………21
2.4. DHHC2, DHHC10, IPET and EPSF mutant lines characterization, Western blot analysis
and expression profiles……………………………………………………………………………..21
2.4.1. Mosquito infections and bite-backs………………………………………………………...21
2.4.2. Genotyping and RT-PCRs of ∆dhhc10, ∆epsf, dhhc2::gfp, dhhc10::gfp, ipet::gfp and
epsf::gfp parasite lines………………………………………………………………………………22
2.4.3. Sequencing of ipet-main version and ipet-splice variant cDNA…………………………22
2.4.4. Life cycle RT-PCRs…………………………………………………………………………..23
2.4.5. Western blot analysis of CSP expression in oocysts from dhhc10-KO and epsf-KO
parasite lines…………………………………………………………………………………………23
2.4.6. Live imaging and immunofluorescence assays (IFAs) of blood stages, ookinetes,
oocysts and sporozoites……………………………………………………………………………24
2.4.7. Statistical methods…………………………………………………………………………..24
10
3 – Results and Discussion…………………………………………………………………………24
3.1. Immunoprecipitation of PUF2 protein in P. berghei gametocytes…………………………24
3.1.1. puf2::gfp sequencing…………………………………………………………………………27
3.1.2. Discussion…………………………………………………………………………………….27
3.2. Characterization of a set of proteins translationally repressed by DOZI and CITH defined
mRNPs………………………………………………………………………………………………..29
3.2.1. Confirmation of the targeted disruption of dhhc10 and epsf…………………………….29
3.2.2. Molecular analysis of GFP-tagged parasite lines…………………………………………29
3.2.3. Alternative splicing in ipet……………………………………………………………………29
3.2.4. Life cycle mRNA and protein expression profile and protein localization………………30.
3.2.5. dhhc10-KO and epsf-KO mutant phenotypes……………………………………………..34
3.2.6. Discussion…………………………………………………………………………………….37
3.2.6.1. DHHC10, IPET and EPSF role in Plasmodium life cycle……………………………...37
3.2.6.2. DHHC family in Plasmodium berghei: DHHC2 and DHHC10…………………………38
4 – Conclusions……………………………………………………………………………………...39
5 – References……………………………………………………………………………………….40
6 – Appendix I………………………………………………………………………………………..44
7 – Appendix II……………………………………………………………………………………….44
8 – Appendix III……………...……………………………………………………………………… 45
9 – Appendix IV………………………………………………………………………………………47
11
1 – Introduction
1.1. Malaria disease
Malaria is an infectious disease caused by parasites of the genus Plasmodium [1],
belonging to the Phylum Apicomplexa [2], that are transmitted by a vector, a female mosquito
of the genus Anopheles, to its host [1]. Five Plasmodium species can cause human malaria:
P. falciparum, P. vivax, P. ovale, P. malariae and P. knowlesi [1]. The responsible for the
deadliest form of malaria is P. falciparum, which has a prevailing incidence in the region of
Africa [3]. A remarkable feature of the Plasmodium parasite is the restrictedness of the hosts
they choose, only closely related vertebrates are infected by the around 5000 Plasmodium
species described [4]. Plasmodium host exclusiveness has been supported by molecular
phylogenetic studies, which have demonstrated the evolutionary relatedness between the
different species that infect mammals [2]. In malaria research, there are several Plasmodium
species that, over the years, became essential to its development; among these we have the
primate malaria model Plasmodium knowlesi, which is a macaque monkey’s parasite in the
wild, and three rodent malaria parasites, Plasmodium berghei, Plasmodium yoelli and
Plasmodium chabaudi, which infect thicket rats in central Africa [5]. The rodent malaria
parasite P. berghei was used as a malaria research model in the present study.
According to the World Malaria Report of 2012, the estimate number of people at risk
of acquiring malaria in 2011 was 3,3 billion people worldwide; more particularly, the
populations at a higher risk are located in the regions of sub-Saharan Africa [3]. In the last
years, many different strategies have been developed to fight the malaria burden; relevant
examples include nets treated with long-term insecticides and also combination of drug
therapies. These strategies proved their success as a strong reduction of malaria cases was
achieved among several regions, while in others complete eradication was successfully
accomplished [6]. Nowadays, a central problem in the fight against malaria is the ability of
the Plasmodium parasite to acquire resistance to antimalarial drugs, like artemisinin, and
also insecticides [7]. In addition, as in any other disease control program, the success also
depends largely on a continuous funding [7]. Presently, there are 104 countries marked as
endemic areas, 99 of these have ongoing malaria transmission, and the remaining ones are
in the prevention or reintroduction phases [3].
Uncomplicated malaria is characterized by sporadic febrile episodes which the host’s
immune system is capable of controlling, and eventually, eliminate [8]. In contrast, severe
malaria may cause death and is characterized by one or a combination of the following
syndromes: cerebral malaria, metabolic acidosis and severe anemia [8]. Cerebral malaria
and metabolic acidosis have a mortality rate of 15-20%, even with artemisinin derivatives
treatment. Moreover, neurological impairment is a common feature among the survivors [8].
12
The ones most affected by severe malaria are children under five years and pregnant women
[3]. The main aim of today’s antimalarial drugs is to prevent progression to severe disease by
targeting the asexual blood stages responsible for the symptoms of the disease [8].
1.2. Plasmodium life cycle
The malaria parasite exhibits a complex life cycle that involves a vertebrate, human
host (or a mouse in the rodent model) and a mosquito vector, as depicted in Fig. 1. Sexual
reproduction occurs in the mosquito; its regulation and the formation of sexual precursors in
infected red blood cells (iRBC) is still unclear, but it was shown for P. falciparum, that the
commitment to sexual differentiation occurs before schizont maturation [9]. During a blood
meal, the mosquito ingests gametocytes and, in the mosquito midgut lumen, the formation of
gametes (gametogenesis) is initiated. Male gametogenesis, termed exflagellation, is
triggered by a set of environmental cues: xanthurenic-acid (a molecule present in the
mosquito) and temperature and pH changes [10]. When fertilization occurs, a diploid zygote
is formed, followed by a tetraploid motile ookinete. The ookinete route includes traversing of
the midgut epithelial cells and subsequent exit through the basal lamina of the epithelium.
This process activates the ookinete to switch from a cell traversal mode to a sessile mode
called oocyst [10]. Oocysts go through a process of plasma membrane invagination, forming
sporoblasts, through which sporozoites will bud-off [10]. The process of sporozoite formation
takes place during a time period of 2 weeks, and after mature oocysts rupture, sporozoites
are released into the haemolymph. From this point on, sporozoites travel to the salivary
glands of the mosquito, invade them, and reach the salivary duct, their journey’s destination,
where they can be injected into a new host during a subsequent blood feeding by the
mosquito [1].
Plasmodium sporozoites are transmitted to a mammalian host during the bite of an
infected mosquito and are deposited in the dermis of the host. However, as it was shown by
Amino et al. (2006), only a proportion of the parasites have the capability of entering the
blood capillaries, the remaining is drained by the lymphatics [11]. Once inside the circulatory
system, sporozoites rapidly reach the liver [10, 12]. Sporozoites traverse a number of
hepatocytes before reaching and invading a final hepatocyte, using a membrane-associated
actin-myosin motor [10]. This traversal process was shown by Mota et al. (2001) to be
essential for the completion of the life cycle, hypothesizing that sporozoites might need to
traverse a number of cells, so that signaling pathways essential for entry and development
inside the hepatocyte can be activated [13]. Inside the final hepatocyte, sporozoites will
develop and multiply, giving rise to thousands of merozoites [12]. The release of Plasmodium
merozoites from hepatocytes is a vital step in the life cycle of this intracellular pathogen. The
common place idea was that the release of merozoites would occur after hepatocyte rupture.
13
However, Sturm et al. (2006) showed that parasites induce hepatocyte death, and
subsequently bud-off inside vesicles (merosomes) into the sinusoid lumen [14]. After being
released from the merosomes, the merozoites invade the host’s red blood cells and the
blood stage of infection begins. The intraerythrocytic parasite development includes the ring,
trophozoite, and schizont stages, and ultimately the formation of new merozoites. To
successfully enter a new red blood cell (RBC), the merozoite must be very quick in selecting
a RBC, adhere to it, enter and enclose itself inside it [15, 16, 17]. Some merozoites develop
into gametocytes, which when taken up by a mosquito during a blood meal allow for a
productive infection of the parasite’s vector [15].
Fig. 1 – Plasmodium life cycle. (A) Sporozoites
transmission to a human host during a blood meal of a
infected mosquito; (B) Traversal of several hepatocytes
before invading a final one; (C) Release of merozoites into
the bloodstream; (D) Merozoite infection of red blood cells;
(E) Formation of male and female gametocytes; (F)
Ingestion of gametocytes by the mosquito during a blood
meal; (G) Gametes fertilization in the mosquito midgut and
further development into ookinetes, and later on, to
oocysts; (H) Migration of sporozoites to the salivary glands
of the mosquito and transmission to another human host
during the next blood meal (Adapted from [18]).
1.3. Plasmodium regulation of gene expression
How the Plasmodium parasite regulates and manages gene expression has been a
matter of intense research and debate [19, 20]. Our malaria study model P. berghei has an
estimated genome size of approximately 18Mbp [21], very similar to P. falciparum (22.8 Mbp)
[22], and also like P. falciparum, an exceptionally high A+T composition [22, 23]. Both P.
berghei and P. falciparum have their genome split in 14 chromossomes [22, 24]. P.
falciparum genome sequencing made available an enormously amount of information about
its composition and characteristics. Particularly, an interesting feature was revealed about
this parasite, it possesses a small amount of transcription associated proteins (TAPs) [22].
This observation was the starting point for the hypothesis that transcriptional regulation in
Plasmodium is most probably unlike that of others well studied eukaryotic systems, like yeast
or mammalian cells [19, 25]. Van Noort et al. (2006) proposed that the few regulatory
proteins encountered in Plasmodium regulate gene expression in a combinatorial manner,
14
relying on a higher number of regulatory DNA sequences per gene than those observed in
other eukaryotes [26].
Until 2005, no specific transcription factors in Plasmodium had been reported. Balaji et
al. (2005) were the first to describe a group of conserved proteins containing putative AP2
DNA-binding domains, referred nowadays as the Apicomplexan AP2 (ApiAP2) protein family.
The P. falciparum ApiAP2 gene family was reported to have 27 members, with a high degree
of conservation between Plasmodium species and with DNA binding domains closely related
to the ones found in transcription factors of other eukaryotes [27]. Even though it was initially
thought that the Plasmodium ApiAP2 would have a prominent role in asexual blood stages,
transcriptional and proteomic studies indicated that possibly they are required throughout the
life cycle [28]. Furthermore, it was shown that the Plasmodium transcription factor (TF) AP2-
O activates gene expression in ookinetes [29], providing additional evidence for a significant
role of this TF family in gene regulation.
The combination of high-throughput techniques and bioinformatics in malaria research
were decisive tools to uncover the prominent role of post-transcriptional regulation in the
Pasmodium parasite [20]. A global analysis of transcript and proteins levels in P. falciparum
is an example of such studies, where it was possible to identify the delay between mRNA
and protein accumulation as the most common expression pattern. In the last years, it
became clear that stage-specific gene regulation is essential for the parasite, which is
illustrated by reports in transcriptional regulation during asexual and sexual development.
Bozdech et al. (2003) analyzed the transcriptome of P. falciparum complete asexual
intraerythrocytic developmental cycle transcriptome and proposed a model for the parasite
transcriptional regulation. The authors compare the transcriptome at this stage of
development to a “just-in-time manufacturing process”, where a gene induction is a onetime
event per cycle and only at the required moment [30]. The existence of sex-specific genes in
Plasmodium was established by Khan et al. (2005), leading to an enormous progress in
uncovering the mechanisms of sexual development regulation. By analyzing the proteome of
separate male and female gametocytes, the authors showed that the male proteome
contained 36% of male-specific proteins and the female proteome 19% of female-specific
proteins [31]. Uncovering the role played by post-transcriptional mechanisms role in
Plasmodium sexual differentiation began when it was shown that p25 and p28 (genes
encoding ookinete surface proteins) mRNAs were kept in a quiescent state in female
gametocytes. These stored transcripts were only, later on, translated in gametes and zygotes
[32]. This process was termed translational repression, and it will be discussed with further
detail in 1.3.1. section. Further studies demonstrated, both in human and rodent malaria
parasites, that an additional substantial amount of mRNAs were also stored in gametocytes
and only translated in a later stage, namely in gametes [21, 33]. The studies mentioned
15
above emphasize that precise regulation of transcription is essential for the parasite, since
dynamic expression of transcripts seems like a critical mechanism at several points during
the intraerythrocytic life cycle.
1.3.1. Translational repression in Plasmodium
Translational repression is a mechanism in which certain mRNAs are selectively
moved into cytoplasmic messenger ribonucleoprotein (mRNPs) complexes and are
maintained in a quiescent state for translation at a later time. This process allows the control
of both temporal and spatial protein expression [20, 34]. The mRNAs that are translationally
repressed in this manner usually possess a U-rich RNA region that can be found in the 3’ or
5’-untranslated regions (UTRs), which is a key factor for their regulation [35].
As mentioned above, both p25 and p28 mRNAs are kept untranslated in female
gametocytes ribonucleoparticles. It was found that these unstranslated p25 and p28 mRNAs
colocalize with the DEAD-box RNA helicase DOZI (Development of Zygote Inhibited) and
Sm-like factor CITH (CAR-I/Trailer Hitch Homolog) proteins in P. berghei [34, 36]. DOZI and
CITH disruption leads to a drastic reduction of abundance of both p25 and p28 mRNAs, as
well as of an additional 370 mRNAs [34, 36]. pbdozi and pbcith-KO female (but not male)
gametocytes do not form ookinetes after fertilization, which indicates that most likely a
fraction of these translationally repressed mRNAs are essential for this particular step of
development [34, 36]. P-granules have an important role in metazoan sexual development,
since they are the storage particles where the translationally silent transcripts are kept and
stabilized [36]. The idea of P-granules as stable storage places is strengthened by the
absence of RNA degradation factors in these granules [36]. A translational repression model
in gametocytes was established in which an mRNP complex is composed of CITH, DOZI and
16 major factors, including eIF4E, a translation initiation factor, and poly-(A)-binding protein,
as depicted in Fig. 2. This complex translationally represses mRNAs that will have a critical
role in the initial stages of the mosquito infection [36]. More recently, a biochemical
characterization of the DOZI homologue commonly known as DDX6 from Plasmodium
falciparum was presented, being the first report that shows the direct interaction between
DDX6 and PfeIF4E [37].
