nterococcus sp CIDADE DO NATAL-RN · 2019-06-09 · Oliveira, Em ília Sousa de. Emerg ê ncia de...

of 99 /99
UNIVERSIDADE FEDERAL DO RIO GRANDE DO NORTE CENTRO DE BIOCIÊNCIAS PROGRAMA DE PÓS-GRADUAÇÃO EM CIÊNCIAS BIOLÓGICAS EMÍLIA SOUSA DE OLIVEIRA EMERGÊNCIA DE Enterococcus sp. RESISTENTES À VANCOMICINA NA CIDADE DO NATAL-RN Natal 2019

Transcript of nterococcus sp CIDADE DO NATAL-RN · 2019-06-09 · Oliveira, Em ília Sousa de. Emerg ê ncia de...

Page 1: nterococcus sp CIDADE DO NATAL-RN · 2019-06-09 · Oliveira, Em ília Sousa de. Emerg ê ncia de enterococcus sp. resistentes à vancomicina na cidade do Natal - RN / Em ília Sousa

UNIVERSIDADE FEDERAL DO RIO GRANDE DO NORTE CENTRO DE BIOCIÊNCIAS

PROGRAMA DE PÓS-GRADUAÇÃO EM CIÊNCIAS BIOLÓGICAS

EMÍLIA SOUSA DE OLIVEIRA

EMERGÊNCIA DE Enterococcus sp. RESISTENTES À VANCOMICINA NA

CIDADE DO NATAL-RN

Natal 2019

Page 2: nterococcus sp CIDADE DO NATAL-RN · 2019-06-09 · Oliveira, Em ília Sousa de. Emerg ê ncia de enterococcus sp. resistentes à vancomicina na cidade do Natal - RN / Em ília Sousa

Emília Sousa de Oliveira

EMERGÊNCIA DE Enterococcus sp. RESISTENTES À VANCOMICINA NA

CIDADE DO NATAL-RN

Dissertação apresentada ao Programa Pós-

Graduação em Ciências Biológicas – linha de

pesquisa Biológica Parasitária e Microbiologia,

da Universidade Federal do Rio Grande do

Norte como requisito para obtenção parcial do

grau de Mestre.

Orientadora: Profª Dra. Maria Celeste Nunes de

Melo

Natal 2019

Page 3: nterococcus sp CIDADE DO NATAL-RN · 2019-06-09 · Oliveira, Em ília Sousa de. Emerg ê ncia de enterococcus sp. resistentes à vancomicina na cidade do Natal - RN / Em ília Sousa

Universidade Federal do Rio Grande do Norte - UFRN

Sistema de Bibliotecas - SISBI

Catalogação de Publicação na Fonte. UFRN - Biblioteca Central Zila Mamede

Oliveira, Emília Sousa de.

Emergência de enterococcus sp. resistentes à

vancomicina na cidade do Natal-RN / Emília Sousa de Oliveira. - 2019.

99 f.: il.

Dissertação (mestrado) - Universidade Federal do Rio

Grande do Norte, Centro de Biociências, Programa de Pós

Graduação em Ciências Biológicas, Natal, RN, 2019. Orientadora: Profa. Dra. Maria Celeste Nunes de Melo.

1. Enterococcus - Dissertação. 2. Resistência à

vancomicina - Dissertação. 3. Cultura de vigilância -

Dissertação. 4. PFGE - Dissertação. 5. MLST - Dissertação.

6. Dispersão clonal - Dissertação. I. Melo, Maria Celeste

Nunes de. II. Título.

RN/UF/BCZM CDU

615.33

Elaborado por Ana Cristina Cavalcanti Tinôco - CRB-15/262

Page 4: nterococcus sp CIDADE DO NATAL-RN · 2019-06-09 · Oliveira, Em ília Sousa de. Emerg ê ncia de enterococcus sp. resistentes à vancomicina na cidade do Natal - RN / Em ília Sousa

Este trabalho de pesquisa foi realizado nos seguintes centros de pesquisa:

Laboratório Principal: Laboratório de Bacteriologia Médica do Departamento

Microbiologia e Parasitologia da Universidade Federal do Rio Grande do Norte,

Natal, Rio Grande do Norte, Brasil. Sob orientação da Profa. Dra. Maria Celeste

Nunes de Melo.

Laboratório de Microbiologia da Faculdade de Farmácia da Universidade de

Porto em Porto, Portugal. Sob orientação da Profa. Dra. Luíza Peixe e com auxílio da

Profa. Dra. Carla Novais e da pós-doutoranda Dra. Ana Freitas.

Page 5: nterococcus sp CIDADE DO NATAL-RN · 2019-06-09 · Oliveira, Em ília Sousa de. Emerg ê ncia de enterococcus sp. resistentes à vancomicina na cidade do Natal - RN / Em ília Sousa

DEDICATÓRIA

Dedico esse trabalho à Deus

e a minha família.

Page 6: nterococcus sp CIDADE DO NATAL-RN · 2019-06-09 · Oliveira, Em ília Sousa de. Emerg ê ncia de enterococcus sp. resistentes à vancomicina na cidade do Natal - RN / Em ília Sousa

AGRADECIMENTO

Agradeço primeiramente a Deus por ter me acompanhado em toda a

trajetória dando-me forças quando achava que não conseguiria continuar e

lembrando-me sempre que com Ele tudo é possível.

À minha orientadora, Profa. Dra. Maria Celeste, por acreditar em mim,

desde o momento que cheguei ao laboratório na graduação e por embarcar comigo

em mais uma etapa do meu processo de formação. E pelos vastos ensinamentos

que me fizeram conhecer melhor e amar a pesquisa.

Às professoras e pesquisadoras da Universidade de Porto, em especial a

Prof. Luíza Peixe – coordenadora do Laboratório de Microbiologia da Universidade

de Farmácia-, a Prof. Carla Novais e a pós-doutoranda Ana Feitas por aceitarem a

colaboração e por me acolherem no laboratório para a realização dos experimentos.

Que mesmo com pouco tempo de contato, puderam me ensinar muito sobre os

Enterococcus e tornaram os experimentos na Universidade de Porto uma

experiência imensurável.

A todos do LaBMed, aos que já saíram, aos que permanecem e aos que

acabaram de entrar. E principalmente aqueles que me ajudaram na realização dessa

pesquisa, em especial, as alunas de Iniciação Científica Camila e Isabelle que tive o

prazer de tutoriar.

