Exonuclease EhRrp6 in growth stress
1
Stress-induced nuclear depletion of Entamoeba histolytica 3′-5′exoribonuclease EhRrp6 and its role
in growth and erythrophagocytosis
Shashi Shekhar Singh1, Sarah Naiyer1, Ravi Bharadwaj3, Amarjeet Kumar2, Yatendra Pratap
Singh1, Ashwini Kumar Ray1, Naidu Subbarao2, Alok Bhattacharya3, Sudha Bhattacharya1*
From the 1School of Environmental Sciences, Jawaharlal Nehru University, New Delhi, 110067, India; 2School of Computational & Integrative Sciences, Jawaharlal Nehru University, 110067, India; 3School of
Life Sciences, Jawaharlal Nehru University, New Delhi, 110067, India
Running Title: Exonuclease EhRrp6 in growth stress
*To whom correspondence should be addressed: Sudha Bhattacharya: School of Environmental Sciences,
Jawaharlal Nehru University, New Delhi 110067, India; [email protected]; Office: +91 11 26704308,
Cell: (0) 9818476740.
Keywords: Entamoeba histolytica, EhRrp6, Serum stress, Exosome complex, 5′-ETS, Exonuclease,
precursor ribosomal RNA (pre-rRNA), Phagocytosis, amoebiasis, amoebic dysentery
http://www.jbc.org/cgi/doi/10.1074/jbc.RA118.004632The latest version is at JBC Papers in Press. Published on August 31, 2018 as Manuscript RA118.004632
by guest on June 12, 2020http://w
ww
.jbc.org/D
ownloaded from
by guest on June 12, 2020
http://ww
w.jbc.org/
Dow
nloaded from
by guest on June 12, 2020http://w
ww
.jbc.org/D
ownloaded from
Exonuclease EhRrp6 in growth stress
2
ABSTRACT
The 3′-5′ exoribonuclease Rrp6 is a key enzyme in
RNA homeostasis involved in processing and
degradation of many stable RNA precursors,
aberrant transcripts, and noncoding RNAs. We
previously have shown that in the protozoan
parasite Entamoeba histolytica, the 5′-external
transcribed spacer fragment of pre-rRNA
accumulates under serum starvation–induced
growth stress. This fragment is a known target of
degradation by Rrp6. Here, we computationally
and biochemically characterized EhRrp6 and
found that it contains the catalytically important
EXO and HRDC domains and exhibits
exoribonuclease activity with both unstructured
and structured RNA substrates, which required the
conserved DEDD-Y catalytic-site residues. It
lacked the N-terminal PMC2NT domain for
binding of the cofactor Rrp47, but could
functionally complement the growth defect of a
yeast rrp6 mutant. Of note, no Rrp47 homologue
was detected in E. histolytica. Immunolocalization
studies revealed that EhRrp6 is present both in the
nucleus and cytosol of normal E. histolytica cells.
However, growth stress induced its complete loss
from the nuclei, reversed by proteasome inhibitors.
EhRrp6-depleted E. histolytica cells were severely
growth restricted, and EhRrp6 overexpression
protected the cells against stress, suggesting that
EhRrp6 functions as a stress sensor. Importantly
EhRrp6 depletion reduced erythrophagocytosis, an
important virulence determinant of E. histolytica.
This reduction was due to a specific decrease in
transcript levels of some phagocytosis-related
genes (EhCaBP3 and EhRho1), whereas
expression of other genes (EhCaBP1, EhCaBP6,
EhC2PK, and EhARP2/3) was unaffected. This is
the first report of the role of Rrp6 in cell growth
and stress responses in a protozoan parasite.
INTRODUCTION
Ribosomal RNA genes in eukaryotes are generally
transcribed as precursor molecules (pre-rRNAs)
that carry the mature sequences of 18S, 5.8S, and
28S rRNAs interspersed with external and internal
transcribed spacers (ETS and ITS respectively).
The spacers are removed from the pre-rRNA and
degraded, while the mature rRNA species along
with ribosomal proteins assemble into the
ribosomal subunits (1). Since the transcription rate
of pre-rRNA is very high, rapid turnover of
aberrant pre-rRNAs and excised spacer regions is
important to maintain intracellular nucleotide
levels. The nuclear exosome has a role in various
steps of pre-rRNA processing, including
generation of 3′-end of 5.8S rRNA and
degradation of the excised 5′-ETS fragment (2-4).
The removal of 5′-ETS requires endonucleolytic
cleavages in Saccharomyces cerevisiae (5), and in
metazoans (6), following which the 5′-ETS sub
fragments are further degraded by cooperative
action of exonucleases and helicases (6). The
involvement of the nuclear exosome and
associated 3′-5′ exonuclease Rrp6 in degradation
of excised 5′-ETS has been well documented in S.
cerevisiae (2,7-9), Arabidopsis thaliana (10-12)
and mammals (13).
The exosome is a multi-subunit protein complex
which is highly conserved across eukaryotes
(14,15). It has important roles in RNA
homeostasis and is involved in RNA turnover (16),
and surveillance pathways (17), for a variety of
RNAs both in the nucleus and cytoplasm (18-
21).The core exosome is composed of nine
subunits (Exo9) that lack catalytic activity. The
core has a barrel-shaped structure with a central
channel for ssRNA to pass through. In S.
cerevisiae the Exo9 interacts in the cytoplasm with
Dis3 (or Rrp44), an enzyme with
endoribonuclease and processive 3′-5′ exonuclease
activities to form Exo10Rrp44. In the nucleus,
Exo10Rrp44 associates with Rrp6 along with its
cofactor C1D (or Rrp47), to form
Exo11Rrp44/Rrp6. Rrp6 is a distributive 3′-5′
exonuclease. Rrp6 and Rrp44 bind to opposite
sides of the core exosome. It is believed that the
active sites of these enzymes are sequestered by
by guest on June 12, 2020http://w
ww
.jbc.org/D
ownloaded from
Exonuclease EhRrp6 in growth stress
3
the core exosome and are made available for
processing/ degradation of RNA that is threaded
through the Exo9 central channel (22,23). In yeast,
Rrp6 is found exclusively in the nuclear exosome,
whereas in human, it is concentrated in the
nucleoli and also found in nucleoplasmic and
cytoplasmic exosome (24). Though RRP6 is not
essential for viability, its deletion in S. cerevisiae
leads to temperature sensitivity, slow growth and
accumulation of 5′-ETS sequences (25).
RRP6 domain structure has been extensively
studied in yeast and human by crystal structure
analysis. The exonuclease (EXO) domain of yeast
and human RRP6, and that of bacterial RNase D
belongs to the DEDD superfamily (DEDD-Y
subfamily) of exonucleases that act by a hydrolytic
mechanism involving two divalent metal ions (26-
28). The EXO domain is flanked by a single C-
terminal helicase and RNase D C-terminal
(HRDC) domain (29). These two domains are
sufficient for catalytic activity in yeast (30).
However, both yeast and human RRP6 contain
additional domains. These include an N-terminal
PMC2NT domain that is needed for Rrp6 to bind
to its cofactor Rrp47 (a double-stranded RNA- and
DNA-binding protein) (31-34); a region C-
terminal to HRDC required for interaction with the
core exosome and with RNA (35); and a putative
NLS domain at the C terminus (28).
We have been studying the regulation of
ribosomal biogenesis in the primitive parasitic
protist, Entamoeba histolytica which causes
amoebiasis in humans. We have earlier shown that
transcription continued in E. histolytica cells
subjected to growth stress by serum starvation, but
pre-rRNA processing was inhibited, leading to
accumulation of unprocessed pre-rRNA and
partially processed fragments of the 5′-ETS (36).
The removal of 5′-ETS sub fragments in model
organisms is done by the 3′-5′ exonuclease activity
of Rrp6 (3,9,12). To investigate whether Rrp6
might be performing a similar function in a
primitive eukaryote like E. histolytica we
biochemically characterized EhRrp6. Here we
show that although EhRrp6 sequence differs from
the S. cerevisiae and human homologs as it has
large deletions at both the N- and C-termini, the
enzymatic properties of EhRrp6 are conserved,
and EhRRP6 could complement the growth defect
of Scrrp6 deletion mutant. EhRRP6 down-
regulation led to increase in levels of 5′-ETS sub
fragments. Further, we show that EhRrp6 is
essential for E. histolytica growth and acts as a
stress sensor. It is lost from the nuclei during
growth stress and is required to maintain the
transcript levels of key genes involved in
phagocytosis, a process important for E.
histolytica pathogenesis.
RESULTS
Identification of Exosome core subunits of E.
histolytica
The focus of this study is the characterization of
EhRrp6, which is implicated in 5′-ETS processing,
and is functionally associated with the core
exosome. We undertook a preliminary analysis to
computationally identify the exosome subunits of
E. histolytica. By performing a sequence
homology search we identified 8 of the 9 proteins
corresponding to the eukaryotic Exo9-core ring
and cap subunits in E. histolytica. These have also
been reported in an earlier study (37). For further
categorization, we performed a phylogeny
construction using the Exo9 protein sequences
from Homo sapiens, S. cerevisiae and
Trypanosoma brucei. As expected, the ring and
cap proteins clustered into two different groups
(supplemental Fig. S1), with the latter containing
three members; Rrp4, Rrp40 and Csl4. Of these
we could identify the E. histolytica homologs of
Rrp4 and Rrp40 (EHI_163510 and EHI_004770,
respectively), but the Csl4 homolog could not be
identified. This corroborates with the earlier study
(37). The remaining six E. histolytica proteins
grouped with the six eukaryotic ring subunits
(Rrp41, Rrp42, Rrp45, Rrp46, Rrp43, and Mtr3).
However, it was not possible to identify the
individual E. histolytica homologs for each of
these six subunits. Rather the sequences grouped
into two categories- Rrp41-like (EHI_040320 and
EHI_086520) and Rrp42-like (EHI_000580 and
EHI_188080). The remaining two sequences
(EHI_126330 and EHI_166910) also grouped in
the Rrp42-like category but with low confidence.
This was unlike the previous study where all six
had been classified as Rrp45-like (37). Our
analysis shows overall conservation of the core
exosome structure in E. histolytica; the major
difference being absence of Csl4 subunit.
by guest on June 12, 2020http://w
ww
.jbc.org/D
ownloaded from
Exonuclease EhRrp6 in growth stress
4
Comparative sequence and structure analysis
of EhRrp6
We looked for E. histolytica homologue of Rrp6
by NCBI-BLAST search performed against non-
redundant protein database of E. histolytica. Only
one protein (XP_650756) with Rrp6 like EXO
domain was found and it was referred to as
EhRrp6. EhRrp6 has a deduced size of 517 amino
acids and is encoded by a single copy gene
(EHI_021400) lacking any introns. Multiple
sequence alignment of EhRrp6 sequence with its
homologues from other organisms showed well-
conserved EXO and HRDC domains (Fig.1A).
Across its entire sequence EhRrp6 shared 30.5%
and 32.9% sequence identity with ScRrp6 and
HsRrp6 respectively. The EhRrp6 EXO domain
(183-373 amino acids) was of comparable length
to the EXO domains of ScRrp6 and HsRrp6, and
shared 50% and 51% sequence identity
respectively. The EhRrp6 HRDC domain (398-463
amino acids) was of comparable length to HRDC
domain of ScRrp6, while it was 15 amino acids
shorter than HRDC of HsRrp6 and the sequence
identity was 45% and 38% respectively. Unlike
Rrp6 homologues in other organisms we were
unable to find a conserved PMC2NT domain in
EhRrp6 (Fig. 1A). We also checked for the
presence of PMC2NT domain in E. histolytica as a
separate protein, or as part of some other protein
by taking the PMC2NT domain of HsRrp6,
ScRrp6 and TbRrp6 as query and searching the
database as described for EhRrp6 identification.
No significant hit was obtained. Phylogenetic
analysis using the amino acid sequence of
conserved domains (EXO and HRDC) of EhRrp6
showed that it was closer to the protein from lower
eukaryotes (Fig. 1B).