Fig.2 – DOZI and
CITH defined mRNP
structure in female
gametocytes.
16
1.3.2. Translational repression and Plasmodium PUF2 protein
The PUF family consists of RNA-binding proteins whose major role is post-
transcriptional regulation. The first two members of the PUF family to be analyzed in detail
were Drosophila melanogaster Pumilio and Caenorhabditis elegans FBF, so consequently,
the group was termed PUF or PUM-HD proteins [38, 39] PUF proteins regulate mRNAs by
binding to specific regions in the 3’-UTRs [40, 41, 42]. All members of the PUF family contain
a PUM-HD (Pumilio homology domain)-type RNA binding domain [39], that can physically
interact with both RNAs and proteins [40, 41]. PUM-HD-type RNA binding domain usually
has 8 consecutive Puf repeats, that normally consist of around 40 aminoacids with two short
flanking regions [38, 39]. Puf repeats are located in the C-terminus region of the protein and
are characterized by having a “core consensus” containing aromatic and basic residues and
[40]. Examples of this family functions are: development, differentiation, germline function,
neuronal function, memory, and mitochondrial and cell cycle biogenesis [40, 41, 42, 43]. The
preservation of stem cells mitotic potential has been proposed as an ancestral role for the
PUF family [40].
Studies focused on the PUF family had a major role in uncovering post-transcriptional
mechanisms [41]. The mechanism of mRNA repression was first described by Goldstrohm et
al. (2006), where the authors suggest that yeast PUF protein recruits factors that assist on its
role in mRNA repression and/or decay, namely proteins of the deanylase complex [45].
Moreover, it was also found that in many cases PUF proteins regulate specific sets of
transcripts whose encoded proteins have related functionalities [45]. For example, mRNAs
involved in organellar biosynthesis were found to be regulated spatially and temporally by
PUF proteins [45]. Since PUF proteins dynamically coordinate many transcripts, its own
regulation has to be extremely tight. Both their activity and expression are regulated at all
levels of gene expression, from transcription to post-translation [42].
In Plasmodium falciparum, PfPUF2 plays an important role in arresting sexual
development in gametocytes [46]. PfPUF2 was found to be expressed in both male and
female gametocytes, and deletion of this gene resulted in increased gametocyte formation
and a considerable higher male/female sex ratio [46]. In contrast, such role for PUF2 in
parasite sexual development and sex differentiation was not observed with the rodent P.
berghei. Interestingly though, P. berghei PUF2 was found to play a critical role in regulating
parasite development during transmission from the mosquito to the mammal host [47]. P.
berghei puf2-KO sporozoites exhibit a precocious development into exo-erythrocytic liver
stage forms (EEFs) inside mosquito salivary glands, showing that translational repression by
PUF2 is an essential control mechanism in sporozoite development [47], as depicted in Fig.
3. Other recent findings also support the idea of PUF2 as a key player in parasite
17
transmission between the mosquito and the mammalian host [48]. Their results suggest that
P. berghei PUF2 regulates IK2 (eIF2α kinase) inhibiting translation of certain transcripts in
salivary gland sporozoites [48]. The rodent P. yoelii PUF2 protein was also analyzed and,
despite some differences when compared with P. berghei, found to play a similar crucial role
in maintaining the homeostasis of specific transcripts and therefore ensuring a successful
parasite transmission from the mosquito to the mammalian host [49].
Fig.3 – Model for the regulation of development during transmission between mosquito and mammalian host having PUF2 protein as a key player (Adapted from [47]).
1.4. Aims of this work
Translational repression is an essential mechanism in sexual differentiation and
gametogenesis. DOZI and CITH roles at this stage have been well established, and evidence
is growing for a PUF2 role in the repression of transcripts in gametocytes. In pbdozi-KO
gametocytes, a great number of transcripts are up and downregulated [37], and RIP-Chip
analysis has been done to confirm that those transcripts are indeed being physically bound
to DOZI- and CITH-defined mRNPs (data not published), thus suggesting that they are
translationally repressed. In P. berghei, PUF2 expression in gametocytes has not yet been
demonstrated.
The main goal of this work is to further dissect the role of these translational repression
complexes in gametocytes. To do so, two different strategies were applied:
a) Perform immmunoprecipitation of PUF2::GFP in P. berghei gametocytes, to
confirme its expression at this stage, and subsequently use the IP-eluates to analyze the
candidate transcripts to be translationally repressed. In addition, the puf2::gfp parasite line
can be used to assess PUF2 localization using microscopy tools.
b) A set of transcripts predicted to be translationally repressed by the DOZI- and
CITH- defined complexes in P. berghei gametocytes (based on the previous data obtained
from the pbdozi-KO and pbcith-KO mutant parasite lines) were chosen using defined criteria
18
(please read below), and GFP-tagged and KO mutant parasite lines were constructed for
each selected gene. Using molecular biology tools, microscopy and Western blot analysis we
were able to characterize them in terms of protein expression, localization, transcription
profile throughout the life cycle and function. The selected genes, with their predicted
features, designations attributed and respective mutant parasite lines constructed in the lab,
are summarized in Appendix IV Table S1.
In the beginning of the selection process, a bigger set of genes were chosen that had
the common characteristic of possessing either a signal peptide, transmembrane domains
(TMDs) or both, indicating that they could potentially be surface proteins, and like many
others discovered in the last years, be of relevance for Plasmodium development in the
mosquito. Preliminary data of the KO-parasite lines for dhhc10, ipet (Invasion Protein
Essential for Transmission) and epsf (Essential Protein for Sporozoite Formation), rendered
them as promising for further studies. DHHC10, as well as DHHC2, another protein studied
in this work, belong to a family of proteins called Asp-His-His-Cys cysteine-rich domain
(DHHC-CRD) S-acyltransferase (PAT) family. This group of enzymes catalyzes the transfer
of a palmitate from palmitoyl-CoA to a protein, a post-translational modification termed
protein palmitoylation. A recent report states that some apicomplexan-specific DHHCs are
essential for parasite growth [50], leading us to an additional interest in this family of proteins,
aiming at a better understanding of the role of these enzymes in P. berghei life cycle,
specially within its mosquito vector.
2 – Material and Methods
2.1. Experimental animals. Female Balb/c ByJ mice (6–8 weeks bred at Charles River,
France) were used. All animal experimentation protocols were approved by the IMM Animal
Care Committee and performed according to EU regulations.
2.2. Reference P.berghei ANKA lines used. Four reference P. berghei ANKA parasite lines
were used in the present work: line HPEcy1m50cl1, a wild-type non-gametocyte producer
clone (Janse et al., 1989); line 820cl1m1cl1 (WT Fluo-frmg; RMgm-164) expressing RFP
under the control of the female gametocyte specific promoter of lap4(ccp2) gene
(PBANKA_131950) and GFP under the control of the male gametocyte specific promoter of
dynein heavy chain gene (PBANKA_041610); line 259cl1 (WT PbGFPcon; RMgm-5)
expressing GFP under the control of the constitutive eef1a promoter; and line cl15cy1 (WT).
Lines 820cl1m1cl1 and contain the transgene integrated into the silent 230p gene locus
(PBANKA_030600) and do not contain a drug-selectable marker. Line 259cl1 contains the
transgene integrated into the small subunit ribosomal rna gene (c-type unit) and does contain
the tgdhfr/ts drug selectable marker.
19
2.3. Immunoprecipitation of PUF2 protein in P. berghei gametocytes
2.3.1. puf2::gfp line. The mutant parasite line that expresses a C-terminally GFP-tagged
version of PUF2 (PBANKA_071920) was previously constructed in the lab (parasite line
1750cl4; data not published).
2.3.2. puf2::gfp sequencing. PUF2::GFP genomic DNA and gametocytes cDNA of were used.
Primers used for both gDNA and cDNA were: g0477 X g0459c; TRAP gDNA was used as a
positive control with the primers g0432 X g0433c. PUF2::GFP PCR products were obtained
using a 50µL PCR mix reaction containing: 10X Taq Buffer with 500mM KCl (Thermo
Scientific), 2mM MgCl2 (Thermo Sientific), 15mM of each primer, 10mM dNTPs, 1µl 5U Taq
DNA Polymerase (Thermo Scientific) and 2µL of DNA sample. Cycling conditions used were:
initial denaturation at 94°C for 3 minutes, followed by 45 cycles of denaturation at 94°C for 10
seconds, annealing at 55°C for 30 seconds and extension at 62°C for 30 seconds. A final
round at 62°C for 10 minutes allowed complete elongation of the PCR product. 5µL of a 1:50
dilution of the PCR products were loaded in a 1% agarose gel to confirm amplification. The
PCR products obtained were cloned using the kit mentioned in Appendix I Table S2. and
transformation was performed using 50µL of DH5α competent cells and 1µL of plasmid.
Samples were incubated on ice for 20 minutes, followed by a thermal shock of 45 seconds at
42°C and by 2 minutes on ice. 1mL LB medium was used to incubate the bacteria for 1 hour
at 37°C. Afterwards, 100µL were plated directly in LB agar plates supplemented with
ampicillin (100µL/mL) and left incubating overnight at 37°C. Colonies were picked from the
plates and mini-prep cultures were grown in 2mL LB medium supplemented with ampicillin
overnight at 37°C. Plasmid DNA extraction was performed used the kit mentioned in
Appendix I Table S2. Correct ligation of the insert into the plasmid was confirmed with a
restriction reaction using the enzymes XhoI (3U; from Promega, Madison, WI U.S.A.) and
XbaI (30U from Jena Bioscience), 1X NEBuffer 4 (BioLabs, Inc. New England), 100 X
Purified BSA (BioLabs, Inc. New England), mili-Q water (Millipore®) and 15µlL of the DNA
previously extracted (in a total volume reaction of 30µl) and incubated for 1 hour and 30
minutes at 37°C. The restriction product was loaded in a 1% agarose gel, and the PCR
products with the expected insert size were chosen. pJET plasmid containing the correct
inserts were used to prepare cultures for midi-preps in LB medium supplemented with
ampicillin and grown overnight at 37°C. DNA concentrations obtained were determined with
a Nanodrop-1000® Spectrophotometer. DNA samples were sequenced by Stabvida using
pJET forward and reverse primers. The sequences obtained were afterwards analyzed using
Finch TV Version 1.4.0 © and Clone Manager © Software.
20
2.3.3. Immunoprecipitation of PUF2::GFP and DOZI::GFP in gametocytes and mixed blood
stages
2.3.3.1.Nycodenz method. After sacrificing one mouse per each parasite line, heparinized
syringes were used to subtract the blood from each mouse by cardiac puncture. PBS was
added up to a volume of 2mL. Purified gametocytes were obtained by loading the blood on a
5mL of 49% Nycodenz solution in PBS, followed by a centrifugation of 20 minutes at 450 rcf
room temperature (RT) with acceleration 3 but no brake. The brownish layer was collected
from the gradient and centrifuged for 5 minutes at 450 rcf at RT. The supernatant was
discarded. The purified gametocytes obtained were washed two times in ice-cold “enriched”
PBS with spins of 5 minutes each at 450rct at 4ºC. Lysis of the parasites was done with 210
μl of NET-2++ buffer for 30 minutes at 4°C using a shaker. After lysis the extract was
centrifuged for 10 minutes at 14000 rpm and the supernatant collected. 50 μl extract were
used per IP with mouse anti-GFP-antibody (1µg Roche Diagnostics, Inc.), anti-c-myc-
antibody (1 μg, Sigma-Aldrich, St. Louis Missouri, USA) or beads-only and incubated for 1
hour at 4°C using a shaker. Another 50µL were saved for the control input sample. Protein G
Sepharose™ 4 Fast Flow beads (GE Healthcare), 20μL packed bead volume per IP,
previously washed 5x with NET-2 buffer and 2x with NET-2++ buffer were then added to
each sample and incubated for 1 hour and 30 minute at 4°C in a shaker. IP samples were
afterwards washed three times with 200μL NET-2 buffer with an additional final wash with
300µL NET-2 buffer. One third of the final wash was resuspended in 500µL TRIzol®
(Reagent for RNA from Ambion®), while the other two thirds were centrifuged and the beads
resuspended in 50µL 2X SDS-PAGE loading buffer and used for western blot analysis.
2.3.3.2. Nycodenz method with enhanced gametocytaemia. Enhanced gametocytemia was
obtained as described in [52]. Nycodenz purification and Immunoprecipitation were
performed as described in the previous section.
2.3.3.3. PUF2::GFP and DOZI::GFP mixed blood stages IP using GFP-Trap® Kit. After
sacrificing one mouse per each parasite line, heparinized syringes were used to subtract the
blood from each mouse by cardiac puncture. 1X RBC lysis buffer was added to the blood the
lysis step performed on ice until the solution became translucent. After a centrifugation of 8
minutes at 2000 rpm, an extra lysis step was performed using 0,1% saponin in PBS
supplement with protease inhibitors (1 tablet of Complete Mini, Roche) 30 minutes on ice.
After another 8 min 2000 rpm spin, the pellet was washed three times with enriched PBS.
Parasite lysis step was performed with 210 µL NET-2++ buffer during 30 minutes at 4°C
using a shaker and a 10 minute spin at maximum speed. 50µL of the lysate were saved as
21
the input fraction to which 50µL 2X SDS-PAGE loading buffer were added. From this point on,
GFP-Trap® _A Kit for Immunoprecipitation of GFP Fusion Proteins (Chromotek) Protocol
(2012-12-07 version) was used starting from step 4.
2.3.4. Detection of PUF2::GFP and DOZI::GFP protein in gametocytes and mixed blood
stages by Western Blot analysis. For Western Blot analysis 15 to 25 µL of IP samples from
purified PUF2::GFP and DOZI::GFP gametocytes as well as mixed blood stages were used.