Às técnicas do laboratório de microbiologia por estarem sempre dispostas

a ajudar nas muitas vezes que precisei utilizar algum equipamento do laboratório

escola ou mesmo em responder as minhas inúmeras dúvidas.

Aos meus pais, pela formação, sempre incentivado ao estudo e pesquisa,

pelo carinho e apoio e por serem meu alicerce nessa jornada. Aos meus irmãos por

estarem presentes em todos os momentos, mesmo longe ainda estão comigo sendo

sempre o meio alicerce. Às minhas tias e tios por me apoiarem sempre e me

incentivarem ao estudo e dedicação sendo exemplos de vida.

Aos meus amigos e colegas que foram de suma importância e essenciais

nessa caminhada. Em especial ao grupo 9 - Sara Ester, Raquel, Talita, Gustavo,

Daniel, Pedro, Marcel e Renata. Às minhas amigas de longa data Mirella, Andréa,

Maria Júlia, Stella, por estarem sempre comigo me apoiando. E às amigas Bruna

Évora e Aldemara que estiveram comigo nesse mestrado.

Page 7: nterococcus sp CIDADE DO NATAL-RN · 2019-06-09 · Oliveira, Em ília Sousa de. Emerg ê ncia de enterococcus sp. resistentes à vancomicina na cidade do Natal - RN / Em ília Sousa

À Coordenação de Aperfeiçoamento de Pessoal de Nível Superior –

CAPES, pela concessão da bolsa de estudo. Às Pró-reitoria de Pós-Graduação, a

Pró-Reitoria de Pesquisa, o Centro de Biociências e o Programa de Pós-Graduação

pelo auxílio com o envio do material biológico para os experimentos realizados na

Universidade de Porto como também com a minha ida até Porto em Portugal.

A todas as pessoas que contribuíram direta ou indiretamente com a minha

formação.

Page 8: nterococcus sp CIDADE DO NATAL-RN · 2019-06-09 · Oliveira, Em ília Sousa de. Emerg ê ncia de enterococcus sp. resistentes à vancomicina na cidade do Natal - RN / Em ília Sousa

“Será que você não sabe? Nunca ouviu falar? O Senhor é o Deus eterno, o Criador

de toda a terra. Ele não se cansa nem fica exausto, sua sabedoria é insondável.

Ele fortalece ao cansado e dá grande vigor ao que está sem forças.

Até os jovens se cansam e ficam exaustos, e os moços tropeçam e caem;

mas aqueles que esperam no Senhor renovam as suas forças. Voam bem alto como

águias; correm e não ficam exaustos, andam e não se cansam.”

Isaías 40:28-31

Page 9: nterococcus sp CIDADE DO NATAL-RN · 2019-06-09 · Oliveira, Em ília Sousa de. Emerg ê ncia de enterococcus sp. resistentes à vancomicina na cidade do Natal - RN / Em ília Sousa

RESUMO

Surtos e dispersões clonais do gênero Enterococcus resistente à vancomicina (ERV) vêm ocasionando um dos maiores problemas de saúde pública em todo o mundo. No Brasil, diversos estudos já reportaram esse cenário por ERV, sendo a maioria ocasionado pelas espécies Enterococcus faecalis e Enterococcus faecium. O objetivo desse estudo foi caracterizar, a nível molecular, isolados de ERV de pacientes oriundos de diferentes hospitais de Natal/RN. Foram analisados 62 isolados de cultura de vigilância e de outros espécimes clínicos de ERV de 51 pacientes de 7 hospitais, no período de dois anos (2015-2016). Os isolados foram identificados a nível de espécie por primers específicos sodA e ddl pela técnica de Reação de Cadeia em Polimerase (PCR). A susceptibilidade aos antibióticos foi avaliada por disco-difusão, fita contendo antibiótico (vancomicina) em gradiente e diluição em ágar (teicoplanina) (EUCAST, 2018; CLSI, 2018). As pesquisas para os determinantes da resistência à vancomicina (vanA/vanB) e da virulência (cylA/asa1/gelE/esp) foram analisadas pela PCR. A relação clonal foi observada pela técnica de Eletroforese em Campo Pulsado (PFGE) e isolados representativos dos principais clones foram também avaliados pela técnica de Tipagem por Sequenciamento de Multilocus (MLST). Sessenta e um isolados foram identificados como Enterococcus faecalis e somente um como Enterococcus faecium. A resistência à vancomicina, ciprofloxacina, tetraciclina e eritromicina foram observados em todos os isolados, e 98,4% foram resistentes à teicoplanina. A CIM para vancomicina e para a teicoplanina observada foi de 16 até ≥ 256 µg/ml e 4 até

64µg/L, respectivamente. Ademais, 88,7% (n=55) e 40,3% (n=25) dos isolados também foram resistentes à gentamicina e estreptomicina, respectivamente. Nenhum isolado foi resistente à linezolida ou ao cloranfenicol. Somente o E. faecium foi resistente à ampicilina. Todos os isolados apresentaram o gene vanA. A ocorrência dos fatores de virulência para E. faecalis incluiu gelE (98,4%; n=60), asa1 (100%; n=61), cylA (16,4%; n=10) e esp (9,8%; n=6). Dois perfis PFGE foram identificados: clone A (50,8%; n=31) e clone B (49,18%; n=30). Os MLST dos isolados representantes foram tipados como ST525 e ST6. Os dois perfis clonais foram co-circulantes nos hospitais pesquisados durante o período do estudo. Essa pesquisa destacou uma alta taxa de colonização de pacientes por E. faecalis resistente à vancomicina com operon vanA e uma disseminação silenciosa de dois clones previamente associados a infecções humanas no Brasil (ST525) e no mundo (ST6). Embora a emergência do ERV em Natal permaneça sem esclarecimento, a disseminação inter-hospitalar durante um longo período de tempo destaca a necessidade de medidas preventivas que possam conter esse cenário de potencial epidemia de infecções por ERV.

PALAVRA-CHAVES: Enterococcus resistente à vancomicina; dispersão clonal; cultura de vigilância; PFGE; MLST.