Amino acid sequence analysis showed that the
active site residues in the EXO domain, known to
play critical role in RNA degradation, were well
conserved in EhRrp6 (D212, E214, D270, Y335
and D339) (Fig. 2A). The structure of EhRrp6
(residues 183 to 463) containing the EXO and
HRDC domains was modelled through
comparative homology modelling (Fig. 2B). The
DOPE score (-33247.70), ProSA web Z score (-
7.49) and PROCHECK results (Ramachandran
plot; 93.6% and 6.4% residues in most favorable
and additional allowed region respectively)
suggested that the EhRrp6 modelled structure was
of good quality. Its overall structure was similar to
its homologs and had RMSD value of 0.531 Å,
0.763 Å and 0.714 Å over the aligned residues
with structures of Rrp6 from H. sapiens, S.
cerevisiae and T. brucei respectively (Fig. 2C).
Like Rrp6 of H. sapiens and T. brucei, the linker
of EhRrp6 was shorter (9 amino acids) than the
linker of S. cerevisiae (26 amino acids) (Fig. 2D).
The shorter linker has been suggested to make the
active site more accessible for both structured and
non-structured RNA substrates in H. sapiens and
T. brucei Rrp6 (38) suggesting a similar behaviour
for EhRrp6.
Further we performed MD simulation of 12 in
silico systems to determine the effect of absence of
Mg+2 ions or introduction of DEDD-Y mutations
on catalytic activity of EhRrp6 (Fig. 2E). In the
absence of Mg+2 ions, the structure of EhRrp6
deviated significantly from its native (modelled)
structure, suggesting that Mg+2 ions stabilize the
structure and are crucial for catalytic activity (data
not shown).
Enzymatic activity of EhRrp6
To assay for the exoribonuclease activity of
EhRrp6 we expressed the wild type protein in E.
coli (SHuffle), as a 6xHis fusion protein and
purified it by Ni-NTA affinity chromatography
and gel filtration. Mutants in the highly conserved
DEDD-Y active site residues were obtained to
determine their effect on enzyme activity. Two
double mutants (D212A, E214A; Y335A, D339A)
and a single mutant (D270A) were generated and
the recombinant proteins purified. The purity was
checked by SDS-PAGE electrophoresis
(supplemental Fig. S2). To assay for
exoribonuclease activity a 50 nt AU-rich RNA
substrate was used which lacked secondary
structure, since double-stranded regions could
potentially restrict enzyme activity (28). The
purified protein (0.1uM) was incubated with 5′-
radiolabeled AU-rich RNA (1uM). A time-course
assay was performed for the indicated time periods
(Fig. 3A). There was loss of full-length RNA
substrate with concomitant appearance of
progressively shorter molecules and final
accumulation of an end product <10 nt. This
pattern is very similar to that reported for the
distributive 3′-5′ exoribonuclease of yeast and
by guest on June 12, 2020http://w
ww
.jbc.org/D
ownloaded from
Exonuclease EhRrp6 in growth stress
5
human Rrp6 (28,39). The EhRrp6 mutants in the
conserved active site residues (mentioned above)
were assayed with the same substrate under the
same reaction conditions. None of the mutant
proteins showed any activity (Fig. 3B), confirming
the conserved role of these residues in the active
site of EhRrp6. Activity of the wild-type enzyme
was also checked with another RNA substrate
expected to have secondary structure. This was a
60 nt RNA modified from an E. histolytica
sequence (3′-end of EhSINE1) (40). The sequence
was predicted by RNA-fold to have a 30 nt 3′-
overhang followed by a stem-loop (Fig. 3C). This
RNA was treated with EhRrp6 under the
conditions described for the AU-rich RNA
substrate. Unlike the latter substrate which was
progressively degraded to shorter fragments, the
60-nt structured substrate showed accumulation of
a 30-nt intermediate, in addition to the <10 nt end-
product (Fig. 3C). This could be due to stalling of
EhRrp6 at the base of the stem-loop, as shown for
Rrp6 from yeast and human (28). To further
characterize the properties of EhRrp6 we
determined the conditions of temperature and pH
with the 50 nt AU-rich RNA substrate and found
maximal activity at 37°C, pH 8.0 (Fig. 3D, E). The
requirement for Mg2+ was absolute as no activity
was found in the absence of Mg2+ or in the
presence of EDTA (Fig. 3F). The nuclease activity
of EhRrp6 was specific to RNA as no activity was
observed with either ss- or ds-DNA substrates
(Fig. 3G).
EhRRP6 complements the growth defect of
rrp6∆ yeast strain
To determine whether EhRRP6 could functionally
complement the S. cerevisiae rrp6 mutant, we
expressed EhRRP6 in temperature-sensitive rrp6∆
yeast strain (3). This strain grows normally at
30°C but is severely growth restricted at 37°C.
Successful transformation of yeast cells with the
wt and mutant EhRRP6 was confirmed by PCR
with EhRRP6-specific primers and expression of
EhRrp6 was confirmed by western analysis
(supplemental Fig. S3). Cells transformed with
EhRRP6 grew normally at both 30°C and 37°C,
while those transformed with the EhRRP6
catalytic domain double mutant (D212A, E214A),
or with vector alone were unable to grow at the
non-permissive temperature (Fig. 4). These data
demonstrate that EhRRP6 indeed encodes a
functional protein that can complement the growth
defect in yeast rrp6 mutant strain. Although
EhRRP6 lacks the N-terminal PMC2NT domain
and has shorter C-terminal region (by 164 amino
acids) compared with yeast sequence, its ability to
complement the yeast mutant strain indicates that
EhRRP6 contains the essential sequences required
for Rrp6 activity and the missing sequences could
be dispensable or redundant under the
experimental conditions.
Down-regulation of EhRRP6 leads to
accumulation of 5′-ETS
The role of RRP6 in the removal of 5′-ETS sub
fragments has been well documented both in yeast
and human (6,21,26). To demonstrate a direct
correlation of EhRrp6 levels with 5′-ETS
processing in E. histolytica we down-regulated the
expression of EhRRP6 by using the antisense
expression approach that has been successful in
expression knock-down of a variety of E.
histolytica genes (41,42). Cell-lines were
constructed for ectopically over expressing
EhRRP6 in the sense or antisense orientation using
a vector with tetracycline (tet)-inducible promoter
(43,44) (Fig. 5A). The levels of EhRrp6 were
determined by western blotting. In antisense
EhRRP6-overexpressing cells the levels of EhRrp6
came down by ~1.8 fold of cells transfected with
vector alone, after tet-induction; while conversely
the levels went up ~1.5 fold in sense-
overexpressing cells (Fig. 5B). The level of 5′-
ETS sub fragments was determined in these cell
lines by northern hybridization. We have earlier
shown accumulation of 5′-ETS sub fragments
(0.7-0.9 kb) which migrate as a broad band in
serum-starved E. histolytica cells (36). Very strong
accumulation of these fragments was seen in the
antisense cell line grown for 48 h with tet (Fig.
5C). There was no accumulation of 5′-ETS sub
fragments in sense cell line after 48 h of growth
with tet. Rrp6 is known to be involved in
generating the mature 3′-end of 5.8S rRNA. We
checked for the accumulation of 5.8S 3′-extended
precursor (equivalent to 5.8S+30 in (25,45)) by
quantitative RT-PCR using primer 30 nt
downstream of 5.8S (Fig. 5D). There was ~5-fold
accumulation of 5.8S extended precursor in
EhRrp6-down regulated cells. Down regulation of
by guest on June 12, 2020http://w
ww
.jbc.org/D
ownloaded from
Exonuclease EhRrp6 in growth stress
6
EhRRP6 resulted in severe growth defect in E.
histolytica cells (Fig. 5E). Antisense expressing
cells showed slow growth phenotype even in the
absence of tet, presumably due to some leaky
expression. These cells attained stationary phase at
lower cell density compared with the sense cell
line. Growth of antisense cell line was very slow
in the presence of tet, although cell lysis was not
observed. Over-expression of EhRRP6 did not
seem to elicit a growth phenotype. These data
demonstrate a direct role of EhRRP6 in
degradation of processed 5′-ETS sub fragments
and show that EhRrp6 performs an essential
function in E. histolytica.
Subcellular localization of EhRrp6 in normal
and serum-starved E. histolytica cells
To determine the subcellular distribution of
EhRrp6 protein in E. histolytica we used
polyclonal antibody raised against the recombinant
protein. The specificity of the antibody was
checked by western blot analysis of E. histolytica
total cell lysate (supplemental Fig. S4). The
antibody cross-reacted with a single band of 60
kDa, corresponding to the expected size of
EhRrp6. Trophozoites were stained with this
antibody and co-localization was determined in
nuclei stained with Hoechst. In normal E.
histolytica cells EhRrp6 was concentrated in the
nuclei and there was substantial staining of the
cytosol as well (Fig. 6A). The relative intensity of
nuclear versus cytoplasmic staining was
determined by selecting five random regions of the
cytosol and nucleus per cell and averaging out the
data for ten cells (Fig. 6C). The nuclear staining
intensity was ~3 times higher than cytosol in
normal cells. Thus our data show dual localization
of Rrp6 in nuclei and cytosol of normal E.
histolytica trophozoites. Such dual localization
was also seen in human cell lines and in T. brucei
(12,24,46,47), while in yeast cells the protein was
detected only in the nucleus (26,48). Interestingly,
when E. histolytica cells were subjected to serum
starvation for 24 hrs there was ~3-fold reduction in
the total levels of EhRrp6 in cell-lysates, as
measured by western blotting (Fig. 6D) Transcript
levels, determined by RNA-seq (two biological
replicates), were reduced by ~1.7-fold, indicating a
greater reduction of protein levels (Fig. 6D). In
both cases normalization was done with EhCaBP1
which did not change in starved cells.
Immunofluorescence analysis of these cells
showed almost complete loss of EhRrp6 from
nuclei of serum-starved cells while the cytosolic
staining was maintained (Fig. 6A). Upon
replenishment of serum to starved cells there was
gradual increase in EhRrp6 levels in nuclei, and by
12 hrs the nuclear:cytoplasmic ratio was restored
to that in normal cells (Fig. 6B). The
disappearance of the accumulated 5′-ETS sub
fragments in 24 hrs serum-starved cells after
serum replenishment paralleled the nuclear
restoration of EhRrp6 (Fig. 6E). The preferential
loss of EhRrp6 from nuclei of serum-starved cells
was also demonstrated by sub cellular
fractionation to obtain lysates from cytoplasmic
and nuclear fractions. The protein was detected by
western blotting (Fig. 6F). The E. histolytica
calcium-binding proteins, EhCaBP1 and EhCaBP6
were used as cytoplasmic and nuclear markers,
respectively, as they are known to be exclusively
localized in these compartments (49,50). The data
showed a ~3.5-fold drop in total EhRrp6 levels in
starved cells compared with control (Fig. 6F). The
protein concentration in the cytosolic fraction was
not significantly altered, while there was ~30-fold
reduction of protein in the nuclear fraction. Our
data suggest that the loss of EhRrp6 from nuclear
fraction was not due to increased localization to
the cytosol, as the cytosolic fraction showed no
increase. Interestingly, the mechanism is totally
reversible, with the nuclear:cytoplasmic ratio
being restored within 12 hrs of serum
replenishment.
Further we checked whether depletion of EhRrp6
from the nucleus was specific to serum-starvation
or was a more general stress response.
Immunofluorescence analysis was done with cells
subjected to heat stress or oxidative stress, using
the methods described (51). In both cases the
nuclear staining of EhRrp6 dropped significantly
within 60 min of stress induction and by 90 min
the protein was almost completely lost from the
nucleus (Fig. 6G-I). There was no significant
change in cytoplasmic staining intensity. Hoechst
staining showed that nuclei retained their integrity
in stressed cells and the loss of staining was not
due to nuclear breakdown. Thus the nuclear loss of
EhRrp6 appears to be a general response to growth
stress.
by guest on June 12, 2020http://w
ww
.jbc.org/D
ownloaded from
Exonuclease EhRrp6 in growth stress
7
The depletion of EhRrp6 from the nucleus in
serum-starved cells provides an explanation for
our earlier observation that the 5′-ETS sub
fragments, which are known substrates of Rrp6,
accumulate to high levels in serum-starved E.
histolytica cells (36).