DTT (200mM final concentration) was added to the samples before the denaturing step at
95°C for 10 minutes. Samples were loaded in a precast gel (BioRad, Any-kD™) and ran the
required time to obtain a desirable band separation at the molecular weight of interest
(PUF2::GFP and DOZI::GFP expected molecular weight were ~83kDa and ~76kDa,
respectively). Using a wet transfer system, the proteins were transferred to a nitrocellulose
membrane for 1 hour and 45 minutes at 200mA. The nitrocellulose membrane was then
blocked for 1 hour at RT with 5% skim milk in 0,05% PBS/Tween 20 and afterwards probed
with anti-GFP antibody in blocking solution overnight at 4ºC. Rabbit anti-GFP (Invitrogen)
and rabbit anti-GFP (Sigma-Aldrich, St. Louis Missouri, USA) were used in a dilution of 1:500
and anti-GFP Roche was used in a dilution of 1:5000. After washing the membrane two
times, 10 minutes each with 0,05% PBS/Tween 20, it was probed with a secondary antibody
for 3 hours at 4°C. HRP-conjugated donkey anti-rabbit (Jackson ImmunoResearch
Laboratories, Inc., West Grove, PA) was used in a 1:500 dilution and HRP-conjugated goat
anti-mouse (Santa Cruz Biotechnology Inc.) was used in a 1:5000 dilution. The membrane
was then washed with 0,05% PBS/Tween 20 developed using Immobilon® Western
Chemiluminescent HRP Substrate (Millipore®).
2.4. DHHC2, DHHC10, IPET and EPSF mutant lines characterization, Western blot
analysis and expression profiles
2.4.1. Mosquito infections and bite-backs. For mosquito passage of the different parasite
lines used in this study, female Balb/c ByJ mice (6–8 weeks years old) were infected
intraperitoneally (IP) with 106 iRBCs of each line. On days 4-5 post-infection (p.i.), these mice
were anesthetised and Anopheles stephensi female mosquitoes allowed to feed for 30 min.
Twenty-four hours after feeding, mosquitoes were anesthetized by cold shock and unfed
mosquitoes were removed. To determine oocyst burdens, mosquito midguts were dissected
at days 12 or 13 p.i., stained with mercurochrome and imaged using a Leica DMR
microscope. To determine oocyst diameters over time mosquito midguts were dissected at
days 12, 14, 16, 19 and 21/22 p.i. and imaged using a Leica DMR microscope. Oocysts were
counted and measured from these images using ImageJ 1.47n software (imagej.nih.gov/ij).
For confirmation of normal development of GFP-tagged parasite lines in mosquitoes, midguts
22
were dissected at different time points and directly imaged in a Leica DM5000B microscope.
For sporozoite (Spz) counting, midguts and salivary glands were dissected at days 20-22 p.i.,
mashed and Spz counted in a Neubauer chamber. For bite-back experiments, 10 starved
female infected mosquitoes were allowed to feed for 30 min on anesthetised naïve female
Balb/c ByJ mice (6–8 weeks years old) on days 20-21 p.i. (10 mosquitoes per mouse).
Successful feeding was confirmed by the presence of blood in the abdomen of mosquitoes.
Parasitemias in these mice were followed up to 32 days post-bite.
2.4.2. Genotyping and RT-PCRs of ∆dhhc10 and ∆epsf and dhhc2::gfp, dhhc10::gfp; ipet::gfp
and epsf::gfp lines Parasite genomic DNA extraction was done using the kit mentioned in
Appendix I Table S2. RNA extraction and cDNA synthesis was performed as stated in the
Appendix II (7.1 and 7.2). Genomic DNA samples were used in a 10 ng/µL concentration. For
cDNA samples, several dilutions were tested, and the most satisfactory was chosen. PCR
mix was done as described in the Appendix II (7.3) and PCR cycling conditions were the
following: initial step of 3 minutes at 95°C, followed by denaturation step of 10 seconds 95°C,
annealing step during 30 seconds using an appropriate annealing temperature, and an
extension step at 68°C for the required amount of time depending on the size of the
fragments amplified. Finally, an extension step of 10 minutes at 68°C was done. The variable
PCR conditions used for each PCR are summarized in the Appendix III Table S3. RNA
polymerase II was used as control genes; PbAcl15cy1 and PbA820cl1m1cl1 were used as
WT control lines for GFP-tagged lines and KO lines, respectively.
2.4.3. Sequencing of ipet-main version and ipet-splicing variant cDNA. Gel extraction of ipet
cDNA from a pool of several PCR products from RT+ PbAcl15cy1 WT mRNA (g1196 X
g1201c), with a final volume of 192µL (160µL of PCR product and 32 µL of 6X loading dye)
and RT+ 2180 GFP-tagged (g1196 X g0408c), with a final volume of 36 µL (30µL of PCR
product and 6 µL of 6X loading dye) was performed using the kit in Appendix I Table S2. The
cDNA extracted was eluted in 30 µL of Elution Buffer and quantified in a Nanodrop-1000®
Spectrophotometer, followed by cloning of the PCR products obtained in a commercial vector.
In the ligation reaction, 7µL of PCR product were used in a 20µL ligation reaction during 25
minutes. The resulting plasmid was transformed in E. coli DH5α chemically competent cells,
using 2 µL of product per 50 µL of cells and incubated on ice for 20 minutes. Then thermal
shock for 45 seconds at 42°C was done, followed by 2 minutes on ice. 950µL of SOC
medium (per tube) were used to incubate the cells for 1 hour at 37°C. Afterwards, 100µL
were plated directly in an agar plate supplemented with ampicillin (100µg/mL), the remaining
culture was centrifuged 3 minutes at 5000 rpm, and most of the supernatant was discarded
leaving around 200µL that were resuspended and plated. Cells were grown at 37°C
overnight. Mini-prep cultures were grown using 3 mL of LB medium supplemented with
23
ampicillin overnight at 37°C. Plasmid DNA extraction was done using the kit in Appendix I
Table S2 and the DNA obtained was diluted in a final volume of 50µL. Correct ligation of the
insert into the vector was confirmed with a restriction reaction using 0,5 µL of BgI-II 10 U/µL
(Fermentas), 1X Buffer Orange (Fermentas) and 5µL of the previously extracted DNA (in a
total volume reaction of 20µL) and incubated for 1 hour at 37°C. Five µL of 6X loading dye
was added to the restriction reaction and 10µl were in a 1% agarose gel in TAE Buffer.
Correctly cloned plasmids were chosen for sequencing using primers flanking the inserts
(provided with the kit) by Stabvida. The sequences obtained were analyzed using BioEdit
Sequence Alignment Editor Version 7.1.11© and Clone Manager© Software.
2.4.4. Life Cycle RT-PCRs. Asexual mixed blood stages originated from P. berghei HPE line
and asexual and gametocytes stages originated from P. berghei ANKA 820cl1m1cl1 line. In
vitro culture ookinetes 8-hours and 16-hours originated from P. berghei ANKA cl1515cy1 line.
Oocysts sample was obtained from oocysts day 12 p.i. P. berghei ANKA 820cl1m1cl1 line-
infected midguts. Midguts and salivary glands sporozoites samples were both obtained from
P. berghei ANKA 259cl1 parasite line at day 21 p.i.. In vivo exoerythrocytic forms 6 hours, 22
hours and 47 hours samples were obtained from P. berghei ANKA 259cl1 parasite line. RNA
extraction, cDNA synthesis and PCR mix were done as stated in Appendix II (7.1, 7.2. and
7.3). PCR cycling conditions were the following: initial step of 3 minutes at 95°C, followed by
denaturation step of 10 seconds 95°C, annealing step during 30 seconds using an
appropriate annealing temperature, and an extension step at 68°C for the required amount of
time depending on the size of the fragments amplified. Finally, an extension step of 10
minutes at 68°C was done. The variable PCR conditions used for each PCR are summarized
in the Appendix III Table S4. Five µL of each PCR product was loaded in a 3% agarose gel in
TAE Buffer. 18S and hsp70 were used as loading controls and p25, p28, dozi and uis4 were
used as control genes.
2.4.5. Western Blot analysis of CSP expression in oocysts from dhhc10-KO and epsf-KO
parasite lines. To determine circumsporozoite protein (CSP) expression in oocysts from
dhhc10-KO and epsf-KO parasite lines, WT (820cl1m1cl1), dhhc10-KO (PbA2097cl1) and
epsf-KO (PbA2099cl1m7) infected midguts were dissected at day 13 p.i. and resuspended in
1X Laemmli Buffer. DTT was added to a final concentration of 200 mM and samples were
boiled for 10 minutes at 95°C. Samples were loaded and ran the necessary time to obtain the
desired band separation at the molecular weights of interest, CSP and Hsp70 (loading
control) expected molecular weights were about 50kDa and 70kDa, respectively. Afterwards,
the proteins were transferred to nitrocellulose membranes for 1 hour and 45 minutes at
200mA. Nitrocellulose membranes were then blocked for 1 hour at RT with 5% skim milk in
PBS/Tween 20 0,05% and probed overnight at 4°C with 1:9000 Anti-CSP and 1:1000 Anti-
24
Hsp70 in blocking solution in the case of dhhc10-KO line, and in the case of epsf-KO line,
probed with 1:18000 Anti-CSP and 1:1000 Anti-Hsp70 in blocking solution. After 6 short
washes with 0,05% PBS/Tween 20, membranes were probed with HRP-conjugated anti-
mouse antibody for 1 hour at RT, 1:5000 for Hsp70 and 1:10000 for CSP, in the case of
dhhc10-KO line, and in the case of epsf-KO line, 1:5000 for Hsp70 and 1:20000 for CSP.
Finally, membranes were washed with PBS/Tween 20 0,05%, and developed using
Immobilon® Western Chemiluminescent HRP Substrate (Millipore®).
2.4.6. Live imaging and immunofluorescence assays (IFAs) of blood stages, ookinetes,
oocysts and sporozoites. Live imaging of blood stages and blood meal ookinetes of the
different GFP-tagged parasite lines was done by collecting infected red blood cells (iRBCs)
from infected mice and by collecting blood meals from infected mosquitoes, incubating with 1
ug/mL of Hoechst-33342/PBS and visualizing under a Leica DM5000B fluorescence
microscope. IFAs to detect GFP-tagged protein expression and localization in blood stages,
oocysts and sporozoites of the different GFP-tagged parasite lines used in this study were
done using rabbit polyclonal anti-GFP 1:100-1:500 as primary antibody and goat anti-rabbit
IgG-Alexa Fluor®488 1:400-1:500 as secondary antibody. IFAs to detect CSP expression and
localization in WT (820cl1m1cl1) and dhhc10-KO oocysts, as well as in dhhc2
and dhhc10::gfp sporozoites were done using mouse anti-CSP as primary antibody and goat
anti-mouse IgG-CyTM3 1:400-1:500 as secondary antibody. In all IFAs, the RBCs were
previously washed twice with 1X RPMI (GIBCO) with 8-min spins at 2000 rpm at 37°C, and
resuspended in 1X PBS at 37°C. Samples were fixed with 4%PFA/PBS for 10 min at RT,
permeabilised with 0.1-0.5% TritonX-100/PBS (for 10 minutes at RT) and blocked for 1h at
RT with 1-3% BSA/PBS. All antibody incubations were done in blocking solution for 1h at RT
and 1-5 ug/mL of Hoescht-33342/PBS was used to stain nuclei; 3X washes with 1X PBS
were done between incubations. Fluoromount-G™ (SouthernBiotech, U.K.) was used to
mount the coverslips. Images were taken with a Leica DM5000B or Zeiss Axiovert 200M
fluorescence microscope and processed using ImajeJ 1.47n software (imajej.nih.gov/ij).
2.4.7. Statistical methods. Statistical analysis of oocyst numbers per mosquito midgut,
sporozoite numbers per mosquito and oocyst diameters was performed using Mann-Whitney
test as part of Prism software package 5 (GraphPad Software).
3 – Results and Discussion
3.1. Immunoprecipitation of PUF2 Protein in P. berghei gametocytes
To study stage-specific expression of P. berghei PUF2 protein in gametocytes,
immunoprecipitations of PUF2::GFP fusion protein from Nycodenz-purified gametocytes
25
were performed. Western blot analysis of the total gametocyte lysate input, the specific
fraction (GFP) and control eluates (c-myc and beads fractions), showed that the protein
could only be detected in the input (Fig. 4). A band was observed in the input fraction
between 72 kDa and 100 kDa that could potentially correspond to PUF2::GFP detection
(which is expected to be around 83 kDa). No such putative PUF2::GFP protein could be
detected however in the specific immunoprecipitated samples (GFP fraction). A total of 5
independent IP experiments were performed to verify the consistency of the results obtained
using the Nycodenz method to purify gametocytes. In two out of five experiments (data not
shown), a putative PUF2::GFP protein was obtained in the input fraction, but not on the
specific eluate of the GFP fraction, similar to the result on Fig. 4; in the remaining three
experiments, PUF::GFP was not detected neither on the input fraction nor on the GFP-
fractions. The unsatisfactory results obtained led to the following hypotheses: a) faulty
execution of the protocol, or b) the IP method is not suitable for PUF2 protein in gametocytes.
Fig. 4 – Western blot analysis using rabbit anti-GFP (Invitrogen) of one
independent PUF2::GFP IP experiment in P. berghei gametocytes purified by the
Nycodenz method
To verify if the protocol was being correctly performed, a control IP was done in parallel
with PUF2::GFP, using the Nycodenz method (Fig. 5. a)). DOZI::GFP protein has been
demonstrated to be successfully immunoprecipitated in gametocytes [36]. As depicted in Fig.
5. a), no PUF2::GFP protein could be detected in neither the input nor the GFP fractions,
while our control line immunoprecipitated successfully, with DOZI::GFP being identified both
in the input fraction and in the specific GFP eluate (~80 kDa) (Fig. 5. a)). This led us to
hypothesize that maybe the gametocyte purified fraction obtained using the Nycodenz
method had an insufficient amount of material for us to be able to consistently detect
PUF2::GFP by Western blot analysis. To enhance gametocytemia in the PUF2::GFP infected
mouse, and subsequently in the IP starting material, phenylhydrazine was injected 2 days
before infecting the mice with puf2::gfp and dozi::gfp (as control) parasite lines, as previously
described [51]. Starting from day 3 post-infection sulfadiazine was added to their drinking
water [51]. Phenylhydrazine stimulates erythropoiesis and consequently, enhances
parasitemia early after infection. Sulfadiazine was used to suppress proliferation of asexual
stage parasites. The Western blot results show that again DOZI::GFP protein was identified
both in the input fraction and in the specific immunoprecipitate GFP eluate (Fig. 5. b). No
PUF2::GFP corresponding band was detected in any of the fractions (Fig. 5. b)). The results
suggest that this method, used with the intent of enhancing gametocytemia, did not improve
26
the amount of IP starting material. This strategy was therefore not successful in increasing
the detection of PUF2::GFP expression in purified gametocytes.