Page 10: nterococcus sp CIDADE DO NATAL-RN · 2019-06-09 · Oliveira, Em ília Sousa de. Emerg ê ncia de enterococcus sp. resistentes à vancomicina na cidade do Natal - RN / Em ília Sousa

ABSTRACT

Vancomycin-resistant enterococci (VRE) clonal spread and outbreaks cause major problems in health institutions around the world. In Brazil, several available studies describe VRE outbreaks or clonal dissemination scenarios mostly involving Enterococcus faecalis and Enterococcus faecium. We aimed to characterize, at molecular level, the VRE recovered from patient in different hospitals of Natal. Sixty-two VRE isolates from surveillance culture and others clinical specimens were collected from 51 patients of 7 hospitals, for two years (2015-2016). Identification at the species level by specific primers sodA and ddl was performed by Polymerase Chain Reation (PCR). Susceptibility to antibiotics were assessed by disk-difusion, MIC test strip (vancomycin) and agar dilution (teicoplanin) (EUCAST, 2018; CLSI, 2018). Search of vancomycin resistance (vanA/vanB) and putative virulence (cylA/asa1/gelE/esp) genes was performed by PCR. Clonal relationship was evaluated by Pulse-filed Gel Electrophoresis (PFGE), and representative strains from main PFGE types also by Multilocus Sequence Typing (MLST). Sixty-one isolates were identified as Enterococcus faecalis and only one as Enterococcus faecium. Resistance to vancomycin, teicoplanin ciprofloxacin, tetracycline and erythromycin were observed in all isolates, and 98,4% were to teicoplanin. Vancomycin and teicoplanin MICs were 16 to ≥ 256 µg/ml and 4 to 64µg/L, respectively. In addition,

88,7% (n=55) and 40,3% (n=25) isolates were also resistant to gentamicin or streptomycin, respectively. None was resistant to linezolid or chloramphenicol. Just the E. faecium was ampicillin resistant. Operon vanA was observed in all isolates. Occurrence of E. faecalis virulence factors included gelE (98,4%; n=60), asa1 (100%; n=61), cylA (16,4%; n=10) and esp (9,8%; n=6). Two PFGE types were identified; type A (50,8%; n=31) and type B (49,18%; n=30). The MLSTs of the representative isolates were typed as ST525 and ST6. Both clones were co-circulating during the period of the study. This study highlights a high rate of patient colonization with vancomycin-resistant E. faecalis with vanA and a silent spread of two clones previously associated with human infections in Brazil (ST525) or worldwide (ST6). Although their transmission routes of this ERV in Natal remain to clarify, the inter-hospital spread during a long period of time highlight the need of preventions measures to contain a potential ERV infection epidemic scenario. KEY-WORDS: Vancomycin-resistant Enterococcus; clonal spread; surveillance culture; PFGE; MLST.

Page 11: nterococcus sp CIDADE DO NATAL-RN · 2019-06-09 · Oliveira, Em ília Sousa de. Emerg ê ncia de enterococcus sp. resistentes à vancomicina na cidade do Natal - RN / Em ília Sousa

XI

LISTA ILUSTRAÇÕES

Figura 1: Organização genética dos três principais operons van (VanA, VanB,

VanC), onde as setas indicam a direção da transcrição. Setas verdes: genes de

regulação; setas vermelhas: genes de resistência; setas laranjas: genes acessórios.

..................................................................................................................................... 35

Figura 2: Produto da PCR para os genes sodA, específico para a espécie E. faecalis

e ddl, específico para a espécie E. faecium. .............................................................. 50

Figura 3: Gel demonstrando os amplicons vanA e vanB, determinantes de

resistência à vancomicina. .......................................................................................... 53

Figura 4: Gel representando os amplicons para os genes de virulência pesquisados

(cylA, gelE, asa1 e esp), pela técnica de PCR. .......................................................... 53

Figura 5: Gel com os perfis de PFGE. A: isolados do clone A; B: isolados do clone B;

Seta azul: controle do clone A (Ef.71); Seta vende: controle do clone B (Ef.24). ...... 56

Gráfico 1: Perfil de resistência em porcentagem dos isolados de Enterococcus aos

antimicrobianos testados. ........................................................................................... 51

Gráfico 2: Distribuição dos determinantes da virulência pesquisados. ...................... 54

Page 12: nterococcus sp CIDADE DO NATAL-RN · 2019-06-09 · Oliveira, Em ília Sousa de. Emerg ê ncia de enterococcus sp. resistentes à vancomicina na cidade do Natal - RN / Em ília Sousa

XII

LISTA DE TABELAS

Tabela 1: Resistência intrínseca e extrínseca dos enterococos. ............................... 28

Tabela 2: Antibióticos para avaliação do fenótipo da resistência à níveis elevados de

aminoglicosídios (HLAR). ............................................................................................ 33

Tabela 3: Características dos principais operons van. ............................................... 35

Tabela 4: Primers utilizados para confirmação da espécie dos isolados de

Enterococcus. .............................................................................................................. 41

Tabela 5: Primers utilizados para avaliar a resistência à vancomicina ...................... 44

Tabela 6: Primers para pesquisa dos genes de virulência esp, cylA, gelE e asa1. ... 45

Tabela 7: Primers utilizados na análise do MLST....................................................... 47

Tabela 8: Distribuição dos ERV em relação ao hospital de origem e as espécies

identificadas................................................................................................................. 49

Tabela 9: Perfil de susceptibilidade para o teste do fenótipo de resistência a níveis

elevados de aminoglicosídios. .................................................................................... 52

Tabela 10: Distribuição do genótipo de virulência para a espécie E. faecalis. .......... 54

Tabela 11: Distribuição dos perfis PFGE da espécie E. faecalis com relação ao

hospital de origem e determinantes de virulência. ..................................................... 57

Tabela 12: Perfil alélico encontrado após o sequenciamento por MLST e a análise

dos locus dos isolados ................................................................................................ 58

Page 13: nterococcus sp CIDADE DO NATAL-RN · 2019-06-09 · Oliveira, Em ília Sousa de. Emerg ê ncia de enterococcus sp. resistentes à vancomicina na cidade do Natal - RN / Em ília Sousa