The proteasome system is involved in nuclear
loss of EhRrp6 in serum-starved cells
The presence of proteasome has earlier been
demonstrated in E. histolytica (52). Treatment of
cells with specific proteasome inhibitors like
lactacystin and MG-132 has been shown to result
in growth defect and also inhibition of encystation
in Entamoeba invadens (53). To check whether
proteasome inhibition could stall the loss of
EhRrp6 during serum starvation we treated serum
starved cells with lactacystin or MG-132 and
checked EhRrp6 levels by western blotting. In
untreated cells EhRrp6 levels began to decline
within 8 hrs of serum starvation and were <28% of
control by 12 hrs. This decline was not observed in
serum starved cells treated with lactacystin or
MG-132 (Fig 7A) at the concentrations of the
inhibitors shown to block Entamoeba growth (53).
EhRrp6 levels were >79% of control in cells
treated with the inhibitors. This suggests the role
of proteasome in targeting EhRrp6 for degradation
during growth stress.
EhRrp6 is required for E. histolytica growth
and phagocytosis
As already shown, EhRrp6 down regulation led to
severe growth defect (Fig. 5E). To further
understand the involvement of EhRrp6 in cell
growth we determined the time taken for EhRrp6
levels to decrease following tet addition in
antisense cell lines. Tet was added to the culture
six hours after inoculating cells into fresh growth
medium. Cells were removed at different time
points and the levels of EhRrp6 were measured by
western blotting. Tet addition to antisense cells
resulted in gradual decline of EhRrp6 levels, and
by 36 hrs the levels in antisense (+tet) cells were
~25% of cells grown without tet (Fig. 7B).
Conversely, the EhRrp6 levels were elevated ~1.3-
fold in sense cells (+tet). Subsequent experiments
were carried out after 36 hr of tet addition. We
checked whether EhRrp6-depleted cells showed
any hallmarks of apoptosis. From Hoechst staining
we found nuclear integrity to be maintained in
these cells (Fig. 7C). We determined the extent of
blebbing which generally increases in apoptotic
cells. We found ~2-fold reduction in the average
number of blebs per cell in antisense (+tet) cells
(Fig. 7D), which may be due to reduced cell
motility. Indeed, we found ~30% reduction in cell
motility in the antisense (+tet) cells (Fig. 7E), as
determined by trans-well cell migration assay (51).
No appreciable change in cell size was observed.
Thus it is unlikely that EhRrp6-depleted cells
underwent apoptosis. Rather, the reduction in cell
growth may be due to block in cell proliferation.
Since EhRrp6 levels were severely reduced during
growth stress and conversely, reduction of EhRrp6
led to growth arrest (Figs. 5, 6), we checked
whether over expression of EhRrp6 could have a
protective effect during growth stress. The EhRrp6
sense cell line was grown with tet, and at 48 hrs
the cells were subjected to serum starvation. There
was significant increase in cell number in the
EhRrp6 over-expressing cells even after serum
starvation, compared with control cell lines in
which the cell number increased very slightly after
starvation (Fig. 7F). This suggests that the
presence of EhRrp6 could delay the onset of stress
signaling.
Phagocytosis is an essential process for E.
histolytica growth and is required for
pathogenesis. We checked whether EhRrp6 down
regulation had any effect on erythrophagocytosis.
Cells were incubated with RBCs, 36 hrs after tet
addition, by which time the EhRrp6 levels had
declined in the antisense (+tet) cells. RBC uptake,
determined by measuring the absorbance at
different time points, was severely reduced in the
EhRrp6 antisense cells (Fig. 8A). After 10 min,
uptake was only ~50% compared with cells
transfected with vector (+tet). The average number
of phagocytic cups per cell was ~40% in the
antisense cells compared with vector control (Fig.
8B). The sense (+tet) cells behaved the same as
control cells. This showed that EhRrp6 down
regulation had a marked inhibitory effect on
erythrophagocytosis.
To further understand the involvement of EhRrp6
in erythrophagocytosis we checked localization of
EhRrp6 in normal cells during RBC uptake.
EhRrp6 did not localize to the phagocytic cups,
by guest on June 12, 2020http://w
ww
.jbc.org/D
ownloaded from
Exonuclease EhRrp6 in growth stress
8
which were strongly stained with TRITC-
phalloidin due to enrichment of F-actin (Fig. 8C),
nor was it associated with the phagosome. This
indicates that physical involvement of EhRrp6
with the phagocytic machinery was unlikely.
A subset of phagocytosis-related genes are
down regulated in EhRrp6-depleted cells
A large number of E. histolytica genes have been
demonstrated to have direct roles in phagocytosis
(41,49,54-57). We checked the expression levels
of some of these genes in EhRrp6 down regulated
cells by western blotting of total cell lysates with
gene-specific antibodies (Fig. 9A). Expression of
two of the genes (EhCaBP3 and EhRho1) was
significantly reduced in the antisense (+tet) cells
compared with control cells (TOC vector +tet).
Expression was reduced by 1.8-fold and 1.6-fold
of control, respectively. Three of the tested genes
(EhCaBP1, EhCaBP6, EhC2PK) showed no
change in expression, while EhARP2/3 expression
was slightly reduced (85% of vector control).
However, this apparent decrease in EhARP2/3 is
probably not significant as the AS (-tet) cells also
showed the same expression (Fig. 9A).
Immunolocalization studies were done with
EhCaBP3 and EhRho1 (which were down
regulated in antisense cells) and EhCaBP1, which
remained unchanged, was used as control. In the
vector (+tet) and sense (+tet) cell lines EhCaBP3,
EhRho1 and EhCaBP1 all co-localized with
Ehactin at the phagocytic cups, as expected for
normal E. histolytica cells. All of these proteins
were significantly enriched in phagocytic cups
compared with cytosol as determined
quantitatively (Fig. 9B). However, in the
antisense (+tet) cell line the pattern was different.
As expected, staining for EhRrp6 was very low in
these cells and it was low both in the nucleus and
cytosol. Staining intensity of EhRho1 and
EhCaBP3 was also extremely low in these cells,
whereas the level of EhCaBP1 was comparable
with control. No enrichment of EhRho1 and
EhCaBP3 could be seen at the phagocytic cups,
whereas Ehactin and EhCaBP1 were enriched at
phagocytic cups in these cells and were
colocalized (Fig. 9B). We conclude that EhRrp6
down regulation specifically affected the levels of
selected proteins in the phagocytic pathway rather
than a generalized inhibitory effect on all genes.
To determine whether the drop in protein levels of
EhRho1 and EhCaBP3 could be due to
translational defect we checked the transcript
levels of these genes by quantitative RT-PCR and
found ~6.3-fold and ~3.2-fold reduction of
EhCaBP3 and EhRho1 transcripts, respectively
and no change in EhC2PK. EhCaBP1 was used as
internal control (Fig. 9C). Since the fold-reduction
in protein levels did not exceed the drop in
transcript levels, it appears unlikely that EhRrp6
down regulation affects the translation of
EhCaBP3 and EhRho1. We conclude that EhRrp6
is required for maintaining the transcript levels of
these key phagocytosis-related genes.
DISCUSSION
The 3′-5′ exoribonuclease encoded by RRP6 is
involved in 3′-end processing of a variety of stable
RNA precursors including pre-rRNAs, snRNAs
and snoRNAs and in transcription termination and
regulation of poly (A) tail length. It is also
required for removal of aberrant transcripts and
cryptic unstable transcripts and is thus a key
enzyme in RNA homeostasis (58,59). Here we
have undertaken a detailed study of this
exonuclease in the protozoan parasite E.
histolytica, in which the 5′-ETS sub fragments of
pre-rRNA are found to accumulate under growth
stress. The excised 5′-ETS is a known target of
degradation by Rrp6 in other organisms and
accumulates in rrp6 mutant cells (2,12,60).
Rrp6 works in conjunction with the exosome. We
found overall conservation of the core exosome in
E. histolytica; the major difference being absence
of Csl4 subunit. While CSL4 is essential in yeast,
mutant strains with truncated versions that lack
NTD or S1 domain are viable, and the Zn-ribbon
domain is not essential in vivo. In addition it has
been shown that Csl4 is not stably associated with
exosomes in vitro (61). Absence of CSL4 has also
been reported in another protozoan parasite, G.
lamblia (37) and may be a more common feature
in early eukaryotic evolution.
Sequence analysis and comparative modelling of
EhRrp6 showed high conservation of structure in
the catalytic EXO domain and HRDC domain.
EhRrp6 lacked the N-terminal PMC2NT domain
found in both yeast and human Rrp6. This domain
is also present in the T. brucei Rrp6 (38) and in
by guest on June 12, 2020http://w
ww
.jbc.org/D
ownloaded from
Exonuclease EhRrp6 in growth stress
9
one of the three Rrp6 isoforms of Arabidopsis
thaliana (12). It interacts with Rrp47 which
promotes the catalytic activity of Rrp6 and may
also have a role in maintaining appropriate
expression levels of Rrp6 (33,62). Rrp47 both
from yeast and human (called C1D) binds
structured nucleic acids and is thought to promote
Rrp6 activity by facilitating its binding to
structural elements within RNA, for example
helices at the 3′ termini (32,33). We could not find
any sequence homologous to RRP47 in the E.
histolytica data base. It appears that this gene may
be missing in E. histolytica and consequently its
interacting domain in EhRRP6 is also absent. In
this context it was interesting that EhRRP6 could
complement the ts growth defect of Scrrp6∆
mutant. The same observation was also made in A.
thaliana in which the isoform that lacked
PMC2NT domain (AtRRP6L1) could complement
the ts growth defect of Scrrp6∆, while AtRRP6L2
in which this domain is present could not (11,12).
It is possible that Rrp6 enzymes that have evolved
to function in the absence of PMC2NT domain
could use alternative mechanisms for structured
RNA recognition. In yeast the N-terminal domains
of Rrp6 and Rrp47 interact to provide a surface for
the binding of MTR4 helicase (63), which is
involved in unwinding the 3′-tail of RNA substrate
so that it can be threaded into the exosome channel
(64,65). The homologue of MTR4 is present in E.
histolytica and it may be recruited to the exosome
by a different mechanism independent of Rrp47.
In yeast the Rrp6 C-terminal domain (CTD) is
required for binding to the core exosome and for
degrading poly(A)+ rRNA processing products
(35). The CTD encompasses amino acid residues
518–733 which contain two distinct elements.
Residues 518–616 constitute the Exosome
Associating Region (EAR), and adopt structure
when associated with Exo9 (23). Residues 634–
733 are disordered and are rich in lysine and
arginine, with a calculated isoelectric point of
10.3. This C-terminal tail is called lasso as it binds
RNA and stimulates RNase activities of Rrp44 and
Rrp6 within the exosome. The CTD of EhRrp6 is
very short and encompasses only 54 amino acids.
Although its calculated isoelectric point is basic
(8.32), it is not as much enriched in lysine and
arginine residues as the yeast and human Rrp6
lasso. The prokaryotic RNase D family also lacks
a highly basic lasso (27). Further analysis of Rrp6
from a variety of eukaryotes is required to
establish the extent of conservation of highly basic
lasso in eukaryotic Rrp6 (23).
Human Rrp6 has been shown to more efficiently
degrade generic RNA substrate, with secondary
structure, beyond the stem-loop compared with
yeast Rrp6. This is attributed to the structure of
yeast catalytic domain in which the active site is
located in a deep cleft. In comparison, the
structure of the human catalytic domain shows the
active site to be more solvent exposed, which
could allow access to the 3′-end of structured RNA
(28). This structural difference in Rrp6 is due to
difference in the length of linker that connects the
EXO and HRDC domains (28,29). In yeast the
linker is 26 residues, but in humans, the linker is
only 10 residues and in T. brucei it is 12 residues
(38). The shorter linker results in a more solvent
exposed Rrp6 active site in human and T. brucei
Rrp6. Our comparative modelling analysis showed
the linker length in EhRrp6 to be 9 residues and
the enzyme is predicted to have a more accessible
active site. Accordingly, EhRrp6 could efficiently
degrade a generic RNA substrate with secondary
structure.