Fig. 5 – Western blot analysis of PUF2::GFP IP experiment
in parallel with DOZI::GFP IP (control line) in P. berghei
gametocytes purified by the Nycodenz method. a) Nycodenz
method only; b) Nycodenz method with enhanced
gametocytemia.
Another approach used to overcome the unsuccessful immunoprecipitation of
PUF2::GFP in gametocytes, was to perform the IP using the commercially available GFP-
Trap® Kit, a kit used specifically for immunoprecipitation of GFP-fusion proteins. This kit
contains a small GFP-binding protein covalently coupled to the surface of agarose beads. In
the previous method, the parasite material was first incubated with the anti-GFP antibody,
and afterwards the resulting complex PUF2::GFP/anti-GFP was incubated with beads. In this
kit, the GFP-binding protein is already coupled to beads, so the complex GFP-binding
protein/beads is directly incubated with the parasite material, saving time, extra handling of
the samples and ideally increasing the binding events and their stability.
Immunoprecipitations of PUF2::GFP and DOZI::GFP fusion proteins were performed using
mixed blood stages lysates (without gametocyte Nycodenz purification). Western blot
analysis of total mixed blood stages input, bound fraction (to the beads) and non-bound
fraction was performed using a mouse anti-GFP antibody (Roche). Unfortunately this
antibody gave a strong unspecific band pattern especially around 55 kDa (Fig. 6), which
most likely corresponds to the heavy chain of the antibody. Still, from this western blot, it can
be concluded that DOZI::GFP could easily be identified in input and bound fraction, while no
specific PUF2::GFP protein could be detected. The strong unspecific band pattern (Fig. 6)
masks the signal that could potentially correspond to PUF2::GFP protein in the input sample,
as a band between 72-100 kDa (the expected size for this protein is 83 kDa) can be
detected; however the fact that this band is not present in the bound fraction, while it is
detectable in the non-fractions of both IPs, argues that it is most likely non-specific and
unrelated to PUF2::GFP. Having a GFP-binding protein/beads complex would theoretically
improve the IP efficiency, as it significantly raises the chances for PUF2::GFP to “find” its
binding partner. However, this was not the case as PUF2::GFP was not successfully
immunoprecipitated using this strategy.
27
Fig. 6 – Western blot analysis of PUF2::GFP and DOZI::GFP IPs in
mixed blood stages using GFP-Trap® Kit. Non bound fraction abbreviated
as Non-B.
3.1.1. puf2::gfp sequencing
While dealing with the inability to immunoprecipitate PUF2::GFP in gametocytes and
mixed blood stages, another hypothesis emerged: what if puf2::gfp parasite line was not
expressing a functional PUF2::GFP fusion protein as expected? To verify this hypothesis,
two different types of samples were sequenced, puf2::gfp genomic DNA (gDNA) and cDNA
prepared from RNA isolated from mouse infected with the PUF2::GFP parasite line. The
primers used and their annealing positions are depicted in Fig. 7. A. puf2::gfp construct had
been designed changing the TGA linker to GGATCC, creating a BamHI restriction site (Fig.
7). Two single mismatches were found in the gfp gene, one synonymous at position 3529
and one at position 3396 that changes a methionine (ATG) to an isoleucine (ATA). Since the
gfp reading frame is still maintained and the mutations found most likely have a minor, if at all,
effect in the overall folding/functioning of the protein, we concluded that the puf2::gfp parasite
line used so far (1750cl4) should express a functional PUF2::GFP fusion protein.
Fig. 7 – puf2::gfp construct
sequencing. A. Schematic diagram
depicting puf2::gfp construct, showing
the sequencing primers (g0477 X
g0459c), their annealing position
(2956 and 3840, respectively), and
the GGATCC linker region between
puf2 and gfp. B. Alignment of
puf2::gfp theoretical construct
(denoted as PUF2::GFP_theore), and
the sequenced clones (two gDNA
clones (denoted as gDNA_clone_G2
and gDNA_clone_G4) and one cDNA clone (cDNA_clone_C4), focusing only on the linker region.
3.1.2. Discussion
Sexual development is a decisive point in the Plasmodium life cycle. In contrast to the
rigid determined progression in all the other stages [52], commitment to gametocytogenesis
is a process characterized by plasticity and in addition regulated by several environmental
factors [46]. Still, the molecular mechanisms governing sexual development and
differentiation remain to be elucidated.
28
PUF2 protein has been emerging as a stage-specific key regulator in Plasmodium. In P.
berghei, it was shown that PU2 protein has an essential role in parasite transmission
between the mosquito and the mammalian host [47]. In addition, further evidences in P.
falciparum suggest that PUF2 has a significant role in suppressing gametocyte differentiation
[46]. Moreover, PUF2 protein is only expressed in sexual stages (and not in asexual stages),
with a cytoplasmic evenly distributed localization [46]. These findings rendered PUF2 protein
as a strong candidate in the repression of transcripts in P. berghei.
Immunoprecipitation of proteins is a powerful technique that is used to isolate a
particular protein, and eventual partners, in a sample where are thousands of other proteins.
By using this technique, it would be possible to confirm PUF2 protein expression in P.
berghei gametocytes and, in addition, create a starting point to study proteins interactions
either with other proteins or with RNA, in the case of RNA-binding proteins. When a protein is
immunoprecipitated, the RNAs that physically interact with it will also be isolated and can be
further identified.
DOZI alongside with CITH protein define a translation repressor complex with an
established role in sexual development [36]. DOZI::GFP and CITH::GFP were shown to
immunoprecipitate successfully in gametocytes, and since then, this complex has been
further characterized [34, 36]. In these studies, immunoprecipitations were performed with
purified gametocytes obtained by the Nycodenz method using blood extracted from one
mouse. Unfortunately, our results demonstrate that the aforementioned IP strategy is not
successful when applied to PUF2::GFP fusion protein. One possibility is that PUF2
expression is much lower when compared to DOZI, and the same IP starting material will
allow detecting DOZI::GFP but not PUF2::GFP. Using a commercial IP kit for GFP fusion
proteins, an improvement in the interaction between the GFP-binding protein and
PUF2::GFP was expected. However, no PUF2 expression was detected, reinforcing the idea
that our handicap was the insufficient amount of gametocyte lysate. Taking our results into
account, the next step would be to perform the IP protocol with a higher number of mice per
each GFP-tagged fusion protein. Using this strategy, it would be possible to define the
detection limit in Western Blot analysis for immunoprecipitated PUF2::GFP. In addition,
preliminary immunofluorescence results (data not shown) indicate that P. berghei
PUF2::GFP is not only expressed in the gametocytes but also in asexual blood stages,
therefore, using mixed blood stages lysates instead of purified gametocytes might be
advantageous. Further studies are required to outline the optimal strategy to
immunoprecipitate PUF2::GFP tagged fusion in P. berghei gametocytes.
29
3.2. Characterization of a set of proteins translationally repressed by the DOZI and
CITH defined mRNP complex
3.2.1. Confirmation of the targeted disruption of dhhc10 and epsf
To investigate the function of PbDHHC2, PbDHHC10, PbIPET and PbEPSF, a series
of mutant parasite lines were previously constructed in the lab. dhhc10 and epsf were
independently disrupted via double homologous recombination and integration of a modified
Toxoplasma gondii dihydrofolate reductase/thymidylate synthase (tgdhfr/ts) gene cassette
(which confers resistance to pyramethamine, an antimalarial drug) to create ∆dhhc10 and
∆epsf lines. The ∆dhhc10 and ∆epsf mutants were verified by diagnostic PCR. Successful
gene deletion was further confirmed by RT-PCR analysis on mixed-blood stages cDNA,
which failed to detect the respective dhhc10 and epsf mRNA. Expression of control genes
was detected (Appendix IV Figs. S1 and S2).
3.2.2. Confirmation of successful GFP-tagging of dhhc2, dhhc10, ipet and epsf
GFP-tagged parasite lines of dhhc2, dhhc10, ipet and epsf were previously generated
in the lab to assess their expression and localization. This was achieved by stably
introducing the gfp gene at the C-terminus of each open reading frame, using single
homologous recombination. As in the case of KO parasite lines, a modified tgdhfr/ts gene
cassette was introduced for selection purposes conferring resistance to pyrimethamine.
Diagnostic PCR across the predicted integration sites showed correct integration of the GFP-
tagging construct. No WT version of the genes was detected. Successful GFP-tagging was
further confirmed by RT-PCR analysis on mixed blood stages cDNA, which failed to detect
the respective WT mRNAs, and successfully detected the respective GFP-tagged mRNAs
(Appendix IV Figs. S3 – S6).
3.2.3. Alternative splicing in ipet
When performing diagnostic RT-PCRs in ipet::gfp parasites we were able to
consistently detect a second amplicon of higher molecular weight. As depicted in Appendix
IV Fig. S5, both ipet mRNA WT version and GFP-tagged version both display a stronger
bottom band (displaying the theoretical expected size, 501bp and 474 bp, for ipet cDNA and
ipet::gfp cDNA, respectively) and a weaker top band. To investigate the origin of the extra
amplicon, bottom and top bands for both WT and ipet::gfp parasites were electroforeticaly
separated, gel extracted and sequenced. As listed in Appendix IV Table S1, ipet gene has 6
exons, which are illustrated in the alignment diagram shown in Fig. 8 A (PBANKA_060580
cDNA). The ipet contig stretch is a region of the genome that includes the ipet gene and a
stretch upstream and downstream of the gene. The contig was aligned with the theoretical
30
ipet cDNA sequence, as well as with the cDNA sequences obtained from both bottom and
top bands originated from both WT and ipet::gfp parasites. As observed in Fig. 8 A, both
bottom bands (PbAcl15cy1 and 2180cl1m4) display a similar exon pattern to ipet theoretical
cDNA; on the other hand, both top bands (PbAcl15cy1 and 2180cl1m4) display a 3’
extension of exon 5. In terms of protein sequence, until aminoacid number 106 a 100%
match for all sequences was verified. When comparing the theoretical version and the splice
variant proteins sequences of IPET, one can see that the theoretical variant and the splice
variant showed a different C-terminal sequence from the position 106th onwards (Fig. 8 B).
Fig. 8 – ipet presents a splice variant. A. Diagram displaying the alignment of ipet contig (PBANKA_060580 contig), ipet theoretical cDNA
sequence (PBANKA_060580 cDNA), ipet splice variant WT version (PbAcl15cy1 top band), ipet splice variant GFP-tagged version
(PbA2180cl1m4 top band), ipet mRNA main version WT version (PbAcl15cy1 bottom band) and ipet mRNA main version GFP-tagged version
(PbA2180cl1m4 bottom band). ipet (PBANKA_060580) gene length is indicated with double dashed line. B. Protein ClustalW multiple alignment of
ipet splice variant WT version (PbAcl15cy1 top band), ipet splice variant GFP-tagged version (PbA2180cl1m4 top band), ipet mRNA main version
WT version (PbAcl15cy1 bottom band) and ipet mRNA main version GFP-tagged version (PbA2180cl1m4 bottom band). Identical and similar
aminoacids are indicated in black and grey shading, respectively.
3.2.4. Life cycle mRNA and protein expression profile and protein localization
To assess the transcription pattern of the studied genes, RT-PCR analysis of dhhc2,
dhhc10, epsf and ipet mRNA was performed in all stages of the P. berghei life cycle (Fig. 9).
In the case of dhhc2, mRNA expression prevails in the gametocytes, however, there is
mRNA detection in the asexual blood stages, although in a lower level. In the mosquito stage,
dhhc2 transcription remains switched on until the midgut sporozoites stage, with a significant
decrease in expression in ookinetes at a later time point. In liver stage, dhhc2 transcription is
switched off. In the case of dhhc10, mRNA transcription is switched on in the gametocytes
and still remains in the ookinete stage at 8 hours, but with a lower expression. In the
remaining of the parasite life cycle, dhhc10 gene transcription is switched off. ipet and epsf
genes transcription have somewhat a similar pattern to dhhc2 gene transcription; the most
31
relevant differences are that ipet and epsf mRNA expression remains during the salivary
glands sporozoites stage, and only in the EEFs is switched off, and in both cases, there is no
expression in asexual blood stages. Even though dhhc2 and dhhc10 belong to the same
enzyme family, their mRNA expression profile is dissimilar, the only resemblance being the
high expression in gametocytes. p25 and p28 are known to be translationally repressed in
gametocytes by the DOZI- and CITH-defined repressor complexes. As expected, their mRNA
transcription is switched on and has the highest expression level in the gametocytes; this is
particularly evident for p25, as observed in Fig. 15. The same situation is verified in our set of
genes predicted to be translationally repressed: dhhc2, dhhc10, ipet and epsf. Among our set
of gene, ipet and epsf are the ones that share the most resembling mRNA profile throughout
the life cycle, with a highest expression in gametocytes and ookinetes at an earlier time point,
and with a lower, but still detectable, expression in the remaining mosquito stages. Since our
set of genes was predicted to be translationally repressed in gametocytes by the DOZI- and
CITH-defined repressor complexes, these findings are in agreement with the proposed
mechanism of repression. In this translationally repression model, a switch on in transcription
is expected in gametocytes, then the mRNAs are maintained in a quiescent state and later
on, when needed, they can be translated into protein.
Fig. 9 – mRNA expression profile of dhhc2, dhhc10, ipet
and epsf. Asexual mixed blood stages were originated from P.
berghei HPE strain. Asexual and gametocytes as well as
oocysts d12 p.i. were originated from P. berghei ANKA
820cl1m1cl1 parasite line. In vitro cultivated ookinetes (ooks)
at 8 and 16 hours were originated from P. berghei ANKA
cl15cy1. Midgut sporozoites (MG Spz) and salivary glands
sporozoites (SG Spz), both from day 20 p.i., and in vivo
exoerythrocytic forms (EEFs) at 6, 22 and 47 hours p.i. were
obtained from P. berghei ANKA 259cl1 parasite line. p25, p28,
dozi and uis4 are shown as control genes. hsp70 and 18S
rRNA were used as loading control genes.