XIII

LISTA DE ABREVIAÇÕES DE SIGLAS

AAC(6’) Enzima 6’-acetiltransferase

ANVISA Agência Nacional de Vigilância Sanitária

APH(2’’) Enzima 2-fosfotransferase

AS Substância de agregação

ATCC American Type Culture Collection

BRCAST Brazilian Committee on Antimicrobial Susceptibility Testing

BHI Brain Heart Infusion

CC Complexo Clonal

CCIH Comissão de Controle de Infecção Hospitalares

CIM Concentração Inibitória Mínima

CLSI Clinical and Laboratory Stardards Institute

Cyl Citolisina

DNA Ácido Desoxirribonucleico

D-Ala D-Alanina

D-Lac D-Lactase

D-Ser D-Serina

EUCAST European Committee on Antimicrobial Susceptibility Testing

ERV Enterococcus resistentes à vancomicina

Esp Proteína de superfície de enterococos

Gel Gelatinase

HLAR High-Level Aminoglycoside Resistance

IRAS Infecções relacionadas à assistência à saúde

LaBMed Laboratório de Bacteriologia Médica

LPS Lipopolissacarídeo

LPxTG Leucina-Prolina-any-Treonina-Glicina

MIC Minimal Inibitory Concentration

MLST Multilocus Sequence Typing

MMR Micro-organimos Multiressistentes

mRNA RNA mensageiro

MRSA Methicillin-Resistant Staphylococcus aureus

Page 14: nterococcus sp CIDADE DO NATAL-RN · 2019-06-09 · Oliveira, Em ília Sousa de. Emerg ê ncia de enterococcus sp. resistentes à vancomicina na cidade do Natal - RN / Em ília Sousa

XIV

OD Origem desconhecida

OMS Organização Mundial de Saúde

PBP Penicilin Binding Protein

PCR Polimerase Chain Reaction

PFGE Pulsed-Field Gel Electrophoresis

pH Potencial de Hidrogênio Iônico

PM Peso molecular

PYR Pirrolodonil Arilamidase

rDNA DNA ribossômico

RGD Argenina-Glicina-Aspartato

RNA Ácido Ribonucleico

rRNA RNA ribossomal

ST Sequence Types

tRNA RNA transportador

TRL Receptor Toll-like

Tn transposons

UFC Unidades Formadora de Colônias

UTI Unidade de Terapia Intensiva

VRE Vancomycin-Resistent Enterococcus

Page 15: nterococcus sp CIDADE DO NATAL-RN · 2019-06-09 · Oliveira, Em ília Sousa de. Emerg ê ncia de enterococcus sp. resistentes à vancomicina na cidade do Natal - RN / Em ília Sousa

XV

LISTA DE SÍMBOLOS

µm Micrometro

°C Graus celsius

° Grau

β Beta

mg Miligrama

mL Mililitro

µL Microlitro

µg/mL Micrograma por mililitro

mg/mL Miligrama por mililitro

µL/mL Microlitro por mililitro

% Porcento

> Maior

≥ Maior igual

≤ Menor igual

= Igual

± Mais ou menos

pb Pares de base

® Marca registrada

M Mol

mM Micromol

V Voltz

U Unidade

V/cm Voltz por centímetro

rpm Rotação por minuto

U/µL Unidade por microlitro

U/mL Unidade por mililitro

Page 16: nterococcus sp CIDADE DO NATAL-RN · 2019-06-09 · Oliveira, Em ília Sousa de. Emerg ê ncia de enterococcus sp. resistentes à vancomicina na cidade do Natal - RN / Em ília Sousa

SUMÁRIO

1 INTRODUÇÃO .................................................................................................. 18

2 REFERENCIAL TEÓRICO ............................................................................... 19

2.1 GÊNERO ENTEROCOCCUS .............................................................................. 19

2.1.1 IMPORTÂNCIA DO GÊNERO ENTEROCOCCUS ....................................................... 20

2.1.2 EPIDEMIOLOGIA DO ENTEROCOCCUS RESISTENTE À VANCOMICINA ...................... 22

2.2 FATORES DE VIRULÊNCIA DOS ENTEROCOCCUS SPP. ................................ 23

2.3 RESISTÊNCIAS ANTIMICROBIANAS EM ENTEROCOCCUS SPP. ................... 27

2.3.1 Resistências aos β-lactâmicos ............................................................ 29

2.3.2 Resistência às tetraciclinas ................................................................. 30

2.3.3 Resistência às quinolonas ................................................................... 31

2.3.4 Resistência aos macrolídeos ............................................................... 31

2.3.5 Resistência aos aminoglicosídios ....................................................... 32

2.3.6 Resistência aos glicopepitídios ........................................................... 33

2.4 DISSEMINAÇÃO CLONAL DO ENTEROCOCCUS RESISTENTE À

VANCOMICINA ........................................................................................................... 37

3 OBJETIVOS ...................................................................................................... 39

3.1 OBJETIVO GERAL ........................................................................................ 39

3.2 OBJETIVOS ESPECÍFICOS .......................................................................... 39

4 METODOLOGIA ............................................................................................... 40

4.1 TIPO DE PESQUISA ...................................................................................... 40

4.2 AMOSTRA ..................................................................................................... 40

4.3 CONFIRMAÇÃO DA IDENTIFICAÇÃO DOS ISOLADOS BACTERIANOS .. 40

4.4 AVALIAÇÃO DA SUSCEPTIBILIDADE AOS ANTIMICROBIANOS .............. 42

4.5 AVALIAÇÃO DA CONCENTRAÇÃO INIBITÓRIA MÍNIMA ........................... 43

4.6 CARACTERIZAÇÃO MOLECULAR DA RESISTÊNCIA................................ 44

4.7 PESQUISA DE GENES DE VIRULÊNCIA ..................................................... 45

4.8 TIPAGEM MOLECULAR DAS CEPAS DE ENTEROCOCCUS ........................... 46

4.9 ANÁLISE POR SEQUENCIAMENTO DE MULTILOCUS .............................. 47

5 RESULTADOS .................................................................................................. 49

5.1 CARACTERIZAÇÃO DA AMOSTRA ............................................................. 49

5.2 AVALIAÇÃO DA SUSCEPTIBILIDADE AOS ANTIMICROBIANOS .............. 50

Page 17: nterococcus sp CIDADE DO NATAL-RN · 2019-06-09 · Oliveira, Em ília Sousa de. Emerg ê ncia de enterococcus sp. resistentes à vancomicina na cidade do Natal - RN / Em ília Sousa

