biologia exercicio

download biologia exercicio

of 50

  • date post

  • Category


  • view

  • download


Embed Size (px)

Transcript of biologia exercicio


Assunto: Citologia1- (UNIFESP-SP) No ano de 2009, o mundo foi alvo da pandemia provocada pelo vrus influenza A (H1N1), causando perdas econmicas, sociais e de vidas. O referido vrus possui, alm de seus receptores proticos, uma bicamada lipdica e um genoma constitudo de 8 genes de RNA. Considerando: 1. a sequncia inicial de RNA mensageiro referente a um dos genes deste vrus: 5 AAAUGCGUUACGAAUGGUAUGCCUACUGAAU 3

gabaritoresponda: a) Qual ser a sequncia de aminocidos que resultar da traduo da sequncia inicial de RNA mensageiro, referente a um dos genes deste vrus indicada em 1? b) Considerando os mecanismos de replicao do genoma viral, qual a principal diferena entre o vrus da gripe e o vrus que causa a AIDS?



Assunto: Citologia2- (UNIFESP-SP) A sonda Phoenix, lanada pela NASA, explorou em 2008 o solo do planeta Marte, onde se detectou a presena de gua, magnsio, sdio, potssio e cloretos. Ainda no foi detectada a presena de fsforo naquele planeta. Caso esse elemento qumico no esteja presente, a vida, tal como a conhecemos na Terra, s seria possvel se em Marte surgissem formas diferentes de a) DNA e protenas.


b) cidos graxos e trifosfato de adenosina. c) trifosfato de adenosina e DNA. d) RNA e acares. e) cidos graxos e DNA 3- (UFRS) Assinale com V (verdadeiro) ou F (falso) as seguintes consideraes sobre o colesterol, um lipdio do grupo dos esterides. ( ( ( ( ( ) ) ) ) ) Ele participa da composio da membrana plasmtica das clulas animais. Ele sintetizado no pncreas, degradado no fgado e excretado na forma de sais biliares. Ele precursor dos hormnios sexuais masculino e feminino. Ele precursor da vitamina B. As formas de colesterol HDL e LDL so determinadas pelo tipo de lipoprotena que transporta o colesterol.

A seqncia correta de preenchimento dos parnteses, de cima para baixo, a) V - F - V - F - V. b) F - V - F - F - V. c) V - V - F - V - F. d) F - F - V - V - F. e) V - V - F - V - V.



Assunto: Citologia4- (UNIFESP-SP) Considere as trs afirmaes: I. Somos constitudos por clulas mais semelhantes s amebas do que s algas unicelulares. II. Meiose um processo de diviso celular que s ocorre em clulas diplides. III. Procariontes possuem todas as organelas citoplasmticas de um eucarionte, porm no apresentam ncleo. Est correto o que se afirma em:


a) I, apenas. b) II, apenas. c) III, apenas. d) I e II, apenas. e) I, II e III. 5- (UEG-GO) A ingesto diria de leite pode causar perturbaes digestivas em milhes de brasileiros que apresentam intolerncia a esse alimento, a qual provocada pela deficincia de lactase no adulto, uma condio determinada geneticamente e de prevalncia significativa no Brasil. "CINCIA HOJE", v. 26, n. 152, ago. 1999, p. 49. [Adaptado]. Tendo em vista o tema apresentado acima, INCORRETO afirmar: a) A lactose, presente no leite, bem como outros carboidratos de origem animal representam uma importante fonte de energia na dieta humana. b) A lactase, assim como outras enzimas, tem sua atividade influenciada por diversos fatores, tais como a temperatura e o pH. c) A lactase uma enzima que age sobre a lactose, quebrando-a em duas molculas, sendo uma de maltose e outra de galactose. d) O efeito simultneo da desnutrio e das infeces intestinais pode resultar em deficincia secundria de lactase, aumentando ainda mais o nmero de pessoas com intolerncia lactose.



Assunto: Citologia6- (UNIFESP-SP) Analise o diagrama.


Indique a alternativa que identifica corretamente os conceitos correspondentes a 1, 2, 3 e 4. a) 1 = em clulas diplides; 2 = na mitose; 3 = na meiose; 4 = em clulas haplides. b) 1 = em clulas haplides; 2 = na meiose; 3 = na mitose; 4 = em clulas diplides. c) 1 = na meiose; 2 = em clulas haplides; 3 = na mitose; 4 = em clulas diplides.

d) 1 = na meiose; 2 = na mitose; 3 = em clulas diplides; 4 = em clulas haplides.e) 1 = na mitose; 2 = em clulas diplides; 3 = em clulas haplides; 4 = na meiose.



Assunto: Citologia7- (UECE) Sabe-se que o carboidrato o principal fator a contribuir para a obesidade, por entrar mais diretamente na via glicoltica, desviando-se para a produo de gordura, se ingerido em excesso. Uma refeio composta de bolacha (amido processado industrialmente) e vitamina de sapoti (sapoti, rico em frutose), leite (rico em lactose) e acar (sacarose processada industrialmente) pode contribuir para o incremento da obesidade, por ser, conforme a descrio acima, visivelmente rica em a) lipdios.


b) protenas. c) glicdios. d) vitaminas.