To examine DHHC2, DHHC10, IPET and EPSF expression and localization, live
imaging and immunofluorescence essays were performed using the GFP-tagged parasite
lines mentioned in 3.2.2.. DHHC2 expression in asexual blood stages and gametocytes was
assessed and presence of DHHC2 was detected at these stages (Fig. 10). DHHC2::GFP
32
parasites revealed green fluorescence throughout the cytoplasm in all blood stages, as
depicted in Fig. 10. In contrast, DHHC10 expression in blood stages was not detected (data
not shown), but in ookinetes fluorescence in two cytoplasmic focal points was observed (Fig.
11). DHHC10 was also detected in oocysts and salivary gland sporozoites, characterized by
a dispersed cytoplasmic pattern and a speckled pattern, respectively (Fig. 12).
DHHC10::GFP parasite line gave rise to oocysts that sporulated normally, and originated
functional sporozoites with standard CSP expression, as depicted in Fig. 13, that were
efficiently transmitted to naive mice by infected mosquito bites (data not shown).
Fig. 10 – DHHC2 is expressed in asexual blood stages, as well as
gametocytes. Live imaging of asexual and sexual blood stages of
dhhc2::gfp parasites show DHHC2 expression all blood stage
parasite forms. Bars correspond to 5 µm.
Fig. 11 – DHHC10 is present in ookinetes. Live imaging of
ookinetes of dhhc10::gfp parasites shows DHHC10 expression at this
developmental stage. Bars correspond to 5 µm.
Fig. 12 – DHHC10 is expressed in oocysts and salivary gland
sporozoites but not in blood stages. A. Immunofluorescence
assay of oocyst-infected midguts at day 14 p.i. with anti-GFP
antibody (green) and Hoechst-33342 (blue). DHHC10 is expressed
at this stage as seen by the GFP signal. Bar corresponds to 20 µm.
B. Immunofluorescence assay of salivary gland sporozoites at day
33 p.i. with anti-GFP antibody (green) and Hoechst-33342 (blue).
DHHC10 is expressed at this stage as seen by the GFP signal. Bar
corresponds to 5 µm.
Fig. 13 – dhhc10::gfp parasite lines develop normally in the mosquito vector.
Live imaging of dhhc10::gfp oocysts at days 8 (400X magnification) and 19 post-
infection (630X magnification) and anti-CSP immunofluorescence assay on
salivary gland sporozoites at day 33 post-infection. Oocysts show normal
sporulation while sporozoites show normal morphology and CSP expression and localisation. Red staining in sporozoites correspond to CSP and
blue staining to DNA (Hoechst-33342). Bars correspond to 20 µm in the case of oocysts and to 5 µm in the case of sporozoites.
33
IPET expression was observed in ookinetes, oocysts, midguts and salivary glands
sporozoites. Expression in blood stages was not detected (data not shown). Interestingly,
IPET::GFP fluorescence pattern in ookinetes resembled that of DHHC10::GFP, showing two
cytoplasmic focal points (Fig. 14). In oocysts, green fluorescence was observed throughout
the cytoplasm (Figs. 14 and 15). In midguts and salivary glands sporozoites a speckled
pattern was observed, suggesting localization to granules or organelles (Fig. 15). Both
patterns are similar to the ones observed in the case of DHHC10 protein. EPSF expression
was examined in ookinetes, and again, two cytoplasmic focal points were detected (Fig. 16).
Fig. 14 – IPET is expressed in ookinetes and oocysts. Live imaging of
mosquito blood meal ookinetes and oocysts of ipet::gfp parasites at days 13
and 21 post-infection shows IPET expression in both parasite forms. IPET is
strikingly located in 2 discrete dots in live ookinetes. Bars correspond to 5 µm
in the case of ookinetes and 20 µm in the case of oocysts.
Fig. 15 – IPET is expressed in oocysts and sporozoites.
Anopheles stephensi female mosquitoes were allowed to feed
on anesthetised BALB/c mice infected with ipet::gfp parasite
line. A. Immunofluorescence assay of oocyst-infected midguts
at day 14 p.i. with anti-GFP antibody (green) and Hoechst-
33342 (blue). IPET is expressed at this stage as seen by the
GFP signal. Bar corresponds to 20 µm. B.
Immunofluorescence assay of midgut sporozoites (MG Spz) at
day 24 p.i. with anti-GFP antibody (green) and Hoechst-33342
(blue). IPET is expressed at this stage as seen by the GFP
signal. Bar corresponds to 5 µm. C. Immunofluorescence
assay of salivary gland sporozoites (SG Spz) at day 21 p.i.
with anti-GFP antibody (green) and Hoechst-33342 (blue).
IPET is expressed at this stage as seen by the GFP signal.
Sporozoites show normal morphology and CSP expression
and localisation (red). Bars correspond to 5 µm.
Fig. 16 – EPSF is expressed in ookinetes. Live imaging of epsf::gfp
mosquito blood meal ookinetes at 16h post-infection shows EPSF
expression in two discrete dots. Bars correspond to 5 µm.
34
As observed before, dhhc2 mRNA expression was detected in asexual blood stages
and gametocytes (Fig. 9). Protein expression was also detected at these stages. dhhc2 is
part of our set of transcripts predicted to be translationally repressed by the DOZI and CITH-
defined repressor complexes, but unexpectedly, there is both mRNA and protein expression
in gametocytes (Figs. 9 and 10). In contrast, dhhc10 has mRNA expression but no protein
expression in gametocytes (Fig. 9; data not shown). Protein expression is detected later on,
in the mosquito stages. In dhhc10 the expression pattern expected in a translationally
repressed transcript in gametocytes was verified, on the contrary, in dhhc2 this pattern was
not observed. We concluded that, even though dhhc2 was initially part of the set of
transcripts predicted to be translationally repressed, dhhc2 translation is not repressed in
gametocytes. In the ookinete stage, DHHC10, IPET and EPSF expression was detected in
two discrete dots, resembling a pattern found in proteins that are associated with crystalloid
bodies [53] (Figs. 11, 14 and 16).
3.2.5. ∆dhhc10 and ∆epsf mutants phenotype
Both ∆dhhc10 and ∆epsf parasite lines were capable of infecting Anopheles stephensi
mosquitoes, and on day 12 to 13 post-infection numbers of oocysts were counted. ∆dhhc10
parasites exhibited normal oocyst development. (Fig. 17 A). In contrast, ∆epsf parasites
exhibited an impairment in oocyst development, since in this KO parasite line, there were
fewer number of oocysts per midgut when compared to WT parasites (Fig. 18 A). In both KO
parasite lines infections (on days 20 to 22 post-infection) no midgut or salivary gland
sporozoites were observed, in contrast to WT infections (Figs. 17 B and 18 B.)
Fig. 17 – dhhc10 gene
deletion mutants are
impaired in development
during mosquito passage.
Anopheles stephensi
female mosquitoes were
allowed to feed on
anesthetised BALB/c mice
infected with either WT
(PbA820cl1m1cl1) or
∆dhhc10 parasite lines. A.
∆dhhc10 parasites show
normal oocyst development. Oocysts were counted on days 12 to 13 post-infection. Absolute numbers of oocysts per midgut from 5 independent
experiments are presented for both WT (n=70) and ∆dhhc10 (n=48) parasites. B. ∆dhhc10 parasites no not form any midgut sporozoites (MG Spz),
as well as salivary gland sporozoites (SG Spz). Absolute numbers of sporozoites from 4 independent experiments are presented for both WT
(n=5) and ∆dhhc10 (n=10) parasites. Sporozoites were counted in pools of 5 to 25 mosquitoes on days 20 to 22 post-infection. (A-B) Mean and
SEM values are shown by the lines, while p-values for Mann-Whitney test are shown above the data sets in both plots.
35
Fig. 18 – epsf gene
deletion mutants are
impaired in development
during mosquito passage.
Anopheles stephensi female
mosquitoes were allowed to
feed on anesthetised
BALB/c mice infected with
either WT (PbA820cl1m1cl1)
or ∆epsf parasite lines. A.
∆epsf parasites show an
impairment in oocyst development. Oocysts were counted on days 12 to 13 post-infection. Absolute numbers of oocysts per midgut from 6 and 5
independent experiments are presented for WT (n=88) and PBANKA_072090-KO (n=92) parasites, respectively. B. ∆epsf parasites no not form
any midgut sporozoites (MG Spz), as well as salivary gland sporozoites (SG Spz). Absolute numbers of MG Spz from 4 independent experiments
are presented for both WT (n=5) and ∆epsf (A) (n=10) parasites, while in the case of SG Spz data from 5 independent experiments are presented
for both WT (n=6) and ∆epsf (n=11) parasites. Sporozoites were counted in pools of 5 to 24 mosquitoes on days 20 to 22 post-infection. (A-B)
Mean and SEM values are shown by the lines, while p-values for Mann-Whitney test are shown above the data sets in both plots.
Oocysts diameter was measured for both ∆dhhc10 and ∆epsf parasite lines at different
time points. As times progresses, both ∆dhhc10 and ∆epsf oocysts become progressively
enlarged when compared to WT (Fig. 19). Two types of oocyst populations were possible to
observe in both KO parasite lines: non-sporulated oocysts, that resemble immature wt
oocysts, and oocysts that seem vacuolated or degenerated (data not shown).
Fig. 19 – epsf and dhhc10 gene
deletion oocysts become
progressively enlarged throughout
time. Anopheles stephensi female
mosquitoes were allowed to feed on
anesthetised BALB/c mice infected
with either WT (PbA820cl1m1cl1)
∆epsf or ∆dhhc10 parasite lines.
Oocyst diameters were measured at
different time point post-infection (p.i.) from bright field Leica DMR microscopic pictures taken 400X magnification using Image J software. A.
Oocyst diameters at day 12 p.i.. B. Oocyst diameters at day 14 p.i.. C. Oocyst diameters at day 16 p.i.. D. Oocyst diameters at day 19 p.i.. E.
Oocyst diameters at days 21/22 p.i.. (A-E) Mean and SEM values are shown by the lines, while p-values for Mann-Whitney test are shown above
the data sets in all plots.
Since circumsporozoite protein (CSP) plays an important role in sporozoite
development [54] and csp disruption mutant has the same phenotype as ∆dhhc10 and ∆epsf
parasites [55], CSP expression was assessed in oocysts of both KO parasite lines by
36
Western blot analysis and immunofluorescence assay at days 13 and 14 p.i., respectively. A
similar result was obtained in both cases, as depicted in Figs. 20 and 21, CSP expression in
KO oocysts was only detected in experimental settings where WT CSP expression was
oversaturated. During WT oocyst development, oocyst plasma membrane invaginations lead
to sporoblasts formation, and consequently sporozoite with CSP covering the whole
membrane [10]. In KO oocysts, however, there is an impairment in sporozoite formation,
which is accompanied by a highly reduced CSP expression. These results strengthen the
hypothesis that both DHHC10 and EPSF are essential proteins for sporozoite formation. In
both KO parasites, oocysts do not sporulate and CSP expression is dramatically reduced,
suggesting that both proteins are vital for the mechanisms underlying sporozoite formation.
Fig. 20 – dhhc10 gene deletion oocysts show
decreased CSP expression. Anopheles stephensi female
mosquitoes were allowed to feed on anesthetised BALB/c
mice infected with either WT (PbA820cl1m1cl1) or
∆dhhc10 parasite lines. Midguts were harvested between
days 13 and 14 post-infection (p.i.). A. Western blot of
infected midguts (2 midguts per lane) at day 13 p.i. with
anti-CSP and anti-Hsp70 antibodies. Two anti-CSP
exposure times are shown. Note that when CSP is
detected in ∆dhhc10 oocysts, signal coming from WT
oocysts is already oversaturated. Hsp70 serve as parasite
loading control. B. Immunofluorescence assay of oocyst-
infected midguts at day 14 p.i. with anti-CSP antibody (red)
and Hoechst-33342 (blue). Anti-CSP images were taken with the same exposure time and their brightness and contrast adjusted in 2 different
ways to highlight that when CSP is detected in ∆dhhc10 oocysts, signal coming from WT oocysts is already oversaturated. Bar corresponds to 20
µm.
Fig. 21 – epsf gene deletion oocysts show decreased
CSP expression. Anopheles stephensi female mosquitoes
were allowed to feed on anesthetised BALB/c mice
infected with either WT (PbA820cl1m1cl1) or ∆epsf
parasite lines. Midguts were harvested between days 13
and 14 post-infection (p.i.). A. Western blot of infected
midguts at day 13 p.i. with anti-CSP and anti-Hsp70
antibodies. Two anti-CSP exposure times are shown. Note
that when CSP is detected in ∆epsf oocysts, signal coming
from WT oocysts is already oversaturated. Hsp70 serves
as parasite loading control. B. Immunofluorescence assay
of oocyst-infected midguts at day 14 p.i. with anti-CSP
antibody (red) and Hoechst-33342 (blue). Anti-CSP images
were taken with the same exposure time and their
brightness and contrast adjusted in 2 different ways to
highlight that when CSP is detected in ∆epsf oocysts, signal coming from WT oocysts is already oversaturated. Hoechst staining is reduced in
∆epsf oocysts when compared to WT oocysts, indicating less DNA replication. Decreased CSP and DNA stainings are in agreement with the
absence of sporozoite formation in ∆epsf parasites. Bars corresponds to 20 µm.