5.3 AVALIAÇÃO DA CONCENTRAÇÃO INIBITÓRIA MÍNIMA ........................... 52

5.4 CARACTERIZAÇÃO MOLECULAR DA RESISTÊNCIA................................ 52

5.5 PESQUISA DE GENES DE VIRULÊNCIA ..................................................... 53

5.6 AVALIAÇÃO DO PERFIL CLONAL POR TIPAGEM MOLECULAR .............. 55

6 DISCUSSÃO ..................................................................................................... 59

7 CONCLUSÃO ................................................................................................... 67

REFERENCIAL BIBLIOGRÁFICO ............................................................................. 68

APÊNDICE A .............................................................................................................. 87

APÊNDICE B .............................................................................................................. 90

ANEXO A .................................................................................................................... 92

Page 18: nterococcus sp CIDADE DO NATAL-RN · 2019-06-09 · Oliveira, Em ília Sousa de. Emerg ê ncia de enterococcus sp. resistentes à vancomicina na cidade do Natal - RN / Em ília Sousa

18

1 INTRODUÇÃO

As bactérias do gênero Enterococcus colonizam naturalmente o trato

intestinal e o geniturinário de animais e humanos, além de estarem amplamente

distribuídas na água, no solo e nos alimentos (KONEMAN et al., 2014). Ao longo de

décadas, essas bactérias foram utilizadas na indústria de alimentos para a produção

de probióticos e como cultura de arranque (FOULQUIÉ MORENO et al., 2006).

Por muito tempo, esse gênero bacteriano foi considerado de pouca

importância clínica em comparação a outras bactérias Gram positivas tidas como

mais virulentas, como o por exemplo, a espécie Staphylococcus aureus. Porém, nos

últimos anos, os Enterococcus sp. vêm emergindo como um importante agente

patogênico. Contudo, somente com o surgimento de cepas que expressam a

resistência à vancomicina que as atenções começam a se voltar para essas

bactérias. Atualmente, os Enterococcus sp. resistentes à vancomicina – vancomycin-

resistant Enterococcus (ERV/VRE) estão entre as principais causas de infecções

nosocomiais (BRASIL, 2016; ECDC, 2012; WEINER et al., 2016), sendo

considerado uma das principais espécies bacterianas responsáveis por infecções

relacionadas à assistência à saúde (IRAS) com altas taxas de morbidade e

mortalidade.

Apesar da crescente emergência do ERV no Brasil e no mundo, ainda são

poucos os estudos regionais que apresentam a análise epidemiológica e de

similaridade genética do ERV, reforçando, dessa forma, a importância da pesquisa

de vigilância desse micro-organismo no nordeste brasileiro. A emergência de ERV

em Natal é um fato importante para a comunidade médica, uma vez que essa

resistência não era comum na região (COSTA, 2012). A caracterização genética

dessas cepas contribui para o entendimento da epidemiologia dos Enterococcus e

as suas mudanças na região da cidade do Natal no Rio Grande do Norte e auxiliar

na elaboração de medidas de controle e prevenção desses agentes.

Page 19: nterococcus sp CIDADE DO NATAL-RN · 2019-06-09 · Oliveira, Em ília Sousa de. Emerg ê ncia de enterococcus sp. resistentes à vancomicina na cidade do Natal - RN / Em ília Sousa

19

2 REFERENCIAL TEÓRICO

2.1 GÊNERO Enterococcus

Esse gênero bacteriano faz parte da família Enterococcaceae e é

composto por 58 espécies descritas até o presente momento (PARTE, 2014).

Observados pela primeira vez em 1899, pelo francês Thiercelin, foram chamados de

“entérocoque” para enfatizar a sua origem entérica saprofíta (KÖHLER, 2007;

THIERCELIN, 1899). No entanto, por sua semelhança fenotípica a outros Gram

positivos, no século XX, estas bactérias pertenciam ao gênero bacteriano

Streptococcus. Somente em 1984, Schleifer e Kilpper-Bälz, utilizando-se de técnicas

moleculares de hibridização de ácido desoxiribonucleico (DNA) e de 16S DNA

ribossômico (rDNA) conseguiram distinguir o gênero Enterococcus do Streptococcus

(FOULQUIÉ MORENO et al., 2006; SCHLEIFER; KILPPER-BÄLZ, 1984).

O gênero Enterococcus é um ‘low G-C’ pertencente ao grande grupo das

bactérias Gram-positivas assim como o Staphylococus e o Streptococcus. São

patógenos oportunistas que apresentam a habilidade de colonizar e permanecer em

diversos ambientes e hospedeiros. Desse modo, podemos encontrá-lo na microbiota

do trato gastrointestinal de muitos animais desde insetos, aves, répteis até

mamíferos, incluindo o ser humano (GILMORE; LEBRETON; VAN SCHAIK, 2013;

HUYCKE; SAHM; GILMORE, 1998; KONEMAN et al., 2014; MARTIN; MUNDT,

1972; MUNDT, 1963). Nas fezes humanas, a sua concentração normalmente

encontrada pode ser de até 108 Unidade Formadora de Colônias (UFC) por grama,

já no cólon humano é possível observar até 1012 UFC por grama (GILMORE et al.,

2014; HUYCKE; SAHM; GILMORE, 1998; RICE et al., 1995). Também é possível

observá-lo colonizando a cavidade oral, a pele e o trato genitourinário, em menores

frequências (KONEMAN et al., 2014). Além disso, podem ser isolados da vegetação,

do solo e da água, muitas vezes associados a contaminação por material fecal ou

esgoto não tratado, e, em virtude disso, por anos foi utilizado como indicador de

contaminação do solo e de alimentos juntamente com outras bactérias entéricas

(GILMORE et al., 2014; HUYCKE; SAHM; GILMORE, 1998).