Under normal growth conditions EhRrp6 was
located both in the nucleus and cytosol.
Interestingly, we show that EhRrp6 is almost
completely lost from the nucleus when cells are
subjected to growth stress by serum starvation.
Conversely, down regulation of this protein
resulted in severe growth stress (Fig. 5). It is
possible that this protein could be a stress sensor
in E. histolytica and its nuclear loss may trigger
cellular reprogramming in response to stress. A
similar observation has been reported in budding
yeast cells in response to changes in nutritional
status, like nitrogen starvation in the presence of a
non-fermentable carbon source which induces the
cells to undergo meiosis and sporulation. The Rrp6
protein which is stable during mitotic growth,
declines progressively as the developmental
program shifts from mitotic growth (fermentation)
to respiration and sporulation (66). Although
serum starvation is not known to induce E.
histolytica cells to differentiate in culture, this
nutritional limitation stops cell division and
possibly triggers pathways that prepare the cell to
by guest on June 12, 2020http://w
ww
.jbc.org/D
ownloaded from
Exonuclease EhRrp6 in growth stress
10
survive in a maintenance mode. The loss of Rrp6
in sporulating yeast cells leads to elevated levels
of ncRNAs like MUTs, CUTs and rsSUTs which
are direct targets of Rrp6 during vegetative
growth. It is thought that Rrp6 negatively regulates
meiotic development by maintaining these
ncRNAs at low levels. It is possible that EhRrp6 is
also involved in degradation of specific ncRNAs,
which needs to be explored. The decline in
EhRrp6 protein levels in stressed cells could be
reversed with proteasomal inhibitors, suggesting
that the loss of EhRrp6 may be through
proteasomal degradation. It is not known whether
the same happens in sporulating yeast as well.
The down regulation of EhRrp6 resulted in a
severe growth phenotype, showing that this
protein is essential for E. histolytica cell
proliferation. The requirement of Rrp6 in proper
mitotic cell division has been demonstrated in
Drosophila as well. It was shown that dRrp6 is
needed for mitosis (in exosome-independent
manner), and that down regulation of dRrp6 led to
chromosome segregation defects and reduction in
the number of dividing cells (67). dRrp6 depletion
did not induce apoptosis but caused a loss of cell
proliferation. In our study also we did not find any
evidence of apoptosis in cells depleted of EhRrp6.
The mechanism by which Rrp6 depletion leads to
mitotic defect is not yet understood. Its depletion
could stabilize specific mRNAs or small
regulatory RNAs with roles in mitosis (67).
Interestingly, Rrp6 could also be involved in
physical stabilization of mitotic structures (68,69).
One of the determinants of E. histolytica
pathogenesis is its ability to phagocytose target
cells. The presence of ingested erythrocytes is a
hallmark of virulent strains (70). Depletion of
EhRrp6 resulted in marked reduction in
erythrophagocytosis, which was not due to general
down regulation of genes known to be essential for
E. histolytica phagocytosis (41,49,54-57). Of the
six genes tested, the expression of two of them
(EhCaBP3, EhRho1) came down (Fig. 9). Both the
mRNA and protein levels were reduced. Since
both these proteins have been shown to modulate
actin dynamics it is not surprising that reduction in
their levels led to reduced phagocytosis (54,55).
How EhRrp6 specifically targets selected genes is
intriguing and needs to be further investigated.
In conclusion, we have biochemically
characterized EhRrp6, a 3′-5′ exoribonuclease that
is lost from the nucleus during growth stress in E.
histolytica. Its down regulation adversely affected
amoebic growth and phagocytosis, a process
required for E. histolytica pathogenesis. This is
the first report of subcellular changes in Rrp6
levels in a parasite system responding to growth
stress. This important regulatory system may well
mediate parasite response to the host environment
and in pathogenesis.
EXPERIMENTAL PROCEDURES
Ethics statement
Mice used for generation of antibodies were
approved by the Institutional Animal Ethics
Committee (IAEC), Jawaharlal Nehru University
(IAEC code no.: 19/2013), New Delhi, India. All
animal experimentations were performed
according to the National Regulatory Guidelines
issued by CPSEA (Committee for the Purpose of
Supervision of Experiments on Animals), Ministry
of Environment and Forests, Govt. of India.
Cell culture, maintenance and stable
transfection of E. histolytica trophozoites Trophozoites of E. histolytica strain HM-1: IMSS
and all transformed strains were maintained and
grown in TY1-S-33 medium supplemented with
125 μl of 250 U ml− 1 penicillin G (potassium salt
from Sigma) and 0.25 mg ml− 1 streptomycin per
100 ml of medium as described before (71). For
serum starvation E. histolytica trophozoites
growing for 48 h in medium containing 15% adult
bovine serum were transferred to low-serum
(0.5%) medium. To make sense and antisense
EhRrp6 expressing cell lines, E. histolytica was
transfected by electroporation (42). Drug selection
was initiated after 2 days of transfection in the
presence of 10 μg ml−1 hygromycin B (for
tetracycline inducible vector) (44). For induction,
tetracycline (30 μg ml− 1) was added 6 to 12 hrs
after sub-culture to the medium for the indicated
time periods. Cells were harvested after 48 hrs for
western blot.
Comparative sequence analysis, Comparative
modeling and Molecular Dynamics simulation
of EhRrp6
by guest on June 12, 2020http://w
ww
.jbc.org/D
ownloaded from
Exonuclease EhRrp6 in growth stress
11
To identify the Rrp6 protein in E. histolytica, we
took the Rrp6 protein sequences from H. sapiens
(NP_001001998), S. cerevisiae (NP_014643) and
T. brucei (XP_844313) and performed searches
using NCBI protein BLAST (two methods: blastp
and PSI-BLAST with default parameters) against
the non-redundant (nr) protein database of E.
histolytica HM-1:IMSS-A (taxid:885318)(72).
Two matrices BLOSSUM62 and PAM250 and
word size of 2, 3 and 6 were used to search for
suitable protein. The threshold value for cutoff
was set to 0.005 and all other parameters were
kept as default. Multiple sequence alignment and
phylogenetic tree construction methods are
explained in supplemental method SM1.1. EhRrp6
structure (EXO and HRDC domain, amino acid
sequence range 183 to 463) was modelled using
two templates in Modeller (v-9.14) (73). Two
Rrp6 proteins, one from H. sapiens (PDB ID:
3SAF) and other from S. cerevisiae (PDB ID:
2HBK) having sequence identity 44% (Query
coverage 99%) and 45% (Query coverage 90%)
respectively were selected as templates for
modelling after performing protein BLAST
against Protein Data Bank PDB (http://www.
rcsb.org/ ) through NCBI BLAST web interface
with default settings (72,74). EhRrp6 best
modelled structure was selected on the basis of
DOPE score and qualitatively evaluated using
ProSA web server
(https://prosa.services.came.sbg.ac.at/prosa.php)
(75) and PROCHECK (76). The two Magnesium
ions (Mg2+) in the catalytic pocket of EhRrp6 were
placed at the same position where Manganese
(Mn2+) and Magnesium (Mg2+) are located in
2HBK and 3SAF respectively through structural
alignment. Molecular Dynamics (MD) simulation
of native and mutant EhRrp6 forms is described in
supplemental methods SM1.2. Graphs were
plotted using Python Matplotlib library (77).
UCSF chimera (1.10.2) was used for structural
comparison and visualization (78).
Cloning, Protein expression and purification
The E.histolytica RRP6 gene (EHI_021400) was
PCR-amplified from genomic DNA using Phusion
DNA polymerase. Digested PCR products were
cloned in pET-30(b) vector. Point mutations of
EhRRP6 were introduced by site-directed
mutagenesis. The presence of mutations was
confirmed by nucleotide sequencing. S1 Table
shows the list of primers used to generate the wild
type and mutant constructs. E.coli Shuffle (DE3)
(Novagen) was transformed with the pET30b-
EhRRP6 constructs. For protein expression, 1% of
overnight grown culture of a single colony was
added to 2 liter of Luria-Bertani (LB) broth
(Sigma) containing kanamycin (50 μg/ml). Cells
were grown to OD600 of 0.6 at 37°C. The cell
culture was induced with 0.25 mM IPTG
(isopropyl-β-D-thiogalactopyranoside) and shaken
overnight at 18°C. The cells were harvested at
5,000 rpm for 20 min and stored at −80°C for later
use. The first step of purification was carried out
using Ni-NTA (Qiagen, Germany) affinity
chromatography. The cell pellets stored at −80°C
were thawed and mixed with lysis buffer (50 mM
Tris-HCl [pH 8.0], 300 mM NaCl, 10 mM
imidazole, 5% glycerol, 1mM β-mercaptoethanol
[βME], 1mM phenylmethylsulfonyl fluoride
[PMSF]). After the addition of lysozyme (0.15
mg/ml), the cell suspension was incubated at 4°C
for 30 min. The cell suspension was sonicated
(QSonica Ultrasonic Systems) in an ice-water
mixture at 25% of the amplitude with a pulse
(three to four cycles) of 30 s each interspersed
with a 1 min interval. Cell lysate was treated with
0.1% Triton X-100, followed by incubation for 30
min on a rotating rocker (Nulife) at 4°C.The lysate
was then centrifuged at 15,000 rpm for 30 min at
4°C. Supernatant was passed through Ni-NTA
column (QIAGEN) equilibrated with buffer (20
mM Tris-HCl [pH 8.0], 300 mM NaCl, 1 mM
βME, and 10 mM imidazole). After washing
(Washing buffer: 20 mM Tris-HCl [pH 8.0], 300
mM NaCl, 50mM KCl, 2mM ATP, 10mM
MgSO4, 1 mM βME) with a gradient of imidazole
from 25 to 150 mM, protein was eluted with buffer
(20 mM Tris-HCl, 150 mM NaCl, 1 mM βME, 5%
glycerol & 250 mM imidazole).The concentrated
protein was loaded on a gel permeation
chromatography Superdex 200 10/300 GL column
(GE Healthcare), which was previously
equilibrated with buffer (20 mM Tris-HCl [pH
8.0], 150 mM NaCl, 5% glycerol & 1mM
βME).The protein fractions were pooled and
dialyzed against (20 mM Tris-HCl [pH 8.0], 50
mM NaCl, 5% glycerol, & 1mM βME) then
concentrated using an Amicon Ultra-15
Centrifugal Filter Unit with Ultracel-30 membrane
(Millipore) to ∼2.5 mg/ml. The protein
by guest on June 12, 2020http://w
ww
.jbc.org/D
ownloaded from
Exonuclease EhRrp6 in growth stress
12
concentration was determined by Bradford method
and stored at -80°C.
For tetracycline inducible expression of EhRRP6
in E. histolytica, CAT gene of the shuttle vector
pEhHYG-tet-O-CAT (44) was excised using KpnI
and BamHI and EhRRP6 gene was inserted in its
place in either the sense or the antisense
orientation.