37
3.2.6. Discussion
3.2.6.1. DHHC10, IPET and EPSF role in Plasmodium life cycle
In the last 20 years, translational repression has been emerging as a critical post-
transcriptional mechanism in the Plasmodium life cycle. DOZI and CITH are present in
Plasmodium P-granules [35], contributing to the translational repression of hundreds of
mRNAs [34, 36]. The DOZI and CITH-defined repressor complexes were shown to have a
central role in the sexual development of the parasite [37]. P25 and P28 are ookinete surface
proteins whose transcripts were found to be translationally repressed by DOZI and CITH
defined mRNPs complexes [37]. Their vital role in Plasmodium development in the mosquito
is well established. It was shown that P25 and P28 double-KO ookinetes traversal ability is
impaired, as is their further development into oocysts [57]. Both P25 and P28 are very well
studied targets of transmission blocking antibodies. Transmission blocking vaccines primary
aim is to decrease the number of infected mosquitoes by arresting parasite development in
the mosquito [58]. Since P25 and P28 are antigens expressed in the ookinetes surface they
are called postfertilization antigens; antigens located on the surface of male and female
gametocytes and gametes are termed prefertilization antigens [59]. Gametocyte/gamete
surface proteins P48/45 and P230 are another example of extensively studied transmission
blocking vaccine candidates [59]. Throughout the years, several ookinete surface proteins
and ookinete secreted proteins have been appointed as promising candidates for the
transmission blocking strategy: ookinete micronemal proteins chitinase (PgCHT1),
circumsporozoite and TRAP-related protein (CTRP), von Willebrand factor A domain-related
protein (WARP) [60], cell-traversal protein for ookinetes and sporozoites (CelTOS) [61] and
Plasmepsin 4 [62], among others.
Similarly to P25 and P28, DHHC2, DHHC10, IPET and EPSF were predicted to be
translationally repressed by DOZI- and CITH-defined repressor complexes. Moreover, this
set of proteins was predicted to be surface proteins due to the presence of signal peptides
and/or transmembrane domains. For these reasons, we originally hypothesized that they
could be useful TBV candidates. However, DHHC10, IPET and EPSF localization in
ookinetes resembles that of proteins associated with crystalloid bodies. Crystalloid bodies
origin and functions are still very unclear. However, a role in malaria transmission has been
proposed due to their stage specific presence in ookinetes and young oocysts [63].
Crystalloid bodies proposed function would be of an organelle where proteins synthesized in
the gametocytes are stored only to be used, afterwards during oocyst development [63].
Interestingly, our findings suggest that dhhc10, ipet and epsf transcripts are in a quiescent
state in the gametocytes, with no protein translation at this stage. In the ookinetes DHHC10,
IPET and EPSF protein production begins, and their localization suggests that they are
38
stored in crystalloid bodies, being used later on in the life cycle. DHHC10 and EPSF seem
crucial for sporozoite formation, since their corresponding KO parasites are characterized by
impairment of sporozoite formation. DHHC10-mediated protein palmitoylation seems to be
absolutely vital but only at the stage of sporozoite formation, since the number of KO oocysts
per mosquito midgut remained normal when compared to a WT line. In contrast, the number
of ∆epsf oocyst per midgut was significantly lower than that of WT parasites, suggesting that
EPSF role starts earlier in the oocyst development. pbdhhc10 disruption phenotype is similar
to the one observed for P. berghei scavenger receptor-like protein PbSR, a protein produced
in the macrogametocytes which is also localized to crystalloid bodies in ookinetes, and was
shown to be involved in the formation of these organelles [53]. PbSR is a member of the
LCCL/lectin adhesive-like protein (LAP) family suggested to be associated with the
crystalloid bodies [63]. Other members of this family showed similar loss-of-function
phenotypes to the ones observed for pbsr and pbdhhc10, with the same enlarged and
vacuolated or non-sporulated oocyst phenotype [64]. These similarities strengthen our
hypothesis of DHHC10 being localized to the crystalloid bodies, where it is stored, and then
delivered to the oocyst. DHHC10 would then palmitoylate targeted proteins essential in the
membrane invagination process that results in sporoblasts formation.
Our perception of RNA regulation in Plasmodium has changed drastically in the last
years. Post-transcriptional mechanisms like translational repression illustrate how
Plasmodium life cycle regulation is a dynamic and sophisticated process. Additional
evidences of complex mechanisms of mRNA processing in Plasmodium species have arised,
such as alternative splicing [65]. In gametocytes, ipet transcription produces a main variant,
which seems to be necessary for development in the mosquito, since IPET is expressed in
ookinetes, oocysts, midgut and salivary gland sporozoites. However, ipet was found to
possess an alternative splice variant, with a coding potential for a protein with a different C-
terminal sequence. This may be indicative of a possible IPET isoform with a different
localization, regulation and function. Further studies are needed to assess the functionality
and relevance of this splice variant. Nonetheless, our findings are an additional indication of
the complexity of the RNA metabolism in Plasmodium.
Our results further confirm the critical role of translational repression in the Plasmodium
sexual development and give additional indications about the highly organized post-
transcriptional mechanisms that regulate the Plasmodium life cycle.
3.2.6.2. DHHC family in Plasmodium: DHHC2 and DHHC10
In the last years, studies regarding palmitoylation role in Plasmodium life cycle have
been increasing significantly. Palmitoylation is a reversible post-translational modification
(PTM) and is essential for the control of protein trafficking, localization, enzyme activity,
39
among others [66]. DHHC domain-containing proteins, also called palmitoylacyl-transferases
(PATs), mediate palmitoylation intracellularlly [66]. PfAnkDHHC, a protein containing a
DHHC domain, was suggested to be important for the development of asexual blood stages
in Plasmodium falciparum [67]. Evidences started to emerge that palmitoylation would be
important for gliding, and consequently for host cell invasion, since GAP45 an important
component of the glideosome is palmitoylated in P. falciparum [68]. More recently, around
400 palmitoylated proteins were identified in asexual blood stages, strengthening the
hypothesis that palmitoylation has a central role in blood stage development, namely in
schizont maturation and erythrocyte invasion [69].
A global analysis of apicomplexan PATs reinforced the idea that palmitoylation is an
important PTM in schizont development, since PbDHHC5, 7, 8 and 9 expression were
detected in P. berghei schizonts [50]. Our results strengthen this idea, since PbDHHC2 is
also detected in schizonts. In addition, PbDHHC2 is also expressed in the remaining blood
stages, suggesting that this protein may have a role throughout blood stage development. In
contrast, PbDHHC10 was not detected in any blood stages, implying that these proteins
have non-overlapping roles in the Plasmodium life cyle. ∆pbdhhc10 parasite line confirmed
this hypothesis, since dhhc10 absence led to impairment only in sporozoite formation. This is
the first indication that palmitoylation is an essential PTM in sporozoite formation.
Our results further confirm the importance of protein palmitoylation mechanism in the
biology Plasmodium parasites, a feature that seems to be shared among the Apicomplexa
parasites [50].
4 – Conclusions
Translational repression is a crucial mechanism in the Plasmodium sexual
development. DOZI and CITH proteins are major key players in this process forming
ribonucleoprotein complexes in female gametocytes where certain mRNAs are translationally
repressed, being stored until fertilization occurs. In sporozoites, PUF2 binds to mRNAs and
also represses their translation controlling, possibly by regulating eIF2α, sporozoite latency.
Indications are emerging of a role of PUF2 in translational repression in the gametocytes; still,
our results weren’t able to further confirm this hypothesis. As depicted in Fig. 22, our findings
suggest that DHHC10, EPSF and IPET are translationally repressed by the DOZI- and CITH-
defined complexes, and only translated later on in ookinetes, where they are stored in
crystalloid bodies. In contrast, DHHC2 expression is already detected in gametocytes, and
also in asexual blood stages, thus suggesting a role at these stages. Afterwards, DHHC10
and EPSF will have an essential role in sporozoite formation. On the other hand, IPET main
variant seems to have a role in parasite development in the mosquito. In addition, our results
40
demonstrate the critical role of protein palmitoylation in sporozoite formation, and hence, in
malaria transmission. Briefly concluding, post-transcriptional mechanisms have a critical role
in the Plasmodium life cycle. Translational repression allows the maintenance of a pool of
important mRNAs ready to be rapidly translated upon a certain signal and thus, ensuring a
rapid transition from one stage to the next in the life cycle.
Fig. 22 – Translational
repression in P. berghei life
cycle. Illustration summarizing
the main conclusions of our
study. Ookinetes abbreviated as
ook and salivary gland
sporozoites as SG Spz.
(Adapted from [56]).
5 – References [1] Barillas-Mury, C. and S. Kumar (2005). "Plasmodium–mosquito interactions: a tale of dangerous liaisons." Cellular Microbiology 7(11): 1539-1545.
[2] Martinsen, E. S., S. L. Perkins, et al. (2008). "A three-genome phylogeny of malaria parasites (Plasmodium and closely related genera): Evolution of life-history traits and host switches." Molecular Phylogenetics and Evolution 47(1): 261-273.
[3] World Health Organization (WHO), World Malaria Report, 2012.
[4] Matuschewski, K. (2006). "Getting infectious: formation and maturation of Plasmodium sporozoites in the Anopheles vector." Cellular Microbiology 8(10): 1547-1556.
[5] Frech, C. and N. Chen (2011). "Genome comparison of human and non-human malaria parasites reveals species subset-specific genes potentially linked to human disease." PLoS Comput Biol 7(12): e1002320.
[6] Thera, M. A. and C. V. Plowe (2012). "Vaccines for Malaria: How Close Are We?" Annual Review of Medicine 63(1): 345-357.
[7] Schwartz, L., G. Brown, et al. (2012). "A review of malaria vaccine clinical projects based on the WHO rainbow table." Malaria Journal 11(1): 11.
[8] Miller, L. H., H. C. Ackerman, et al. (2013). "Malaria biology and disease pathogenesis: insights for new treatments." Nat Med 19(2): 156-167.
[9] Silvestrini, F., P. Alano, et al. (2000). "Commitment to the production of male and female gametocytes in the human malaria parasite Plasmodium falciparum." Parasitology 121 Pt 5: 465-471.
41
[10] Aly, A. S., A. M. Vaughan, et al. (2009). "Malaria parasite development in the mosquito and infection of the mammalian host." Annu Rev Microbiol 63: 195-221.
[11] Amino, R., S. Thiberge, et al. (2006). "Quantitative imaging of Plasmodium transmission from mosquito to mammal." Nat Med 12(2): 220-224.
[12] Prudencio, M., A. Rodriguez, et al. (2006). "The silent path to thousands of merozoites: the -Plasmodium liver stage." Nat Rev Microbiol 4(11): 849-856.
[13] Mota, M. M., G. Pradel, et al. (2001). "Migration of Plasmodium Sporozoites Through Cells Before Infection." Science 291(5501): 141-144.
[14] Sturm, A., R. Amino, et al. (2006). "Manipulation of host hepatocytes by the malaria parasite for delivery into liver sinusoids." Science 313(5791): 1287-1290.
[15] Ho, M. and N. J. White (1999). "Molecular mechanisms of cytoadherence in malaria." American Journal of Physiology - Cell Physiology 276(6): C1231-C1242.
[16] Bannister, L. H., J. M. Hopkins, et al. (2000). "A Brief Illustrated Guide to the Ultrastructure of Plasmodium falciparum Asexual Blood Stages." Parasitology today (Personal ed.) 16(10): 427-433.
[17] Bannister, L. and G. Mitchell (2003). "The ins, outs and roundabouts of malaria." Trends in Parasitology 19(5): 209-213.
[18] Portugal, S., H. Drakesmith, et al. (2011). "Superinfection in malaria: Plasmodium shows its iron will." EMBO Rep 12(12): 1233-1242.
[19] Coleman, B. I. and M. T. Duraisingh (2008). "Transcriptional control and gene silencing in Plasmodium falciparum." Cellular Microbiology 10(10): 1935-1946.
[20] Deitsch, K., M. Duraisingh, et al. (2007). "Mechanisms of gene regulation in Plasmodium." Am J Trop Med Hyg 77(2): 201-208.
[21] Hall, N., M. Karras, et al. (2005). "A comprehensive survey of the Plasmodium life cycle by genomic, transcriptomic, and proteomic analyses." Science 307(5706): 82-86.
[22] Gardner, M. J., N. Hall, et al. (2002). "Genome sequence of the human malaria parasite Plasmodium falciparum." Nature 419(6906): 498-511.
[23] Janse, C. J., P. F. J. van der Klooster, et al. (1986). "DNA synthesis in Plasmodium berghei during asexual and sexual development." Molecular and Biochemical Parasitology 20(2): 173-182.
[24] Ponzi, M., C. J. Janse, et al. (1990). "Generation of chromosome size polymorphism during in vivo mitotic multiplication of Plasmodium berghei involves both loss and addition of subtelomeric repeat sequences." Molecular and Biochemical Parasitology 41(1): 73-82.
[25] Tuteja, R., A. Ansari, et al. (2011). "Emerging functions of transcription factors in malaria parasite." J Biomed Biotechnol 2011: 461979.
[26] van Noort, V. and M. A. Huynen (2006). "Combinatorial gene regulation in Plasmodium falciparum." Trends Genet 22(2): 73-78.
[27] Balaji, S., M. M. Babu, et al. (2005). "Discovery of the principal specific transcription factors of Apicomplexa and their implication for the evolution of the AP2-integrase DNA binding domains." Nucleic Acids Res 33(13): 3994-4006.
[28] Painter, H. J., T. L. Campbell, et al. (2011). "The Apicomplexan AP2 family: integral factors regulating Plasmodium development." Mol Biochem Parasitol 176(1): 1-7.
[29] Yuda, M., S. Iwanaga, et al. (2009). "Identification of a transcription factor in the mosquito-invasive stage of malaria parasites." Mol Microbiol 71(6): 1402-1414.
[30] Bozdech, Z., M. Llinás, et al. (2003). "The Transcriptome of the Intraerythrocytic Developmental Cycle of Plasmodium falciparum.” PLoS Biology 1 (1): e5.
[31] Khan, S. M., B. Franke-Fayard, et al. (2005). "Proteome Analysis of Separated Male and Female Gametocytes Reveals Novel Sex-Specific Plasmodium Biology." Cell 121(5): 675-687.
[32] Paton, M. G., G. C. Barker, et al. (1993). "Structure and expression of a post-transcriptionally regulated malaria gene encoding a surface protein from the sexual stages of Plasmodium berghei." Mol Biochem Parasitol 59(2): 263-275.
42
[33] Le Roch, K. G., Y. Zhou, et al. (2003). "Discovery of gene function by expression profiling of the malaria parasite life cycle." Science 301(5639): 1503-1508.
[34] Mair, G. R., E. Lasonder, et al. (2010). "Universal Features of Post-Transcriptional Gene Regulation Are Critical for Plasmodium Zygote Development." PLoS Pathog 6(2): e1000767.
[35] Braks, J. A. M., G. R. Mair, et al. (2008). "A conserved U-rich RNA region implicated in regulation of translation in Plasmodium female gametocytes." Nucleic Acids Research 36(4): 1176-1186.