Os enterococos possuem a morfologia de cocos ovalados, com dimensão

variadas entre 0,6 a 2,5 µm, dispostos, normalmente, em diplococos, pequenas

Page 20: nterococcus sp CIDADE DO NATAL-RN · 2019-06-09 · Oliveira, Em ília Sousa de. Emerg ê ncia de enterococcus sp. resistentes à vancomicina na cidade do Natal - RN / Em ília Sousa

20

cadeias ou mesmo como células isoladas (FACKLAM; CARVALHO; TEIXEIRA,

2002; KONEMAN et al., 2014). São aeróbios facultativos, por isso cresce tanto em

ambiente com oxigênio como com a redução do mesmo. São micro-organismos

extremamente resilientes a diferentes condições ambientais, crescem em

temperaturas variantes de 10 e 45°C, em ambientes hipertônicos – até 6,5% de

cloreto de sódio – como também em hipotônicos, em pH variante do ácido até básico

(pH entre 4 e 9,6) e resistem a 60°C por até 30 minutos (KONEMAN et al., 2014;

SHERMAN, 1937). São capazes de hidrolisar bile na presença de esculina e

produzir pirrolodonil arilamidase. Sobrevivem a concentrações elevadas de sais

biliares e azida de sódio, sendo estes utilizados como agentes seletivos para

enterococos in vitro (HUYCKE; SAHM; GILMORE, 1998; KONEMAN et al., 2014).

2.1.1 Importância do gênero Enterococcus

O fato do gênero Enterococcus apresentar capacidade de sobrevida e

adaptação em diversos tipos de ambientes, bem como pela produção de

bacteriocinas, leva ao estudo crescente de suas propriedades funcionais. Esses

micro-organismos se destacam por serem utilizados em diversas áreas como na

biotecnologia ambiental, na biorremediação de poluentes; nos tratamentos

terapêuticos com os probióticos; na indústria alimentícia com a biopreservação de

alimentos, além de cultura de arranque para produção de alimentos como queijos e

leites fermentados (FOULQUIÉ MORENO et al., 2006; FRANZ et al., 2003, 2011;

GIRAFFA, 2002; TANG et al., 2016).

Apesar disso, esse gênero bacteriano tem emergido como um importante

agente causador de infecções tanto comunitária quanto hospitalares (CETINKAYA;

FALK; MAYHALL, 2000). A maioria das infecções enterocócicas é originária da

microbiota do próprio paciente e em menor proporção podem ser transmitidas por

contato ou pelo consumo de alimentos contaminados (KONEMAN et al., 2014). As

espécies consideradas importantes agentes patógenos, por promoverem tanto a

colonização e a infecção nos seres humanos, são o Enterococcus faecalis e o

Enterococcus faecium, numa proporção de 80-90% e 10-15%, respectivamente.

(DEVRIESE et al., 1995; GILMORE et al., 2014; RUOFF et al., 1990). No Brasil, de

acordo com o boletim de avaliação dos indicadores nacionais das IRAS da Agência

Page 21: nterococcus sp CIDADE DO NATAL-RN · 2019-06-09 · Oliveira, Em ília Sousa de. Emerg ê ncia de enterococcus sp. resistentes à vancomicina na cidade do Natal - RN / Em ília Sousa

21

Nacional de Vigilância Sanitária (ANVISA), sua proporção para a espécie E. faecalis

varia de 50-60%, enquanto a E. faecium oscila de 5-20% (BRASIL, 2016).

As infecções mais comuns associadas com esses patógenos são as do

trato urinário, intra-abdominais, pélvicas, bacteremias, endocardites, cutâneas,

neonatais, do sistema nervoso central e do trato respiratório (GILMORE et al., 2014;

VAN TYNE; GILMORE, 2014). Além disso, esse gênero é considerado umas das

causas mais comum de IRAS do trato urinário e de feridas, além de ser considerado

um dos maiores causadores de bacteremia nosocomial (CETINKAYA; FALK;

MAYHALL, 2000; CRISTINA et al., 2005; WEINER et al., 2016). Estudos

epidemiológicos já demostraram que eles ocupam a quarta posição nos Estados

Unidos e a quinta posição no continente europeu dos agentes etiológicos

causadores de infecções de corrente sanguínea, no entanto, apresenta uma menor

incidência na América Latina (DESHPANDE et al., 2007). No Brasil, de acordo com o

boletim da ANVISA, o enterococos ocupa a 7ª posição dos micro-organismos mais

isolados de infecções primárias da corrente sanguínea tanto das unidades de terapia

intensiva (UTI) adulta, como na pediátrica e neonatal (BRASIL, 2016). Atualmente o

ERV é considerado pela OMS como pertencente a lista das bactéria

multirresistentes de prioridade alta (TACCONELLI et al., 2018; WHO, 2017).

A ocorrência do ERV no ambiente hospitalar, já foi observado resultando

na elevação do custo direto em até três vezes, com também do tempo de internação

em 12 dias (DREES et al., 2008; SONG et al., 2003). Além do mais, estudos de

coorte já demostraram que a bacteremia por ERV resulta no aumento da taxa de

mortalidade dos pacientes em duas vezes em comparação com a taxa de pacientes

com bacteremia por Enterococcus sensíveis (EDMOND et al., 1997; SONG et al.,

2003). A maior preocupação em torno da aquisição de infecções nos hospitais por

esse gênero está relacionada a pacientes com a presença de dispositivos invasivos

como cateter e ventilação mecânica; após procedimento cirúrgicos; além de já

colonizados por ERV (PITTET et al., 2008). Já foi observado que pacientes

colonizados apresentam altas taxas para desenvolverem infecções decorrentes

desses micro-organismos (DREES et al., 2008).

Page 22: nterococcus sp CIDADE DO NATAL-RN · 2019-06-09 · Oliveira, Em ília Sousa de. Emerg ê ncia de enterococcus sp. resistentes à vancomicina na cidade do Natal - RN / Em ília Sousa

22

2.1.2 Epidemiologia do Enterococcus resistente à vancomicina

O primeiro ERV foi reportado em 1988, em uma cultura de vigilância de um paciente

com leucemia linfocítica aguda, na França (LECLERCQ et al., 1988). No mesmo

ano, outro ERV foi isolado na Inglaterra (UTTLEY et al., 1988). A posteriori, diversos

casos de surtos e dispersões clonais foram e ainda são reportados ao redor do

mundo em todos os continentes (ALOTAIBI; BUKHARI, 2017; ANTALEK et al., 1995;

BELL; PATON; TURNIDGE, 1998; BONTEN et al., 1996; BOYCE et al., 1994;

FRIEDEN et al., 1993; GORDTS et al., 1995; HANDWERGER et al., 1993; LIU et al.,

2011; LIVORNESE et al., 1992; LOCHAN et al., 2016; MURRAY et al., 1992;