EhRrp6 exonuclease assays
To check the 3′-5′ exoribonuclease activity of
purified EhRrp6, 5′ [32P] labeled RNA was taken
as substrate. The 50-nt AU-rich RNA and 60 nt
generic RNA had the sequences-
5′GAAUUAUUUAUUAUUUAUUUAUUAUUU
AUUUAUUUAUUAUUUAUUUAUUA3′and
5′GAGCUAGGAAGAAUAGAUGAAAAAUCU
AUUAAUAUAUAAUUAAUUACUUUUUUUU
UUUUU-3′. RNAs were heated at 95°C for 2 min
and cooled to room temperature prior to
determining activities. To label the in vitro–
transcribed RNA at its 5′ end, it was
dephosphorylated using Antarctic Phosphatase,
followed by rephosphorylation catalyzed by T4
polynucleotide kinase in the presence of
[γ32P]ATP. Exoribonuclease activities were
performed in a 10-μL reaction mixture of 10 mM
Tris-HCl (pH 8.0), 10 mM DTT, 50 mM KCl, 5
mM MgCl2, 1 U/μL RNAse inhibitor (NEB),
10µM RNA and 1uM protein at 37°C. Single-
point assays of mutant EhRrp6 were conducted for
120 min. Reactions were quenched by the addition
of 10 μL of loading buffer (95% formamide, 20
mM EDTA, 1% DNA loading dye) and snap
chilled in ice-water. Samples were loaded onto a
15% polyacrylamide-8M urea gel for
electrophoresis. Gels were imaged using a Fuji
FLA-5000 scanner. For DNA substrates the
following sequence (40) was used as ssDNA and
was annealed with its homologue to obtain ds
DNA, which was checked on native gel.
>SINE-1ssDNA
5′CCCCTGAGCTAGGAAGAATAGATGAAAA
ATCTATTAATACTTAATTAATTACTTTTTTC
TTTTTA-3′
Yeast complementation
EhRRP6 cDNAs were cloned into pRS 426-GPD
and transformed into wild-type (BY4742) and
rrp6Δ (Dharmacon 11777) yeast strains using the
lithium acetate method (79). Following selection
at 30°C, the cells were tested for growth at 30°C
and 37°C.
Immunofluorescence staining
Immunofluorescence staining of E. histolytica
cells was performed as described before (41). In
brief, E. histolytica cells were collected by
centrifugation and washed before re-suspending in
TYI-S-33 medium. The cells were transferred onto
acetone-cleaned coverslips placed in a petri dish
and allowed to adhere for 10 min at 35.5 °C. The
culture medium was removed and cells were fixed
with 3.7% pre-warmed paraformaldehyde for 30
min. Cells were permeabilized with 0.1% Triton
X-100/PBS for 3 min. The fixed cells were then
washed with PBS and quenched for 30 min in PBS
containing 50 mM NH4Cl. The coverslips were
blocked with 1% BSA/PBS for 30 min, followed
by incubation with primary antibody at 37 °C for 1
h. The coverslips were washed with PBS followed
by 1% BSA/PBS before incubation with secondary
antibody for 30 min at 37 °C. Antibody dilutions
used were: anti-EhRrp6/anti-EhARPC2/anti-
EhRho1 at 1:100, anti-EhCaBP1/anti-
EhCaBP3/anti-EhC2PK/anti-EhCaBP6 at 1:200
and anti-r-EhCaBP6 at 1:300, anti-rabbit/mice
Alexa 488, Pacific blue-410 (Molecular Probes) at
1:250, TRITC-Phalloidin at 1:250. The
preparations were further washed with 1X PBS
and stained with Hoechst (20 μg/ml) for 10 min at
37°C. The cells were washed thoroughly with 1X
PBS and mounted on a glass slide using DABCO
(1, 4-diazbicyclo (2,2,2) octane (Sigma) 10 mg/ml
in 80% glycerol). The edges of the coverslip were
sealed with nail-paint to avoid drying. Confocal
images were visualized using a Nikon Real Time
Laser Scanning Confocal Microscope (Model
A1R).The raw images were processed using NIS
element 3.20 (Nikon) that included merging of
AlexaFluor 488, Hoechst and DIC channels,
acquisition of intensity profile, determination of
intensity at the region of interest.
RNA isolation and northern hybridization
Cells were removed at different time points. Total
RNA from ∼5 × 106 cells was purified using
by guest on June 12, 2020http://w
ww
.jbc.org/D
ownloaded from
Exonuclease EhRrp6 in growth stress
13
TRIzol reagent (Invitrogen) according to the
manufacturer’s instructions. For northern analysis
10 μg of total RNA was resolved on 1.2%
formaldehyde agarose gel in gel running buffer
[0.1 M MOPS (pH 7.0), 40 mM sodium acetate,
5 mM EDTA (pH 8.0)] and 37% formaldehyde at
4 V/cm. The RNA was transferred on to
GeneScreen plus R membrane (PerkinElmer). α-
P32dATP labeled probe was prepared by random
priming method using DecaLabel DNA labeling
kit (Thermo Scientific). Hybridization and
washing conditions for RNA blots were as per
manufacturer instructions.
Total cell lysate preparation
E. histolytica trophozoites were harvested at
280xg for 7 min/ 4°C. The pellet was washed with
cold PBS # 8, resuspended in 50 mM Tris-Cl pH
7.0, 5% glycerol, 2% SDS and 1X protease
inhibitor cocktail (Sigma) and kept at 95°C/ 5 min.
The sample was centrifuged at 13000 g/ 5 min.
The supernatant was collected and quantification
was done by bicinchoninic acid (BCA). Yeast cell
lysate was prepared according to Shirai A, et al
(80). Cells were harvested, 0.7N NaOH solution
was added and sample was incubated for 3
min/RT. The cells were centrifuged and SDS-
PAGE sample buffer was added. The sample was
heated at 95°C/10 min and supernatant obtained
after centrifugation was loaded.
Sub-cellular fractionation
Separation of nuclear and cytosolic fractions was
essentially done as described (81). Briefly, ∼107
cells growing in log phase were harvested at
280xg for 7 min at 4°C and cell pellet was washed
with PBS # 8. The washed pellet was resuspended
in 2ml lysis buffer [10mM HEPES pH=7.5,
1.5mM MgCl2, 10mM KCl, 0.5mMDTT, 0.2%
NP-40 detergent and protease inhibitor cocktail)
and incubated on ice, 15 min followed by
centrifugation at 3000xg for 10 min at 4°C. The
pellet contained the nuclear fraction and
supernatant contained cytoplasmic fraction.
Nuclear integrity was checked by microscopy.
Nuclear pellet was resuspended in 50ul of lysis
buffer added with 0.5% Triton X-100 and protein
content of each fraction was estimated by BCA
assay.
Western blotting
Samples were separated on 15% SDS–PAGE and
the gel was transferred on to a polyvinylidine
fluoride (PVDF) membrane by wet transfer
method and processed using standard protocols.
The antigens were detected with polyclonal anti-
EhRrp6 (1∶2000), EhCoactosin (1:5000) (raised in
mice) or anti-EhCaBP1, EhCaBP6 raised in
rabbits (1∶5000, raised in our laboratory) and anti-
α-tubulin antibody (Sigma Cat No.T6199)
followed by secondary anti-rabbit or anti-mouse
immunoglobulins conjugated to HRPO at 1∶10,000
dilution (Sigma, Cat No. A6667 or A2554). ECL
reagents were used for visualization (Millipore).
Protein concentration was estimated by BCA assay
using BSA as a standard. Quantification of band
intensity in each lane was done by densitometry
using ImageJ software and values were normalized
using respective internal control.
RNA-Seq transcriptome sequencing
Total RNA was purified from exponentially
growing E. histolytica cells (and 24h serum
starved cells) using TRIzol reagent (Invitrogen)
and used for selection of polyA plus RNA and
library preparation was done after oligo (dT)
selection. RNA-Seq libraries were generated by
performing RNA fragmentation, random hexamer
primed cDNA synthesis, linker ligation and PCR
enrichment. These libraries were then sequenced
on the Illumina HiSeq 2500 (v3 Chemistry)
platform. From paired-end reads low quality
sequences were removed including non-polyA
tailed RNAs using bowtie2 (version 2.2.2) and in-
house Perl scripts. About 35 million reads were
obtained and on an average, ∼90.13% of total
reads passed > = 30 Phred score. The reads were
aligned to the E. histolytica (HM1:IMSS) total
genome, downloaded from AmoebaDB, using
RSEM v1.2.31 with default parameters and
commands: “rsem- prepare-reference” and “rsem-
calculate-expression”. The data were obtained for
two biological replicates.
Erythrophagocytosis assay
The assay was performed essentially as described
(41). E. histolytica trophozoites were harvested in
1X PBS (pH 7.2) and equal numbers (105 cells)
were incubated with 107 RBCs for the indicated
times, at 37°C in 0.5 ml of culture medium. The
amoebae and erythrocytes were centrifuged and
by guest on June 12, 2020http://w
ww
.jbc.org/D
ownloaded from
Exonuclease EhRrp6 in growth stress
14
cold distilled water was added to lyse the non-
engulfed RBCs and re-centrifuged at 1,000 g for 2
min. This step was repeated twice, followed by re-
suspension in 1 ml formic acid to lyse Entamoeba
cells containing engulfed RBCs. The absorbance
was measured at 400 nm with formic acid as
blank.
Cell proliferation and cell migration assay
Growth kinetics was studied by inoculating equal
number of cells (3x104 cells/ml). The cells were
allowed to grow at 35.5°C in 5 ml or 7 ml tubes
and harvested at 12, 24, 36, 48, and 72 h post
inoculation. The cells were harvested in 1X PBS
(pH 7.2) by chilling on ice followed by
centrifugation at 1,500Xg for 5 min. The cell
pellet was resuspended in 1 ml 1X PBS (pH 7.2).
The cells were counted with haemocytometer by
mixing cells with 0.4% Trypan blue in a ratio of
1:1. At every time point, the cells were harvested
and counted as mentioned above. For motility
assay, experiments were carried out as described
before (51). 1.5 × 105 harvested amoebic cells
were added to top chamber of transwell containing
8 μM pore size (Costar, USA) in incomplete TYI
medium. TYI medium with 15% serum was placed
in lower chamber. A 24‐well plate was sealed with
parafilm and placed in anaerobic bag for 2 hr at
35.5°C. Parasites migrated in the bottom chamber
were chilled, transferred to a microcentrifuge tube,
centrifuged at 1,000 g for 5 min, resuspended in
TYI medium, and quantified with a
haemocytometer. Each experiment was performed
in triplicate. The standard error bars were
calculated and represented.
Real-time quantitative reverse transcriptase
PCR
Total RNA was extracted by the TRIzol reagent
(Invitrogen) and cDNA was synthesized by the
Verso cDNA Synthesis kit (Thermo Scientific),
followed by PCR amplification, using the listed
primers: EhCaBP3 forward primer
5′atggacaagaagtagattcaaccgaagat 3′; reverse primer
5′agctctgaagctgaaatgtagcc3′; EhRho1 forward
primer 5′tgatatgaacactggtgctggt 3′; reverse primer
5′agcggttgggatttcaccttt3′; EhCaBP1 forward
primer 5′aatcataaactaatggctgaagcac3′; reverse
primer 5′cataagagacagctccatctcca3′; EhC2PK
forward primer 5′ccacaagaacgagctacagca3′;
reverse primer 5′cattcattgatgctgtgggatga3′. FP1
(5.8S rRNA) 5′ctttggatagtttagtttcctgggc3′; RP1
(5.8S rRNA) 5accttgaagttcataagtatactttc3′; FP2
(5.8S+30nt rRNA) 5′ tgtgaatatccaaaatttgaatgc 3′;
RP2 (5.S+30 rRNA)
5′ctctgttgtacttgcattggattttaatatatgctc3′ Reactions
were carried out using Power SYBR Green PCR
Master Mix (Applied Biosystems) on the 7500
Fast Real-Time PCR System (Applied Biosystems)
by denaturation at 95°C for 10 min, followed by
40 cycles at 95°C for 15 s and 60°C for 40 s.
Melting curve analyses were performed to verify
the amplification specificity. Relative
quantification of gene expression was performed
according to the ΔΔ-CT method using 7500
Software v2.3 (Applied Biosystems).
Statistical analysis
Statistical comparisons were made using ANOVA
test. Experimental values were reported as the
mean ± SD. Differences in mean values were
considered significant at “one black star” p-value
≤0.05, “two black star” p-value ≤0.01, “three black
star” p-value ≤0.001. All calculations of statistical
significance were made using the GraphPad InStat
software package (GraphPad Prism 7).