[36] Mair, G. R., J. A. M. Braks, et al. (2006). "Regulation of Sexual Development of Plasmodium by Translational Repression." Science 313(5787): 667-669.
[37] Tarique, M., M. Ahmad, et al. (2013). "Plasmodium falciparum DOZI, an RNA helicase interacts with eIF4E." Gene 522(1): 46-59.
[38] Zhang, B., M. Gallegos, et al. (1997). "A conserved RNA-binding protein that regulates sexual fates in the C. elegans hermaphrodite germ line." Nature 390(6659): 477-484.
[39] Zamore, P. D., J. R. Williamson, et al. (1997). "The Pumilio protein binds RNA through a conserved domain that defines a new class of RNA-binding proteins." RNA 3(12): 1421-1433.
[40] Wickens, M., D. S. Bernstein, et al. (2002). "A PUF family portrait: 3′UTR regulation as a way of life." Trends in Genetics 18(3): 150-157.
[41] Quenault, T., T. Lithgow, et al. (2011). "PUF proteins: repression, activation and mRNA localization." Trends in Cell Biology 21(2): 104-112.
[42] Miller, M. A. and W. M. Olivas (2011). "Roles of Puf proteins in mRNA degradation and translation." Wiley Interdiscip Rev RNA 2(4): 471-492.
[43] Spassov, D. S. and R. Jurecic (2003). "The PUF family of RNA-binding proteins: does evolutionarily conserved structure equal conserved function?" IUBMB Life 55(7): 359-366.
[44] Goldstrohm, A. C., B. A. Hook, et al. (2006). "PUF proteins bind Pop2p to regulate messenger RNAs." Nat Struct Mol Biol 13(6): 533-539.
[45] Gerber, A. P., D. Herschlag, et al. (2004). "Extensive association of functionally and cytotopically related mRNAs with Puf family RNA-binding proteins in yeast." PLoS Biol 2(3): E79.
[46] Miao, J., J. Li, et al. (2010). "The Puf-family RNA-binding protein PfPuf2 regulates sexual development and sex differentiation in the malaria parasite Plasmodium falciparum." J Cell Sci 123(Pt 7): 1039-1049.
[47] Gomes-Santos, C. S. S., J. Braks, et al. (2011). "Transition of Plasmodium Sporozoites into Liver Stage-Like Forms Is Regulated by the RNA Binding Protein Pumilio." PLoS Pathog 7(5): e1002046.
[48] Müller, K., K. Matuschewski, et al. (2011). "The Puf-Family RNA-Binding Protein Puf2 Controls Sporozoite Conversion to Liver Stages in the Malaria Parasite." PLoS ONE 6(5): e19860.
[49] Lindner, S. E., S. A. Mikolajczak, et al. (2013). "Perturbations of Plasmodium Puf2 expression and RNA-seq of Puf2-deficient sporozoites reveal a critical role in maintaining RNA homeostasis and parasite transmissibility." Cell Microbiol 15(7): 1266-1283.
[50] Frenal, K., C. L. Tay, et al. (2013). "Global analysis of apicomplexan protein s-acyl transferases reveals an enzyme essential for invasion." Traffic 14(8): 895-911.
[51] Beetsma, A. L., T. J. van de Wiel, et al. (1998). "Plasmodium berghei ANKA: purification of large numbers of infectious gametocytes." Exp Parasitol 88(1): 69-72.
[52] Alano, P. (2007). "Plasmodium falciparum gametocytes: still many secrets of a hidden life." Molecular Microbiology 66(2): 291-302.
[53] Carter, V., S. Shimizu, et al. (2008). "PbSR is synthesized in macrogametocytes and involved in formation of the malaria crystalloids." Mol Microbiol 68(6): 1560-1569.
[54] Thathy, V., H. Fujioka, et al. (2002). "Levels of circumsporozoite protein in the Plasmodium oocyst determine sporozoite morphology." EMBO J 21(7): 1586-1596.
[55] Menard, R., A. A. Sultan, et al. (1997). "Circumsporozoite protein is required for development of malaria sporozoites in mosquitoes." Nature 385(6614): 336-340.
43
[56] Zhang, M., B. R. Joyce, et al. (2013). "Translational Control in Plasmodium and Toxoplasma Parasites." Eukaryotic Cell 12(2): 161-167.
[57] Tomas, A. M., G. Margos, et al. (2001). "P25 and P28 proteins of the malaria ookinete surface have multiple and partially redundant functions." EMBO J 20(15): 3975-3983.
[58] Dinglasan, R. R. and M. Jacobs-Lorena (2008). "Flipping the paradigm on malaria transmission-blocking vaccines." Trends Parasitol 24(8): 364-370.
[59] Saxena, A. K., Y. Wu, et al. (2007). "Plasmodium p25 and p28 surface proteins: potential transmission-blocking vaccines." Eukaryot Cell 6(8): 1260-1265. [60] Li, F., T. J. Templeton, et al. (2004). "Plasmodium Ookinete-secreted Proteins Secreted through a Common Micronemal Pathway Are Targets of Blocking Malaria Transmission." Journal of Biological Chemistry 279(25): 26635-26644.
[61] Kariu, T., T. Ishino, et al. (2006). "CelTOS, a novel malarial protein that mediates transmission to mosquito and vertebrate hosts." Mol Microbiol 59(5): 1369-1379.
[62] Li, F., K. P. Patra, et al. (2010). "Apical surface expression of aspartic protease Plasmepsin 4, a potential transmission-blocking target of the plasmodium ookinete." J Biol Chem 285(11): 8076-8083.
[63] Dessens, J. T., S. Saeed, et al. (2011). "Malaria crystalloids: specialized structures for parasite transmission?" Trends Parasitol 27(3): 106-110.
[64] Raine, J. D., A. Ecker, et al. (2007). "Female inheritance of malarial lap genes is essential for mosquito transmission." PLoS Pathog 3(3): e30.
[65] Singh, N., P. Preiser, et al. (2004). "Conservation and developmental control of alternative splicing in maebl among malaria parasites." J Mol Biol 343(3): 589-599.
[66] Corvi, M. M., A. M. Alonso, et al. (2012). "Protein palmitoylation and pathogenesis in apicomplexan parasites." J Biomed Biotechnol 2012: 483969.
[67] Seydel, K. B., D. Gaur, et al. (2005). "Plasmodium falciparum: characterization of a late asexual stage golgi protein containing both ankyrin and DHHC domains." Exp Parasitol 110(4): 389-393.
[68] Rees-Channer, R. R., S. R. Martin, et al. (2006). "Dual acylation of the 45 kDa gliding-associated protein (GAP45) in Plasmodium falciparum merozoites." Mol Biochem Parasitol 149(1): 113-116.
[69] Jones, M. L., M. O. Collins, et al. (2012). "Analysis of protein palmitoylation reveals a pervasive role in Plasmodium development and pathogenesis." Cell Host Microbe 12(2): 246-258.
[70] Yoshida, N., Nussenzweig, R.S., Potocnjak, P.,Nussenzweig, V., and Aikawa, M. (1980) Hybridoma produces protective antibodies directed against the sporozoite stage of malaria parasites. Science 207: 71–73.
[71] Tsuji, M., Mattei, D., Nussenzweig, R.S., Eichinger, D., and Zavala, F. (1994) Demonstration of heat-shock protein 70 in the sporozoite stage of malaria parasites. Parasitol Res 80: 16–21.
44
6 – Appendix I: General products and kits
Table S1. Composition of buffers and solutions used.
Solution Composition
TAE Buffer 40 mM Tris base; 20 mM acetic acid; 1 mM EDTA; pH 8,0
Running Buffer 0,025 M Tris base; 0,19 M glycine; 0,1% SDS; pH 8,3
Transfer Buffer 0,025 M Tris base; 0,19 M glycine; 20% absolute methanol; pH 8,3
NET-2 Buffer 150 mM NaCl; 50 mM Tris pH 7,4; 0,5% NP40 (IGEPAL CA 630)
NET-2++ Buffer NET-2 Buffer; 2 mM DTT; 1 tablet protease inhibitor ROCHE; RNase Out (2 U/µl; Promega)
RBC Lysis Buffer 1,5 M NH4Cl; 0,1 M KHCO3; 0,01 M EDTA.Na2; pH 7,4
Enriched PBS 1X PBS; 0,1% BSA pH8,4; 10 mM Glucose
Table S2. Molecular Biology Kits used and their origin.
Purpose Kit Origin
Gel extraction PureLink™ Quick Gel Extraction Kit Invitrogen
PCR products purification GeneJET™ PCR Purification Kit Fermentas
Plasmid DNA extraction PureLink™ HiPure Plasmid Filter Midiprep Kit Invitrogen
Plasmid DNA extraction PureLink™ Quick Plasmid Miniprep Kit Invitrogen
Genomic DNA Extraction GenElute™ Mammalian Genomic DNA Miniprep Kit
Sigma-Aldrich (St. Louis, Missouri, USA)
Cloning of PCR products CloneJET PCR Cloning Kit Thermo Scientific
Table S3. Western Blot analysis components used and origin.
Purpose Component Origin
Protein ladder Page Ruler™ Plus Prestained Protein Ladder Thermo Scientific
Protein ladder Precision Plus Protein™ Dual Xtra Standards BioRad
Electrophoretic running system Mini PROTEAN® Tetra Cell BioRad
Electrophoretic transfer system Mini Trans-Blot® Cell BioRad
Running gel Mini-PROTEAN® TGX™ Gels Any-kD™, 10 well-comb, 30 µL
BioRad
Table S4. List of the antibodies used, indicating their origin, the initial concentration and dilution used.
Antibody Origin Initial Concentration/Dilution used
Anti-GFP, rabbit IgG fraction (A11122) Invitrogen 2mg/ml ; 1:500
Rabbit anti-GFP, N-terminal Sigma-Aldrich (St. Louis, Missouri, USA)
1,0 mg/ml ; 1:500
Mouse IgG1к Anti-GFP Stabilized antibody preparation
Roche ---------;1:5000
Goat Anti-Mouse IgG-HRP: sc 2005 Santa Cruz Biotechnology Inc. ---------;1:5000-1:20000
Peroxidase-conjugated AffiniPure Donkey Anti-Rabbit IgG (H+L)
Jackson ImmunoResearch Laboratories, Inc. (West Grove, PA)
0,8 mg/ml ; 1:500
Monoclonal Anti-c-myc Antibody Sigma-Aldrich (St. Louis, Missouri, USA)
2 mg/ml; 0,02 mg/ml
Mouse anti-CSP 3D11 [70] ----------;10µg/µl(conc.IFAs); 1:9000-1:18000 (WB)
Parasite specific mouse monoclonal anti-PbHsp70 2E6
[71] ----------;1:1000
Rabbit polyclonal anti-GFP #ab6556 Abcam® ----------;1:100-1:500
Goat anti-rabbit IgG-Alexa Fluor® 488 Jackson ImmunoResearch Laboratories, Inc. (West Grove, PA)
----------;1:400-1:500
Goat anti-mouse IgG-Cy™3 Jackson ImmunoResearch Laboratories, Inc. (West Grove, PA)
----------1:400-1:500
7 – Appendix II: Protocols
7.1. TRIzol Plasmodium RNA preparation. TRIzol® (Reagent for RNA from Ambion®) was
added to the different samples in a proportion of 10 volumes of sample pellet size followed
by sample solubilization by vigorous shaking. Chlorophorm was added (0,2 times the original
TRIzol volume) and tubes centrifuged for 30 minutes at maximum speed and 4°C. New tubes
were used to collect the aqueous layer, without disturbing the interface, and isopropanol (0,5
times the original TRIzol volume) was added in order to precipitate the nucleic acids.
Samples were then incubated overnight at 4°C. On the following day, Glycogen (for
45
molecular biology, Roche) was added to the samples and then centrifuged for 30 minutes at
maximum speed and 4°C. The supernatant was carefully removed and the pellet was
washed with 75% RNase free ethanol, centrifuging for 30 minutes at maximum speed and
4°C. The pellets were left to dry and resuspended in 51µL in MiliQ (Millipore®) RNAse free
water, then subjected to DNAse treatment using 3µL DNase I Amplification Grade 1U/µL
(Invitrogen) and 6µL 10x DNase I Reaction Buffer (Invitrogen) and incubated for 30 minutes
at 37°C. Reaction was stopped using 6µL 25 mM EDTA RNase free (Invitrogen) and heat
inactivation, during 10 minutes at 65°C. RNA precipitation was performed using MiliQ
(Millipore®) RNase free water (34µL), 3 mM RNAse free NaOAc pH5,2 (10µL) and 96%
RNase free ethanol (250µL). The samples were stored at -80°C, for at least 1 hour. Glycogen
(for molecular biology, Roche) was added to the samples, and then centrifuged for 30
minutes at maximum speed. The obtained pellet was resuspended in 25µl MiliQ (Millipore®)
RNase free water.
7.2. First strand cDNA synthesis with Super Script II. 10 µL of pure RNAs were used as a
RT+ and 10 µL as a RT-. 1µl of 50 µM Anchored-oligo(dT)18 Primer (Roche) and 1 µl of 3µg/µl
Random Primer (Invitrogen) were added followed by a incubation of 10 minutes at 70°C. On
ice the following reagents were added: 4µL of 5X First Strand Buffer (Invitrogen), 2µL 0,1M
DTT (Invitrogen), 1µL 40U RNase Out (Invitrogen), 1µL 10 mM dNTP Mix (Invitrogen) and
finally, 0,5µL of 200U/µL Super Script™ Reverse Transcriptase (Invitrogen) was added only
to the RT+. Incubation for 1 hour at 42°C was done followed by an activation step of 15
minutes at 70°C. Then 1 µL of RNase H 5000U/ml (Bio Labs) and 2µL of 10X RNase H
Reaction Buffer (Bio Labs) were added followed by a 20-minute incubation at 37°C. Samples
were stored at -20°C.
7.3. PCR mix. If not stated otherwise, PCR mix was done as the following: 2,5µL 10X Taq
Buffer with 500 mM KCl (Thermo Scientific), 2µL 25 mM MgCl2 (Thermo Sientific), 0,5µL
dNTPs, 0,25µL 10 µM Fwd primer, 0,25µL 10µM Rev primer, 0,125µL Taq DNA Polymerase
5 U/µl (Thermo Scientific), 1µL of 10 ng/µL genomic DNA or, in the case of a RT-PCR, 2 µl of
a cDNA dilution. Final reaction volume was 25µL.