SIVERTSEN et al., 2016; TIMMERS et al., 2002). No Brasil, o ERV foi reportado no

ano de 1998, na cidade de Curitiba, dez anos após o primeiro isolado no mundo

(DALLA COSTA et al., 1998). Posteriormente, outros isolados foram reportados por

diversas cidades do Brasil, concentrando-se principalmente na região Sul e Sudeste

(CORREA et al., 2015; RESENDE et al., 2014; RIBAS et al., 2007; SACRAMENTO

et al., 2016; ZANELLA et al., 1999, 2006). E somente em 2006, o primeiro isolado de

ERV do Nordeste foi descrito em Recife, Pernambuco (VILELA et al., 2006). Nos

últimos anos, o ERV vem sendo reportado e estudado em outros estados do

nordeste brasileiro como na Bahia, no Ceará e em Pernambuco (COELHO et al.,

2011; FREITAS, 2018; MENEZES et al., 2015; NUNES; CAMPELO; XIMENES,

2017; PINTO et al., 2011; PORTO et al., 2013). No estado do Rio Grande do Norte,

o único relato do ERV ocorreu em 2012 em estudo de caracterização das infecções

enterocócicas da região, o qual identificou um amostra com E. faecium com vanA

(COSTA, 2012). Nenhum outro relato foi reportado.

Page 23: nterococcus sp CIDADE DO NATAL-RN · 2019-06-09 · Oliveira, Em ília Sousa de. Emerg ê ncia de enterococcus sp. resistentes à vancomicina na cidade do Natal - RN / Em ília Sousa

23

2.2 FATORES DE VIRULÊNCIA DOS Enterococcus spp.

Os fatores de virulência dos enterococos estão intimamente relacionados

a colonização, infecção e permanência nos ambientes bióticos e abióticos. Em

decorrência desses fatores, esse gênero bacteriano apresenta a habilidade de se

estabelecer em ambientes inóspitos, como por exemplo, apresentando altas

temperaturas e com alta concentração de sal (MURRAY, 1990). Além disso, estudos

já demostram que são tolerantes ao cloro, aos desinfetantes e as soluções

alcoólicas utilizadas em hospitais, deste modo, capazes de persistir no ambiente e

nos equipamentos médicos (KEARNS; FREEMAN; LIGHTFOOT, 1995; PIDOT et al.,

2018). Contudo, comparativamente com outros patógenos do grupo das Gram

positivas, o Enterococcus possui uma pequena quantidade de fatores de virulência.

A colonização bacteriana ocorre quando o microrganismo está presente

na superfície do corpo, como na pele, na boca, no intestino, sem resultar em

infecções ou danos ao hospedeiro. Sabe-se pouco, até o momento, sobre os

mecanismos utilizados pelo enterococos para a colonização natural do trato

gastrointestinal dos indivíduos (GILMORE et al., 2014). Contudo, a exposição do

organismo à pressão seletiva dos antibióticos resulta na modificação da microbiota e

facilita a colonização pelo ERV. Estudo já demostrou que, em modelo animal, a

redução da população entérica das Gram negativas ocasiona a diminuição da

produção da proteína antimicrobiana intestinal RegIIIγ pelas células paneth,

acarretando no crescimento populacional dos ERV (BRANDL et al., 2008). Os

componentes bacterianos como flagelo, lipossacarídeo (LPS) e o ácido lipoteicóicos

são reconhecidos pelos seus receptores Toll-like (TLR) e Nod das células intestinais

e estimulam a produção das proteínas antimicrobianas. Já observado que a

expressão da proteína RegIIIγ foi restaurada após o tratamento com a TLR4 -

agonista ao LPS - ou TLR5 – agonista da flagelina, proteína presente no flagelo

bacteriano -, e como consequência, proporcionou o restauro do sistema de defesa

imune inata e a restrição da colonização pelos Enterococcus resistentes

(KINNEBREW et al., 2010). Além disso, a recolonização da microbiota intestinal, em

ratos, já demostrou ocasionar a redução significativa da população do ERV (UBEDA

et al., 2013).

Page 24: nterococcus sp CIDADE DO NATAL-RN · 2019-06-09 · Oliveira, Em ília Sousa de. Emerg ê ncia de enterococcus sp. resistentes à vancomicina na cidade do Natal - RN / Em ília Sousa

24

A colonização intestinal pelos enterococos resistentes suscita no

carreamento silencioso desses micro-organismos por longos períodos, o que

favorece a disseminação de cepas adaptadas por transferência horizontal através do

contato direto entre os pacientes, como também pelo contato com os profissionais

de saúde (BALDASSARRI et al., 2005; TORNIEPORTH et al., 1996). Outra forma de

transmissão menos frequente é em virtude da contaminação dos equipamentos

médicos (LIVORNESE et al., 1992).

Cepas mais adaptadas ao ambiente hospitalar apresentam, muitas vezes,

além dos genes de resistência aos antibióticos, genes de virulência que ocasionam o

aumento da gravidade das infecções bacterianas. Estes fatores, relacionados a

adesão, invasão tecidual e evasão do sistema imune, são localizados tanto na

superfície celular, como também, são proteínas secretadas (VAN TYNE; GILMORE,

2014). Dentre os vários fatores de virulência estudados para o enterococos podemos

destacar: a proteína de superfície do enterococos, as substâncias de agregação, a

gelatinase e a citolisina.

A proteína de superfície de enterococos (Esp) é codificada pelo gene esp

da ilha de patogenicidade-Esp. É uma proteína ancorada ao domínio LPxTG

(Leucina-Prolina-any-Treonina-Glicina) da superfície da membrana celular e, em sua

estrutura, apresenta uma região central composta por unidades repetidas in tandem

que permite conformações alternativa como resultados de adições ou deleções

dessas unidades. Desse modo, pode servir como um braço retrátil que se estende

através da parede celular, facilitando, assim, a evasão ao sistema imune. (GILMORE

et al., 2014; HENDRICKX et al., 2009; SHANKAR et al., 1999). Além disso, a Esp

contribui para a adesão tecidual e a formação do biofilme, sendo estes dois fatores

importantes para a sobrevida e persistência do enterococos (TOLEDO-ARANA et al.,

2001). Como também, está presente nas linhagens mais adaptadas ao hospital,

tanto na espécie E. faecalis como na E. faecium, detectado em abundância em

isolados de bacteremia e endocardites, no entanto raro quando isolados de

indivíduos saudáveis (KAYAOGLU; ØRSTAVIK, 2004; SHANKAR et al., 1999;

TOLEDO-ARANA et al., 2001).