ACKNOWLEDGMENTS: This work was supported by J.C. Bose national fellowship and Board of
Research in Nuclear Sciences (BRNS) to SB, Council of Scientific and Industrial Research fellowship to
SSS, AK, and SN. NS acknowledges University Grant Commission funded UPE-II for providing partial
financial assistance. We acknowledge AIRF, JNU, for providing instrumental support and Dr. Prabhat
Kumar for confocal microscopy. We are grateful to Biswadip Das for helpful comments and suggestions.
CONFLICT OF INTEREST: The authors declare that they have no conflicts of interest with the
contents of this article.
by guest on June 12, 2020http://w
ww
.jbc.org/D
ownloaded from
Exonuclease EhRrp6 in growth stress
15
AUTHOR CONTRIBUTIONS: Study design: SSS, SB; Study conduct: SSS, AK, RB; Data analysis:
SSS, SB, AB, NS, AK, SN, RB, YPS, and AKR; Data interpretation: SB, SSS, NS, AK and AB; Drafting
manuscript: SB, SSS. Approving final version of manuscript: SB, AB and NS; SB, SSS, AK and RB take
responsibility for the integrity of data analysis.
FOOTNOTES
Abbreviation used are: nt, nucleotide; ts, temperature sensitive; ncRNA, non-coding RNA.
REFERENCES:
1. Woolford, J. L., Jr., and Baserga, S. J. (2013) Ribosome biogenesis in the yeast Saccharomyces cerevisiae. Genetics 195, 643-681
2. Allmang, C., Mitchell, P., Petfalski, E., and Tollervey, D. (2000) Degradation of ribosomal RNA precursors by the exosome. Nucleic acids research 28, 1684-1691
3. Allmang, C., Petfalski, E., Podtelejnikov, A., Mann, M., Tollervey, D., and Mitchell, P. (1999) The yeast exosome and human PM-Scl are related complexes of 3' --> 5' exonucleases. Genes & development 13, 2148-2158
4. de la Cruz, J., Kressler, D., Tollervey, D., and Linder, P. (1998) Dob1p (Mtr4p) is a putative ATP-dependent RNA helicase required for the 3' end formation of 5.8S rRNA in Saccharomyces cerevisiae. The EMBO journal 17, 1128-1140
5. Henras, A. K., Soudet, J., Gerus, M., Lebaron, S., Caizergues-Ferrer, M., Mougin, A., and Henry, Y. (2008) The post-transcriptional steps of eukaryotic ribosome biogenesis. Cellular and molecular life sciences : CMLS 65, 2334-2359
6. Sloan, K. E., Bohnsack, M. T., Schneider, C., and Watkins, N. J. (2014) The roles of SSU processome components and surveillance factors in the initial processing of human ribosomal RNA. Rna 20, 540-550
7. Lebreton, A., Tomecki, R., Dziembowski, A., and Seraphin, B. (2008) Endonucleolytic RNA cleavage by a eukaryotic exosome. Nature 456, 993-996
8. Schaeffer, D., Tsanova, B., Barbas, A., Reis, F. P., Dastidar, E. G., Sanchez-Rotunno, M., Arraiano, C. M., and van Hoof, A. (2009) The exosome contains domains with specific endoribonuclease, exoribonuclease and cytoplasmic mRNA decay activities. Nature structural & molecular biology 16, 56-62
9. Delan-Forino, C., Schneider, C., and Tollervey, D. (2017) Transcriptome-wide analysis of alternative routes for RNA substrates into the exosome complex. PLoS genetics 13, e1006699
10. Zakrzewska-Placzek, M., Souret, F. F., Sobczyk, G. J., Green, P. J., and Kufel, J. (2010) Arabidopsis thaliana XRN2 is required for primary cleavage in the pre-ribosomal RNA. Nucleic acids research 38, 4487-4502
11. Sikorski, P. J., Zuber, H., Philippe, L., Sement, F. M., Canaday, J., Kufel, J., Gagliardi, D., and Lange, H. (2015) Distinct 18S rRNA precursors are targets of the exosome complex, the exoribonuclease RRP6L2 and the terminal nucleotidyltransferase TRL in Arabidopsis thaliana. The Plant journal : for cell and molecular biology 83, 991-1004
12. Lange, H., Holec, S., Cognat, V., Pieuchot, L., Le Ret, M., Canaday, J., and Gagliardi, D. (2008) Degradation of a polyadenylated rRNA maturation by-product involves one of the three RRP6-like proteins in Arabidopsis thaliana. Molecular and cellular biology 28, 3038-3044
13. Wang, M., and Pestov, D. G. (2011) 5'-end surveillance by Xrn2 acts as a shared mechanism for mammalian pre-rRNA maturation and decay. Nucleic acids research 39, 1811-1822
by guest on June 12, 2020http://w
ww
.jbc.org/D
ownloaded from
Exonuclease EhRrp6 in growth stress
16
14. Makino, D. L., Baumgartner, M., and Conti, E. (2013) Crystal structure of an RNA-bound 11-subunit eukaryotic exosome complex. Nature 495, 70-75
15. Mitchell, P., Petfalski, E., Shevchenko, A., Mann, M., and Tollervey, D. (1997) The exosome: a conserved eukaryotic RNA processing complex containing multiple 3'-->5' exoribonucleases. Cell 91, 457-466
16. Parker, R., and Song, H. (2004) The enzymes and control of eukaryotic mRNA turnover. Nature structural & molecular biology 11, 121-127
17. van Hoof, A., Frischmeyer, P. A., Dietz, H. C., and Parker, R. (2002) Exosome-mediated recognition and degradation of mRNAs lacking a termination codon. Science 295, 2262-2264
18. Kadaba, S., Krueger, A., Trice, T., Krecic, A. M., Hinnebusch, A. G., and Anderson, J. (2004) Nuclear surveillance and degradation of hypomodified initiator tRNAMet in S. cerevisiae. Genes & development 18, 1227-1240
19. Maquat, L. E., and Carmichael, G. G. (2001) Quality control of mRNA function. Cell 104, 173-176 20. Isken, O., and Maquat, L. E. (2007) Quality control of eukaryotic mRNA: safeguarding cells from
abnormal mRNA function. Genes & development 21, 1833-1856 21. Allmang, C., Kufel, J., Chanfreau, G., Mitchell, P., Petfalski, E., and Tollervey, D. (1999) Functions
of the exosome in rRNA, snoRNA and snRNA synthesis. The EMBO journal 18, 5399-5410 22. Wasmuth, E. V., Januszyk, K., and Lima, C. D. (2014) Structure of an Rrp6-RNA exosome complex
bound to poly(A) RNA. Nature 511, 435-439 23. Wasmuth, E. V., and Lima, C. D. (2017) The Rrp6 C-terminal domain binds RNA and activates the
nuclear RNA exosome. Nucleic acids research 45, 846-860 24. Lykke-Andersen, S., Tomecki, R., Jensen, T. H., and Dziembowski, A. (2011) The eukaryotic RNA
exosome: same scaffold but variable catalytic subunits. RNA biology 8, 61-66 25. Briggs, M. W., Burkard, K. T., and Butler, J. S. (1998) Rrp6p, the yeast homologue of the human
PM-Scl 100-kDa autoantigen, is essential for efficient 5.8 S rRNA 3' end formation. The Journal of biological chemistry 273, 13255-13263
26. Phillips, S., and Butler, J. S. (2003) Contribution of domain structure to the RNA 3' end processing and degradation functions of the nuclear exosome subunit Rrp6p. Rna 9, 1098-1107
27. Zuo, Y., Wang, Y., and Malhotra, A. (2005) Crystal structure of Escherichia coli RNase D, an exoribonuclease involved in structured RNA processing. Structure 13, 973-984
28. Januszyk, K., Liu, Q., and Lima, C. D. (2011) Activities of human RRP6 and structure of the human RRP6 catalytic domain. Rna 17, 1566-1577
29. Midtgaard, S. F., Assenholt, J., Jonstrup, A. T., Van, L. B., Jensen, T. H., and Brodersen, D. E. (2006) Structure of the nuclear exosome component Rrp6p reveals an interplay between the active site and the HRDC domain. Proceedings of the National Academy of Sciences of the United States of America 103, 11898-11903
30. Assenholt, J., Mouaikel, J., Andersen, K. R., Brodersen, D. E., Libri, D., and Jensen, T. H. (2008) Exonucleolysis is required for nuclear mRNA quality control in yeast THO mutants. Rna 14, 2305-2313
31. Mitchell, P., Petfalski, E., Houalla, R., Podtelejnikov, A., Mann, M., and Tollervey, D. (2003) Rrp47p is an exosome-associated protein required for the 3' processing of stable RNAs. Molecular and cellular biology 23, 6982-6992
32. Schilders, G., van Dijk, E., and Pruijn, G. J. (2007) C1D and hMtr4p associate with the human exosome subunit PM/Scl-100 and are involved in pre-rRNA processing. Nucleic acids research 35, 2564-2572
33. Stead, J. A., Costello, J. L., Livingstone, M. J., and Mitchell, P. (2007) The PMC2NT domain of the catalytic exosome subunit Rrp6p provides the interface for binding with its cofactor Rrp47p, a nucleic acid-binding protein. Nucleic acids research 35, 5556-5567
by guest on June 12, 2020http://w
ww
.jbc.org/D
ownloaded from
Exonuclease EhRrp6 in growth stress
17
34. Costello, J. L., Stead, J. A., Feigenbutz, M., Jones, R. M., and Mitchell, P. (2011) The C-terminal region of the exosome-associated protein Rrp47 is specifically required for box C/D small nucleolar RNA 3'-maturation. The Journal of biological chemistry 286, 4535-4543
35. Callahan, K. P., and Butler, J. S. (2008) Evidence for core exosome independent function of the nuclear exoribonuclease Rrp6p. Nucleic acids research 36, 6645-6655
36. Gupta, A. K., Panigrahi, S. K., Bhattacharya, A., and Bhattacharya, S. (2012) Self-circularizing 5'-ETS RNAs accumulate along with unprocessed pre ribosomal RNAs in growth-stressed Entamoeba histolytica. Scientific reports 2, 303
37. Williams, C. W., and Elmendorf, H. G. (2011) Identification and analysis of the RNA degrading complexes and machinery of Giardia lamblia using an in silico approach. BMC genomics 12, 586
38. Barbosa, R. L., Legrand, P., Wien, F., Pineau, B., Thompson, A., and Guimaraes, B. G. (2014) RRP6 from Trypanosoma brucei: crystal structure of the catalytic domain, association with EAP3 and activity towards structured and non-structured RNA substrates. PloS one 9, e89138
39. Burkard, K. T., and Butler, J. S. (2000) A nuclear 3'-5' exonuclease involved in mRNA degradation interacts with Poly(A) polymerase and the hnRNA protein Npl3p. Molecular and cellular biology 20, 604-616
40. Gaurav, A. K., Kumar, J., Agrahari, M., Bhattacharya, A., Yadav, V. P., and Bhattacharya, S. (2017) Functionally conserved RNA-binding and protein-protein interaction properties of LINE-ORF1p in an ancient clade of non-LTR retrotransposons of Entamoeba histolytica. Molecular and biochemical parasitology 211, 84-93
41. Babuta, M., Mansuri, M. S., Bhattacharya, S., and Bhattacharya, A. (2015) The Entamoeba histolytica, Arp2/3 Complex Is Recruited to Phagocytic Cups through an Atypical Kinase EhAK1. PLoS pathogens 11, e1005310
42. Bharadwaj, R., Arya, R., Shahid Mansuri, M., Bhattacharya, S., and Bhattacharya, A. (2017) EhRho1 regulates plasma membrane blebbing through PI3 kinase in Entamoeba histolytica. Cellular microbiology 19
43. Ramakrishnan, G., Vines, R. R., Mann, B. J., and Petri, W. A., Jr. (1997) A tetracycline-inducible gene expression system in Entamoeba histolytica. Molecular and biochemical parasitology 84, 93-100
44. Hamann, L., Buss, H., and Tannich, E. (1997) Tetracycline-controlled gene expression in Entamoeba histolytica. Molecular and biochemical parasitology 84, 83-91
45. Thomson, E., and Tollervey, D. (2010) The final step in 5.8S rRNA processing is cytoplasmic in Saccharomyces cerevisiae. Molecular and cellular biology 30, 976-984