8- (UFC-CE) Sobre as substncias que compem os seres vivos, correto afirmar que: (01) os carboidratos, os lipdios e as vitaminas so fontes de energia para os seres vivos; (02) a gua a substncia encontrada em maior quantidade nos seres vivos; (04) alm de sua funo energtica, os carboidratos esto presentes na formao de algumas estruturas dos seres vivos; (08) as gorduras constituem o principal componente estrutural dos seres vivos; (16) os seres vivos apresentam uma composio qumica mais complexa do que a matria bruta, sendo formados por substncias orgnicas, como as protenas, os lipdios, os carboidratos, as vitaminas e os cidos nuclicos. Soma ( )



Assunto: Citologia9- (UFABC-SP) O Saccharomyces fermento biolgico, usado pelas donas de casa na produo de po. Normalmente, aps manusear a massa, e tendo feito os pes, antes de ass-los, ela pega um pedao da massa e faz uma bolinha que colocada num copo com gua. Quando a bolinha sobe, ela coloca os pes para assar. Considere a figura a seguir que representa a clula do Saccharomyces e algumas regies indicadas por nmeros.

gabaritoa) Considerando o Saccharomyces que se encontra no interior da massa, escreva a reao responsvel pela diminuio da densidade da bolinha e indique a regio numerada onde ela ocorre. b) Sendo o Saccharomyces um organismo anaerbico facultativo, qual deles consome mais glicose: os que esto no interior da massa ou os que ficam na superfcie? Explique.



Assunto: Citologia10- (UFABC-SP) O local onde ocorrem os principais eventos da digesto humana o intestino delgado. Nele so encontradas as microvilosidades e uma mistura de sucos digestivos. No esquema simplificado a seguir, est representada por setas a trajetria de algumas substncias para os capilares sangneos e destes para as clulas intestinais.

gabaritoa) Mencione uma substncia orgnica, resultante da digesto de protenas, que pode seguir a trajetria da

seta pontilhada e uma substncia inorgnica que pode seguir a trajetria da seta contnua.b) Suponha que uma pessoa tivesse perdido a capacidade de gerar clulas com microvilosidades. Que conseqncia ela teria no aproveitamento dos nutrientes? E se as clulas intestinais deixassem de receber a substncia inorgnica do sangue, que problema ocorreria? Explique cada situao.



Assunto: Citologia11- (UFSC) A gua a substncia mais abundante na constituio dos mamferos. encontrada nos compartimentos extracelulares (lquido intersticial), intracelulares (no citoplasma) e transcelulares (dentro de rgos como a bexiga e o estmago). Sobre a gua e sua presena nos mamferos CORRETO afirmar que: (01) a quantidade em que encontrada nos organismos invarivel de espcie para espcie. (02) com o passar dos anos, existe uma tendncia de aumentar seu percentual em um determinado tecido.


(04) importante fator de regulao trmica dos organismos. (08) em tecidos metabolicamente ativos inexistente. (16) participa da constituio dos fluidos orgnicos que transportam substncias dissolvidas por todo o corpo. (32) constitui meio dispersante para facilitar a realizao das reaes qumicas. Soma ( )



Assunto: Citologia12- (UFBA) A figura ilustra mecanismos moleculares de resistncia bacteriana a antibiticos, a saber: a) o recrutamento de uma enzima que destri ou incapacita a droga; b) o uso de uma bomba no envoltrio celular que expulsa a droga antes que ela aja; c) a substituio da protena-alvo da droga por uma verso que a droga no reconhece.

gabaritoA partir da anlise das informaes, explique a resistncia bacteriana a antibiticos, relacionando-a estratgia reprodutiva do grupo.



Assunto: Citologia13- (PUC-PR) As enzimas so catalisadores orgnicos e atuam na ativao das reaes biolgicas. Em relao s enzimas, podemos afirmar que: a) seu poder cataltico resulta da capacidade de aumentar a energia de ativao das reaes. b) so catalisadores eficientes a qualquer substrato. c) atuam em qualquer temperatura, pois sua ao cataltica independe de sua estrutura espacial. d) sendo protenas, por mudanas de pH, podem perder seu poder cataltico ao se desnaturarem.


e) no podem ser reutilizadas, pois reagem como substrato, tornando-se parte do produto.

14- (UFSC) Protenas so molculas essenciais vida, atuando como enzimas, hormnios, anticorpos, antibiticos e agentes anti-tumorais, alm de estar presentes nos cabelos, na l, na seda, em unhas, carapaas, chifres e penas dos seres vivos. Em relao s protenas CORRETO afirmar que: (01) so biopolmeros constitudos de aminocidos, os quais so unidos entre si por meio de ligaes peptdicas. (02) a produo destas molculas se d sem gasto de energia pelos organismos, j que os aminocidos provm da alimentao. (04) todas as protenas possuem peso molecular idntico, caracterstica especial dessas m