8 – Appendix III: Primers and PCR Tables
Table S1. Primers used in the puf2::gfp sequencing protocol. Forward abbreviated as Fwd and Reverse as Rev.
Primer Sequence (5’-3’) target Fwd/Rev
g0432 AACATTCACTCCATTCTTCC
trap Fwd
g0433
CATGTTATTCCAATGCTCAC trap Rev
g0459 AGCTGTTACAAACTCAAGAAGGACC gfp Rev
g0477 GTTGACGACATTCCTGAGG puf2 Fwd
46
Table S2. Primers used for genotyping and RT-PCRs dhhc2::gfp, dhhc10::gfp, ∆dhhc10, ipet::gfp, ∆epsf, epsf::gfp parasite lines. The
lowercase letters represent sequence with no homology to template DNA, whereas homologous regions are shown in uppercase. Forward
abbreviated as Fwd and Reverse as Rev.
Primer Sequence (5’-3’) Target Fwd/Rev
g0084 aaagaattcTGATGGTTTACAATCACC RNA polymerase II Fwd
g0085 aaagcggccgctTTCTTCCTGCATCTCCTC RNA polymerase II Rev
g0115 TTCGATATCATGAATTTTAAATACAG PBANKA_051490 (p28) Fwd
g0116 TCCgcggccgcGCATTACTATCACGTAAATAAC PBANKA_051490 (p28) Rev
g0408 GTATGTTGCATCACCTTC gfp Rev
g0628 aaagaattcCATATATTAGAGTATTG epsf Fwd
g0629 aaagcggccgcAATTTGCCTTTTGTGCATC epsf Rev
g0641 aaagaattcAAAACTGTTTTAAAGATG dhhc10 Fwd
g0642 aaagcggccgcATAATGTTTTATAAAATAGCC dhhc10 Rev
g0952 GATTCATAAATAGTTGGACTTG KO and GFP-tagging vector backbone Fwd
g0964 AACGAATTTGACTTGCATTC dhhc10 5' flanking region Fwd
g0965 GGTATGAACTCATACATGTC dhhc10 3’ flanking region Rev
g0968 TACATTGAAGTGTTGGTATG epsf 5’ flanking region Fwd
g0969 TGCATGCACATATATGTCAC epsf 3’ flanking region Rev
g1019 ATGCATAAACCGGTGTGTC tgdhfr/ts Fwd
g1020 AGCTTCTGTATTTCCGC tgdhfr/ts Rev
g1021 ATTGTTGACCTGCAGGCATG KO vector backbone Rev
g1196 AAAAGAGAAAAAATGGTG ipet 5’ flanking region Fwd
g1197 GCCTTATGGAATTAGTGC epsf 5’ flanking region Fwd
g1199 ATTTTTGGGGGTTTTCAG dhhc10 Fwd
g1200 GTTTTCAACACAAGTGTG dhhc10 3’ flanking region Rev
g1201 GTAAAAAAGGCATTATAG Ipet Rev
g1203 GTATTAATGCATGACTTG epsf 3' flanking region Rev
g1204 ATACAAACCAGACAGATC dhhc10 Fwd
g1205 AAGTTCCTTACGTATTAG epsf Fwd
g1258 ACACATAAATATATGCAG dhhc2 5' flanking region Fwd
g1259 ATGACATATTATAAACTC dhhc2 3’ flanking region Rev
g1261 AATATATGCAGATATCAC dhhc2 Fwd
g1262 AAAAAAATATACTTGTGC dhhc2 Rev
Table S3. PCR conditions used for genotyping and RT-PCR of ∆dhhc10, ∆epsf, dhhc2::gfp, dhhc10::gfp, ipet::gfp and epsf::gfp parasite lines. 5’ integration and 3’ integration abbreviated as 5’ int and 3’ int, respectively, RNA polymerase abbreviated as RNA pol II and annealing temperature as Ta.
Genotyping
RT-PCRs
5’int 3’int WT gene tgdhfr/ts RNA pol II
WT mRNA
GFP-tagged mRNA
p28 RNA pol II
dhhc2::gfp
Primers g1258/0g408c
g0952/g1259c
g1258/g1259c
g1019/g1020c
g0084/g0085c
g1261/g1262c
g1258/0g408c
g0115/g0116c
g0084/g0085c
Ta 40°C 43°C 43°C 40°C 43°C 43°C 53°C 43°C 44°C
Extension time
1min30s 1min27s 1min27s 1min30s 1min27s 58s 1min5s 1min5s 1min5s
Nr. cycles 45 45 45 45 45 45 40 45 45
dhhc10::gfp Primers g1199/ g0408c
g0952/g1200c
g1199/g1200c
g1019/g1020c
g0084/g0085c
g1204/g1200c
g1204/g0408c
g0115/g0116c
g0084/g0085c
Ta 45°C 45°C 47°C 40°C 40°C 45°C 45°C 40°C 40°C
Extension time
1min27s 1min27s 1min20s 2min 1min6s 1min5s 1min5s 1min22s 1min22s
Nr. cycles 45 45 45 35 35 45 45 35 35
∆dhhc10 Primers g0964/g1021c
g0952/g0965c
g0642/g0642c
g1019/g1020c
g0084/g0085c
g0641/g0642c
----------- g0115/g0116c
g0084/g0085c
Ta 40°C 40°C 50°C 40°C 40°C 43°C ----------- 43°C 43°C
Extension time
1min52s 1min52s 1min30s 1min52s 1min52s 1min6s ----------- 1min6s 1min6s
Nr. cycles 45 45 35 45 45 45 ----------- 45 45
ipet::gfp
Primers g1196/g0408c
g0952/g1201c
g1196/g1201c
g1019/g1020c
g0084/g0085c
g1196/g1201c
g1196/g0498c
g0115/g0116c
g0084/g0085c
Ta 45° C 45°C 50°C 40°C 40°C 50°C 50°C 40°C 40°C
Extension time
1min32s 1min32s 1min30s 2min 1min5s 45s 1min5s 1min22s 1min22s
Nr. cycles 45 45 45 35 35 45 45 35 35
47
epsf::gfp Primers g1197/ g0408c
g0952/g1203c
g1197/g1203c
g1019/g1020c
g0084/g0085c
g1205/g1203c
g1205/g0408c
g0115/g0116c
g0084/g0085c
Ta 48°C 46,2°C 48°C 40°C 43°C 46°C 46°C 43°C 43°C
Extension time
1min20s 1min18s 1min11s 1min56s 1min5s 45s 45s 1min5s 1min5s
Nr. cycles 45 45 45 45 45 45 45 45 45
∆epsf
Primers g0968/g1021c
g0952/g0969c
g0628/g0629c
g1019/g1020c
g0084/g0085c
g0628/g0629c
----------- g0115/g0116c
g0084/g0085c
Ta 40°C 40°C 48°C 40°C 48°C 43°C ----------- 43°C 43°C
Extension time
1min56s 1min56s 1min11s 1min56s 1min11s 1min5s ----------- 1min5s 1min5s
Nr. cycles 45 45 45 45 45 45 ----------- 45 45
Table S4. Summary of the PCR conditions used for the Life Cycle RT-PCRs for dhhc2, dhhc10, epsf and ipet cDNAs and the necessary
controls. Annealing temperature abbreviated as Ta.
Primers Ta Extension time Nr. Cycles
dhhc2 g0646/g0644c 43°C 54s 45
dhhc10 g0641/g0642c 43°C 33s 45
p25 g0385/g0476c 43°C 45s 45
p28 g0115/g0116c 43°C 45s 45
Dozi g0546/g0548c 43°C 45s 45
18S 33/34 60°C 10s 45
hsp70 g0258/g0259c 43°C 14s 45
Epsf g0628/g0629c 43°C 33s 45
Ipet g0623/g0624c 43°C 33s 45
uis4 g1370/g1371c 60°C 17s 45
9 – Appendix IV: Supplementary Figures and Tables
Table S1. Designation, predicted characteristics and mutant parasite lines for the genes studied.
Designation P. berghei ID
P. falciparum closest homologue
Predicted function Signal peptide
TMDs Molecular weight
Exons GFP-tagged line
KO line
dhhc2
PBANKA_010830
PF3D7_0609800 DHHC-type zinc finger protein, palmitoyltransferase putative
Not present
4 33,198 kDa 4 PbA2185cl1m1
------------
dhhc10 PBANKA_051200
PF3D7_1027900 DHHC-type zinc finger protein, palmitoyltransferase putative
present 4 32,862 kDa 11 PbA2187cl1m1
PbA2097cl1
ipet
PBANKA_060580
PF3D7_1207300 Unknown function present 1 13,128 kDa 6 PbA2180cl1m4
------------
epsf
PBANKA_072090
PF3D7_0418800 Unknown function present 2 30,289 kDa 9 PbA2182cl2m2
PbA2099cl1m7
*information adapted from plasmodb.org and genedb.org
Fig. S1 – ∆dhhc10 parasite
line diagnostic PCR and RT-PCR
analysis. The dhhc10 gene deletion
construct was obtained by
cloning dhhc10 5´ and 3´ targeting
regions upstream and downstream
of the Toxoplasma gondii dhfr/ts selecta
ble marker, respectively. The construct
was integrated into the dhhc10 locus of
PbA820cl1m1cl1 by double homologous
recombination, resulting in the complete
deletion of dhhc10 ORF in ∆dhhc10
parasites. A. Genomic integration of the
construct, as well as absence of dhhc10 ORF and presence of tgdhfr/ts was confirmed by PCR after cloning of ∆dhhc10 parasites (PbA2097cl1).
B. Absence of dhhc10 mRNA was confirmed in ∆dhhc10 mixed blood stages by RT-PCR. p28 and RNA polimerase II serve as control genes
48
Fig. S2 – ∆epsf parasite line
diagnostic PCR and RT-PCR
analysis. The epsf gene deletion
construct was obtained by cloning
epsf 5´ and 3´ targeting regions
upstream and downstream of
Toxoplasma gondii dhfr/ts selectable
marker, respectively. The construct
was integrated into the epsf locus of
PbA820cl1m1cl1 by double
homologous recombination, resulting
in the complete deletion of epsf ORF
in ∆epsf parasites. A. Genomic
integration of the construct, as well as
absence of epsf ORF and presence
of tgdhfr/ts was confirmed by PCR
after cloning of ∆epsf parasites (PbA2099cl1m7). B. Absence of epsf mRNA was confirmed in ∆epsf mixed blood stages by RT-PCR. p28 and
RNA polimerase II serve as control genes.
Fig. 3 – dhhc2::gfp parasite line
diagnostic PCR and RT-PCR
analysis. dhhc2 GFP tagging
construct was obtained by cloning the
last ~1000 bp of dhhc2 ORF excluding
the stop codon upstream and in frame
with gfp gene. This construct includes
Toxoplasma gondii dhfr/ts selectable
marker. The construct was integrated
into the dhhc2 locus of PbAcl15cy1 by
single homologous recombination,
resulting in the fusion
of dhhc2 to gfp in dhhc2::gfp
parasites. A. Genomic integration of
the construct, as well as absence of WT dhhc2 ORF and presence of tgdhfr/ts was confirmed by PCR after cloning of dhhc2::gfp parasites
(PbA2185cl1m1). B. Absence of WT dhhc2 mRNA and presence of dhhc2::gfp mRNA was confirmed in dhhc2::gfp mixed blood stages by RT-
PCR. p28 and RNA polimerase II serve as control genes.
Fig. 4 – dhhc10::gfp parasite line
diagnostic PCR and RT-PCR analysis.
dhhc10 GFP tagging construct was
obtained by cloning the last ~1000 bp of
dhhc10 ORF excluding the
stop codon upstream and in frame
with gfp gene. This construct includes
Toxoplasma gondii dhfr/ts selectable
marker. The construct was integrated
into the dhhc10 locus of PbAcl15cy1 by
single homologous recombination,
resulting in the fusion
of dhhc10 to gfp in dhhc10::gfp
parasites. A. Genomic integration of the
construct, as well as absence of WT
dhhc10 ORF and presence of tgdhfr/ts
was confirmed by PCR after cloning of dhhc10::gfp parasites (PbA2187cl1m1). B. Absence of WT dhhc10 mRNA and presence of dhhc10::gfp
mRNA was confirmed in dhhc10::gfp mixed blood stages by RT-PCR. p28 and RNA polimerase II serve as control genes
49
Fig. 5 – ipet::gfp parasite line
diagnostic PCR and RT-PCR analysis.
ipet GFP tagging construct was obtained
by cloning the last ~1000 bp of ipet ORF
excluding the stop codon upstream and in
frame with gfp gene. This construct
includes Toxoplasma gondii dhfr/ts
selectable marker. The construct was
integrated into the ipet locus of
PbAcl15cy1 by single homologous
recombination, resulting in the fusion
of ipet to gfp in ipet::gfp parasites. A.
Genomic integration of the construct, as
well as absence of WT ipet ORF and
presence of tgdhfr/ts was confirmed by PCR after cloning of ipet::gfp parasites (PbA2180cl1m4). B. Absence of WT ipet mRNA and presence of
ipet::gfp mRNA was confirmed in ipet::gfp mixed blood stages by RT-PCR. p28 and RNA polimerase II serve as control genes.
Fig. 6 – epsf::gfp parasite line
diagnostic PCR and RT-PCR analysis.
epsf GFP tagging construct was
obtained by cloning the last ~1000 bp of
epsf ORF excluding the
stop codon upstream and in frame
with gfp gene. This construct includes
Toxoplasma gondii dhfr/ts selectable
marker. The construct was integrated
into the epsf locus of PbAcl15cy1 by
single homologous recombination,
resulting in the fusion
of epsf to gfp in epsf::gfp parasites. A.
Genomic integration of the construct, as
well as absence of WT epsf ORF and presence of tgdhfr/ts was confirmed by PCR after cloning of epsf::gfp parasites (PbA2182cl2m2). B.
Absence of WT epsf mRNA and presence of epsf::gfp mRNA was confirmed in epsf::gfp mixed blood stages by RT-PCR. p28 and RNA
polimerase II serve as control genes.