46. Lejeune, F., Li, X., and Maquat, L. E. (2003) Nonsense-mediated mRNA decay in mammalian cells involves decapping, deadenylating, and exonucleolytic activities. Molecular cell 12, 675-687
47. Haile, S., Cristodero, M., Clayton, C., and Estevez, A. M. (2007) The subcellular localisation of trypanosome RRP6 and its association with the exosome. Molecular and biochemical parasitology 151, 52-58
48. Feigenbutz, M., Jones, R., Besong, T. M., Harding, S. E., and Mitchell, P. (2013) Assembly of the yeast exoribonuclease Rrp6 with its associated cofactor Rrp47 occurs in the nucleus and is critical for the controlled expression of Rrp47. The Journal of biological chemistry 288, 15959-15970
49. Verma, D., Murmu, A., Gourinath, S., Bhattacharya, A., and Chary, K. V. R. (2017) Structure of Ca2+-binding protein-6 from Entamoeba histolytica and its involvement in trophozoite proliferation regulation. PLoS pathogens 13, e1006332
50. Yadava, N., Chandok, M. R., Prasad, J., Bhattacharya, S., Sopory, S. K., and Bhattacharya, A. (1997) Characterization of EhCaBP, a calcium-binding protein of Entamoeba histolytica and its binding proteins. Molecular and biochemical parasitology 84, 69-82
by guest on June 12, 2020http://w
ww
.jbc.org/D
ownloaded from
Exonuclease EhRrp6 in growth stress
18
51. Rastew, E., Vicente, J. B., and Singh, U. (2012) Oxidative stress resistance genes contribute to the pathogenic potential of the anaerobic protozoan parasite, Entamoeba histolytica. International journal for parasitology 42, 1007-1015
52. Scholze, H., Frey, S., Cejka, Z., and Bakker-Grunwald, T. (1996) Evidence for the existence of both proteasomes and a novel high molecular weight peptidase in Entamoeba histolytica. The Journal of biological chemistry 271, 6212-6216
53. Makioka, A., Kumagai, M., Ohtomo, H., Kobayashi, S., and Takeuchi, T. (2002) Effect of proteasome inhibitors on the growth, encystation, and excystation of Entamoeba histolytica and Entamoeba invadens. Parasitology research 88, 454-459
54. Aslam, S., Bhattacharya, S., and Bhattacharya, A. (2012) The Calmodulin-like calcium binding protein EhCaBP3 of Entamoeba histolytica regulates phagocytosis and is involved in actin dynamics. PLoS pathogens 8, e1003055
55. Bharadwaj, R., Sharma, S., Janhawi, Arya, R., Bhattacharya, S., and Bhattacharya, A. (2018) EhRho1 regulates phagocytosis by modulating actin dynamics through EhFormin1 and EhProfilin1 in Entamoeba histolytica. Cellular microbiology, e12851
56. Jain, R., Santi-Rocca, J., Padhan, N., Bhattacharya, S., Guillen, N., and Bhattacharya, A. (2008) Calcium-binding protein 1 of Entamoeba histolytica transiently associates with phagocytic cups in a calcium-independent manner. Cellular microbiology 10, 1373-1389
57. Somlata, Bhattacharya, S., and Bhattacharya, A. (2011) A C2 domain protein kinase initiates phagocytosis in the protozoan parasite Entamoeba histolytica. Nature communications 2, 230
58. Wasmuth, E. V., and Lima, C. D. (2012) Structure and Activities of the Eukaryotic RNA Exosome. The Enzymes 31, 53-75
59. Fox, M. J., and Mosley, A. L. (2016) Rrp6: Integrated roles in nuclear RNA metabolism and transcription termination. Wiley interdisciplinary reviews. RNA 7, 91-104
60. Lange, H., Sement, F. M., and Gagliardi, D. (2011) MTR4, a putative RNA helicase and exosome co-factor, is required for proper rRNA biogenesis and development in Arabidopsis thaliana. The Plant journal : for cell and molecular biology 68, 51-63
61. Malet, H., Topf, M., Clare, D. K., Ebert, J., Bonneau, F., Basquin, J., Drazkowska, K., Tomecki, R., Dziembowski, A., Conti, E., Saibil, H. R., and Lorentzen, E. (2010) RNA channelling by the eukaryotic exosome. EMBO reports 11, 936-942
62. Feigenbutz, M., Garland, W., Turner, M., and Mitchell, P. (2013) The exosome cofactor Rrp47 is critical for the stability and normal expression of its associated exoribonuclease Rrp6 in Saccharomyces cerevisiae. PloS one 8, e80752
63. Schuch, B., Feigenbutz, M., Makino, D. L., Falk, S., Basquin, C., Mitchell, P., and Conti, E. (2014) The exosome-binding factors Rrp6 and Rrp47 form a composite surface for recruiting the Mtr4 helicase. The EMBO journal 33, 2829-2846
64. Lykke-Andersen, S., Brodersen, D. E., and Jensen, T. H. (2009) Origins and activities of the eukaryotic exosome. Journal of cell science 122, 1487-1494
65. Zinder, J. C., and Lima, C. D. (2017) Targeting RNA for processing or destruction by the eukaryotic RNA exosome and its cofactors. Genes & development 31, 88-100
66. Lardenois, A., Liu, Y., Walther, T., Chalmel, F., Evrard, B., Granovskaia, M., Chu, A., Davis, R. W., Steinmetz, L. M., and Primig, M. (2011) Execution of the meiotic noncoding RNA expression program and the onset of gametogenesis in yeast require the conserved exosome subunit Rrp6. Proceedings of the National Academy of Sciences of the United States of America 108, 1058-1063
67. Graham, A. C., Kiss, D. L., and Andrulis, E. D. (2009) Core exosome-independent roles for Rrp6 in cell cycle progression. Molecular biology of the cell 20, 2242-2253
by guest on June 12, 2020http://w
ww
.jbc.org/D
ownloaded from
Exonuclease EhRrp6 in growth stress
19
68. Van Hooser, A. A., Yuh, P., and Heald, R. (2005) The perichromosomal layer. Chromosoma 114, 377-388
69. Blower, M. D., Nachury, M., Heald, R., and Weis, K. (2005) A Rae1-containing ribonucleoprotein complex is required for mitotic spindle assembly. Cell 121, 223-234
70. Nozaki, T., and Bhattacharya, A. (2015) Amebiasis: Biology and Pathogenesis of Entamoeba, Springer
71. Diamond, L. S., Harlow, D. R., and Cunnick, C. C. (1978) A new medium for the axenic cultivation of Entamoeba histolytica and other Entamoeba. Transactions of the Royal Society of Tropical Medicine and Hygiene 72, 431-432
72. Johnson, M., Zaretskaya, I., Raytselis, Y., Merezhuk, Y., McGinnis, S., and Madden, T. L. (2008) NCBI BLAST: a better web interface. Nucleic Acids Res 36, W5-9
73. Eswar, N., Webb, B., Marti-Renom, M. A., Madhusudhan, M. S., Eramian, D., Shen, M. Y., Pieper, U., and Sali, A. (2007) Comparative protein structure modeling using MODELLER. Current protocols in protein science Chapter 2, Unit 2 9
74. Berman, H. M., Westbrook, J., Feng, Z., Gilliland, G., Bhat, T. N., Weissig, H., Shindyalov, I. N., and Bourne, P. E. (2000) The Protein Data Bank. Nucleic acids research 28, 235-242
75. Wiederstein, M., and Sippl, M. J. (2007) ProSA-web: interactive web service for the recognition of errors in three-dimensional structures of proteins. Nucleic Acids Research 35, W407-W410
76. Laskowski, R. A., MacArthur, M. W., Moss, D. S., and Thornton, J. M. (1993) PROCHECK: a program to check the stereochemical quality of protein structures. Journal of Applied Crystallography 26, 283-291
77. Hunter, J. D. (2007) Matplotlib: A 2D graphics environment. Computing In Science & Engineering 9, 90-95
78. Pettersen, E. F., Goddard, T. D., Huang, C. C., Couch, G. S., Greenblatt, D. M., Meng, E. C., and Ferrin, T. E. (2004) UCSF Chimera--a visualization system for exploratory research and analysis. Journal of computational chemistry 25, 1605-1612
79. Gietz, R. D., and Schiestl, R. H. (2007) High-efficiency yeast transformation using the LiAc/SS carrier DNA/PEG method. Nature protocols 2, 31-34
80. Shirai, A., Matsuyama, A., Yashiroda, Y., Arai, R., and Yoshida, M. (2006) Rapid and reliable preparation of total cell lysates from fission yeast.
81. Dey, A., Chitsaz, F., Abbasi, A., Misteli, T., and Ozato, K. (2003) The double bromodomain protein Brd4 binds to acetylated chromatin during interphase and mitosis. Proceedings of the National Academy of Sciences of the United States of America 100, 8758-8763
FIGURES LEGENDS
Figure 1. Domain analysis of EhRrp6. (A) Comparison with Saccharomyces cerevisiae, Homo sapiens
and Trpanosoma brucei Rrp6 is shown. Percent identity and, in parentheses, similarity with respect to
ScRrp6 are indicated below each domain. Amino acid positions of each domain are indicated. (B)
Phylogenetic analysis of Rrp6 homologues. After multiple sequence alignment of all the sequences, 100
replicates (bootstrap) of the sample were generated and the tree was constructed on the basis of distance
from PAM matrix and neighbourhood joining method. Bootstrap values are indicated at the nodes. (Eh, E.
histolytica; Sc, S. cerevisiae; Hs, H. sapiens; Mm, Mus musculus; Dm, D. melanogaster; Tb, T. brucei;
At, A. thaliana)
Figure 2. Sequence and structure comparison of EhRrp6. (A) Active site residues are colored on the
basis of percent identity across the listed species. Asterisks denote the conserved DEDDY residues. The
method used for alignment is described in supplemental method SM 1.1. (B) Modeled structure of
by guest on June 12, 2020http://w
ww
.jbc.org/D
ownloaded from
Exonuclease EhRrp6 in growth stress
20
EhRrp6. The EXO, Linker and HRDC domains are shown. (C) Comparison of EhRrp6 structure (red)
with Rrp6 structures of H. sapiens (Green; PDB ID: 3SAF), S. cerevisiae (Blue; PDB ID: 2HBK) and T.
brucei (Cyan; PDB ID: 4NLB) through structural alignment. (D) Comparison of linker region of EhRrp6
and Rrp6 of H. sapiens, S. cerevisae and T. brucei. The linker regions of respective proteins are colored
as in (C) and the sequences are shown below. The molecular surface of EhRrp6 is visualized in grey and
the conserved DEDD-Y active site residues in the EXO domain are colored in red. (E) Active site of
EhRrp6 is shown. Active site residues D212, E214, D270, Y335 and D339 are labeled along with two
magnesium ions (MgA and MgB).
Figure 3. Exoribonuclease activity of EhRrp6. (A) Purified recombinant 6x-His-tagged WT EhRrp6
(0.1uM) was incubated with 5′-radiolabeled RNA substrate (1uM) in reaction buffer. Composition of
buffer and sequence of the 50 nt AU-rich RNA substrate is given in methods section. The reaction was
performed for the indicated time periods. (B) EhRrp6 mutants in the indicated active site residues (Fig.
2A) were assayed for enzyme activity under the same reaction conditions as in (A) for 120min. (C)
EhRrp6 activity with 60 nt generic RNA substrate. The RNA-fold predicted folding pattern of this RNA
is shown on the right. The reaction conditions were as described in (A). (D-F) The activity of WT EhRrp6
was determined under different conditions of temperature, pH (quantification of gel shown in
supplementary Fig. S5), and Mg2+ ion. In panel F the reaction was performed for 120 min. (G) EhRrp6
(0.1uM) was incubated with 65 nt 5′ radiolabelled ssDNA (1uM) or dsDNA (1uM) for 60 min at 37ᵒC in
reaction buffer as in panel A. The sequence of DNA substrate is given in methods section.
Figure 4. Complementation of growth defect of rrp6∆ yeast strain by EhRRP6. Yeast cells were
transformed with WT or mutant EhRRP6. The mutated active site residues are indicated. Growth is shown
at permissive (30°C) and non-permissive (37°C) temperature.
Figure 5. EhRrp6 down regulation affects 5′-ETS degradation. (A) Schematic representation of E.
histolytica Tet-O-CAT cloning vector with tet- inducible expression of EhRRP6 in sense and antisense
orientation. (B) Western blot analysis of EhRRP6 expression in sense and anti-sense cell lines upon
induction with 30 ug/ml tet. Coactosin is shown as loading control. Band intensity was determined by
densitometry using ImageJ software. Normalized values obtained from an average of three experiments
are plotted below, showing mean ± SD. (*p-value ≤ .05, **p-value ≤ .01 and ***p-value ≤ .001). (C)
Northern blot analysis of total RNA (10 ug) from the indicated cell lines, using 5′-ETS probe; SS, serum
starved. The 5′-ETS sub fragments (indicated by vertical line) migrate as a broad band of 0.7-0.9 kb.
Vertical lines between lanes indicate the spliced borders. (D) Quantitative real time RT-PCR analysis of
relative transcript level of 5.8S and 5.8S+30nt rRNA in the EhRrp6 down regulated cell lines. Primer sets
used are indicated. 18S rRNA was used as an internal control. (Group data represent mean ± SD) (E)
Growth kinetics of various cell lines over a period of 72 h. Equal numbers of cells (3x104/ml) were
inoculated into fresh growth medium. The cells were harvested at indicated time points, resuspended in
PBS and counted by haemocytometer. Data are reported as mean ± SD of 3 independent experiments.
Figure 6. Immuno localization of EhRrp6 in E. histolytica trophozoites. (A) Normal and 24 h serum
starved E. histolytica trophozoites were stained with polyclonal anti-EhRrp6 antibody. Alexa-488 (green)
conjugated secondary antibodies were used for visualization. Nucleus was stained with Hoechst 33342
(blue). In the right panel a few selected cells are enlarged, with nucleus marked by arrow. (B) After 24 hrs
of serum starvation, serum was replenished (SR) for 4 h and 12 h. (C) Quantitative analysis of fluorescent
signals obtained from panels A & B. Intensity of immunostain (EhRrp6) was measured at multiple
locations in the cytosol and nucleus. Five random regions were selected from cytosol and nucleus and
average intensity was computed for each region. This was repeated for ten such cells (N = 10, bars
represent standard error; scale bar, 20 µm). (D) Western blot and RNA-Seq analyses of total cell lysate
from normal and serum starved cells. Anti-EhRrp6 antibody was used for western analysis. Anti-
EhCaBP1 was used as loading control. Band intensity was quantified by densitometric scanning using
ImageJ and the normalized values of EhRrp6 expression were obtained from an average of three
by guest on June 12, 2020http://w
ww
.jbc.org/D
ownloaded from
Exonuclease EhRrp6 in growth stress
21
experiments are plotted, showing mean ± SD. RNA-Seq data were obtained from two biological
replicates. (E) Northern blot analysis of total RNA (10 ug) from normal and 24 h serum starved cells and
after serum replenishment of starved cells, using 5′-ETS probe. The 5′-ETS sub fragments (indicated by
vertical line) migrate as a broad band of 0.7-0.9 kb. Vertical lines between lanes indicate the spliced
borders. (F) Western blot analysis of total cell lysate (TCL), cytoplasmic fraction (CF) and nuclear
fraction (NF) from normal and serum starved cells, using the indicated antibodies. Normalized values of
band intensity are plotted from an average of three experiments. (G and H) EhRrp6 immunolocalization
in trophozoites exposed to heat (42˚C) or oxygen stress (1mM H2O2) for the indicated time periods.
Nuclei are marked by white arrows. (I) Quantitative analysis of fluorescent signals obtained from panels
G and H. Data are reported as mean ± SD of 3 independent experiments (***p-value ≤ .001).
Figure 7. (A) The proteasome system is involved in nuclear loss of EhRrp6p. Normal (N) and serum
starved (SS) cells were treated with either 10 µM lactacystin or 100 µM MG132 for the indicated times.
Equal amounts of nuclear extracts were analysed by western blot using antibodies against EhRrp6 (and
EhCaBP6 as loading control). Normalized values of band intensity from an average of three experiments
are plotted below. The mean values (± SD) are shown. (B- F). EhRrp6 is required for E. histolytica
growth and cell motility. (B). Western blot analysis of EhRRP6 expression in sense and anti-sense cell
lines upon induction with 30 µg/ml tet. Ehcoactosin was used as loading control. Band intensity in each
lane was determined by densitometry using ImageJ software. Normalized values were obtained from an
average of three experiments and values relative to tet (-) are plotted in the respective lower panel. (C)
Hoechst staining of nuclei in AS cells from with tet for 36h. (D) DIC images of indicated cell lines to
show the effect of EhRrp6 on blebbing in E. histolytica. Quantitative analysis of blebs in indicated cell
lines was carried out by selecting 30 cells randomly, and the analysis was carried out three times. (E) Cell
migration was measured by transwell assay (51) . Cells 1.5 × 105 were loaded in the upper chamber and
incubated for 2 hr at 35.5°C. Cells that had migrated towards lower chamber were collected and counted
in a haemocytometer. (F) Growth kinetics of EhRrp6- overexpressed cells during serum starvation. Equal
numbers of cells (3X104/ml) were inoculated into fresh growth medium and tet was either added after 12
hrs. Growth was continued, and at 48 h the cells were subjected to serum starvation. The cells were
harvested at indicated time points, resuspended in PBS and counted by haemocytometer. Mean ± SD for
duplicate cultures are plotted.
Figure 8. EhRrp6 is required for E. histolytica phagocytosis. (A) Spectrophotometric assay for
erythrophagocytosis. RBC uptake assay was performed in the indicated cell lines. Cells were incubated
with RBCs for different time points and the amount of RBC uptake was determined
spectrophotometrically using RBC solubilisation assay as described in “Experimental procedures”. The
experiments were carried out three times independently. (B) Quantitative analysis of phagocytic cups.
Thirty cells were randomly selected (in three independent experiments) and the number of phagocytic
cups were counted for each cell line grown with tet. (C) To look at EhRrp6 localization with respect to
phagocytic cups, cells grown for 48h were harvested and incubated with RBCs for indicated time periods
at 37°C and subsequently fixed for further processing. Cells were immunostained with EhRRP6-specific
antibody, followed by Alexa-488-conjugated secondary antibody (green). F-actin was stained with
TRITC-conjugated phalloidin (red). Slides were viewed using Nikon confocal microscope. Arrowhead
indicates phagocytic cups, cross marks the closure of cups before scission, and star marks the phagosome.
Figure 9. Effect of EhRrp6 depletion on expression of phagocytosis related genes. (A) Selected genes
known to be involved in phagocytosis (EhCaBP3, EhRho1, EhCaBP1, EhCaBP6, EhC2PK, EhARP2/3)
and EhCoactosin were studied. Protein levels were determined by western blotting in the indicated cell
lines. Tet addition (30µg/ml) was for 36hrs. Ehcoactosin was used as loading control. Band intensity in
each lane was determined by densitometry using ImageJ software. Normalized values were obtained from
an average of three experiments and values relative to TOC (+tet) cells are indicated at the bottom of each
lane. (B) Immunolocalization of phagocytosis related proteins in EhRrp6-depleted cells and control cells,
grown for 36h in presence of tet and incubated with RBCs for 10 min. Phagocytic cups were visualized
by guest on June 12, 2020http://w
ww
.jbc.org/D
ownloaded from
Exonuclease EhRrp6 in growth stress
22
by Ehactin staining with TRITC-phalloidin (red). Indicated proteins were immunostained with specific
antibodies, followed by secondary antibodies conjugated with Alexa-488 (green) (for EhRrp6) and Alexa-
405(blue) (for EhCaBP1, EhRho1 and EhCaBP3). Arrow shows the phagocytic cups. Scale bar indicates
10μm. For quantitative analysis (shown in panels on the right), relative pixel intensity of fluorescent
signals from cells stained with indicated proteins were calculated from actively phagocytosing amoebic
cells. Relative intensities were calculated for each marker by NIS‐Elements AR 3.0. This analysis was
carried out with 30 randomly selected cells. (N = 30, bar represents standard error). (C) Quantitative real-
time PCR analysis of relative transcript levels of EhRrp6, EhCaBP3, EhRho1 and EhC2PK genes in the
indicated cell lines. EhCaBP1 was used as internal control. (Group data represent mean ± SD).
by guest on June 12, 2020http://w
ww
.jbc.org/D
ownloaded from
Exonuclease EhRrp6 in growth stress
23
Figure 1.
by guest on June 12, 2020http://w
ww
.jbc.org/D
ownloaded from
Exonuclease EhRrp6 in growth stress
24
Figure 2.
by guest on June 12, 2020http://w
ww
.jbc.org/D
ownloaded from
Exonuclease EhRrp6 in growth stress
25
Figure 3.
by guest on June 12, 2020http://w
ww
.jbc.org/D
ownloaded from
Exonuclease EhRrp6 in growth stress
26
Figure 4.
by guest on June 12, 2020http://w
ww
.jbc.org/D
ownloaded from
Exonuclease EhRrp6 in growth stress
27
Figure 5.
by guest on June 12, 2020http://w
ww
.jbc.org/D
ownloaded from
Exonuclease EhRrp6 in growth stress
28
Figure 6.
by guest on June 12, 2020http://w
ww
.jbc.org/D
ownloaded from
Exonuclease EhRrp6 in growth stress
29
Figure 7.
by guest on June 12, 2020http://w
ww
.jbc.org/D
ownloaded from
Exonuclease EhRrp6 in growth stress
30
Figure 8.
by guest on June 12, 2020http://w
ww
.jbc.org/D
ownloaded from
Exonuclease EhRrp6 in growth stress
31
Figure 9.
by guest on June 12, 2020http://w
ww
.jbc.org/D
ownloaded from
Singh, Ashwini Kumar Ray, Naidu Subbarao, Alok Bhattacharya and Sudha BhattacharyaShashi Shekhar Singh, Sarah Naiyer, Ravi Bharadwaj, Amarjeet Kumar, Yatendra Pratap
EhRrp6 and its role in growth and erythrophagocytosis 3'-5'exoribonucleaseEntamoeba histolyticaStress-induced nuclear depletion of
published online August 31, 2018J. Biol. Chem.
10.1074/jbc.RA118.004632Access the most updated version of this article at doi:
Alerts:
When a correction for this article is posted•
When this article is cited•
to choose from all of JBC's e-mail alertsClick here
by guest on June 12, 2020http://w
ww
.jbc.org/D
ownloaded from
VOLUME 293 (2018) PAGES 16242–16260DOI 10.1074/jbc.AAC118.006754
Correction: Stress-induced nuclear depletion ofEntamoeba histolytica 3�-5� exoribonuclease EhRrp6 andits role in growth and erythrophagocytosis.Shashi Shekhar Singh, Sarah Naiyer, Ravi Bharadwaj, Amarjeet Kumar,Yatendra Pratap Singh, Ashwini Kumar Ray, Naidu Subbarao,Alok Bhattacharya, and Sudha Bhattacharya
A grant was inadvertently omitted from the grant support footnote.The following grant should be included: This work was supported inpart by DST-PURSE (to N. S.).
ADDITIONS AND CORRECTIONS
19510 J. Biol. Chem. (2018) 293(50) 19510 –19510
© 2018 Singh et al. Published under exclusive license by The American Society for Biochemistry and Molecular Biology, Inc.
Top Related