As substâncias de agregação (AS) são um grupo de proteínas, adesinas,

ancoradas a superfície bacteriana, responsivas a feromônio e codificadas pelos

genes asa1, asc10, asp1 presentes em plasmídeos conjugativos – pAD1, pCF10 e

Page 25: nterococcus sp CIDADE DO NATAL-RN · 2019-06-09 · Oliveira, Em ília Sousa de. Emerg ê ncia de enterococcus sp. resistentes à vancomicina na cidade do Natal - RN / Em ília Sousa

25

pPD1, respectivamente (DUNNY, 2013; HENDRICKX et al., 2009). As expressões

dessas proteínas são induzidas por um sinal químico autocrino produzido por outras

células no quorum sensing. Essas proteínas apresentam uma sequência sinal na

região N-terminal, uma região C-terminal ancorada a LPxTG, dois domínios RGD

(Argenina-Glicina-Aspartato) e uma região de ligação ao ácido lipoproteíco

(HENDRICKX et al., 2009). Elas atuam na adesão facilitando o contato entre as

células doadora e receptora no primeiro estágio (formação de par do acasalamento)

da conjugação bacteriana, como também, é imprescindível na ligação aos

componentes da matriz extracelular, ligando-se a fibrina, fibronectina e

trombospondina (ROZDZINSKI et al., 2001). Ademais, contribui para a formação do

biofilme. A região RGD age mediando a adesão e a internalização bacteriana em

célula eucarióticas, além de favorecer para a evasão do sistema imune (GALLI;

LOTTSPEICH; WIRTH, 1990; GILMORE et al., 2014; KAYAOGLU; ØRSTAVIK,

2004). Estudos já demostraram que as AS são prevalentes tanto em isolados

clínicos, principalmente de endocardites, como também de amostras fecais de

pacientes em hospitais, no entanto são raras no ambiente comunitário (HENDRICKX

et al., 2009; KAYAOGLU; ØRSTAVIK, 2004; KREFT et al., 1992). A sua presença

contribui para a colonização do trato gastrointestinal através da sua habilidade de

ligar-se à células epiteliais (KREFT et al., 1992; VAN TYNE; GILMORE, 2014).

A gelatinase (Gel) é uma enzima extracelular zinco-metaloproteolítica

codificada pelo gene gelE e regulado pelo sistema fsr do quorum sensing

dependente do feromônio de ativação da biossíntese da gelatinase, presentes no E.

faecalis. Pertence à família metaloproteína da matriz e apresenta uma capacidade

de hidrolisar gelatina, fibrinogênio, colágeno, caseína, hemoglobina, insulina e outros

peptídeos bioativos (GAO; HOWDEN; STINEAR, 2018). Possui um importante papel

na morte celular durante o processo de formação do biofilme, como também na

evasão ao sistema imune por clivagem dos componentes do sistema complemento

(PARK et al., 2008; THOMAS et al., 2009). Já demostrado, em modelo animal, que

essa enzima está relacionada a gravidade da endocardite pelo enterococos

(THURLOW et al., 2010).

A citolisina (Cyl) pertence à classe das lantibiótico das bacteriocinas

sendo expressas em diversas cepas de E. faecalis. É uma toxina bacteriana que

atua contra todas as espécies das Gram positivas, além da sua capacidade de lisar

Page 26: nterococcus sp CIDADE DO NATAL-RN · 2019-06-09 · Oliveira, Em ília Sousa de. Emerg ê ncia de enterococcus sp. resistentes à vancomicina na cidade do Natal - RN / Em ília Sousa

26

eritrócitos, e outras células eucarióticas, contribuindo para a gravidade da infecção

(ROUX; PAYNE; GILMORE, 2009; VAN TYNE; GILMORE, 2014; VAN TYNE;

MARTIN; GILMORE, 2013). Ela é codificada pelo operon cyl, composto por um

conjunto de oito genes (cylR1, cylR2, cylLL, cylLS, cylM, cylB, cylA e cyII), que pode

estar presente tanto em ilha de patogenicidade como também em transposon

responsivo à feromônio, como o pAD1 (COBURN; GILMORE, 2003; VAN TYNE;

MARTIN; GILMORE, 2013). A citolisina é composta por duas subunidades CylLL e

CylLS, que são ativadas pela CylA (GILMORE et al., 2014). Essa toxina apresenta

importantes papéis na patogenicidade do Enterococcus. Suas funções são a

eliminação de outras bactérias, a produção de dano tecidual e consequente invasão

da corrente sanguínea, como também a lise de linfócitos contribuindo para evasão

do sistema imune (KAYAOGLU; ØRSTAVIK, 2004; VAN TYNE; MARTIN; GILMORE,

2013).

Page 27: nterococcus sp CIDADE DO NATAL-RN · 2019-06-09 · Oliveira, Em ília Sousa de. Emerg ê ncia de enterococcus sp. resistentes à vancomicina na cidade do Natal - RN / Em ília Sousa

27

2.3 RESISTÊNCIAS ANTIMICROBIANAS EM Enterococcus spp.

A resistência genética à substâncias danosas é um processo natural de

proteção de algumas espécies bacterianas que, em alguns casos, foram

predeterminados há milhões de anos (BARLOW; HALL, 2002; LEBRETON et al.,

2017). Contudo, o uso excessivo e indiscriminado dos antibióticos tanto no

tratamento de infeções humanas como na pecuária resultou no aumento

exponencial da taxa de resistência. Atualmente, a resistência bacteriana é

considerada um dos maiores problemas relacionados à saúde pública associados à

morbidade e à letalidade.

A resistência bacteriana aos antimicrobianos pode ter origem intrínseca a

espécie como também pode ser adquirida. O termo resistência inerente ou intrínseca

é utilizando quando a propriedade está presente em todos ou na grande maioria dos

isolados da espécie, sendo, normalmente uma característica cromossomial

(MURRAY, 1990). Já a resistência adquirida pode ocorrer tanto por mutação de uma

porção genética já existente como por aquisição de elementos genéticos móveis,

como plasmídeos e transposons. Outro termo que também pode ser utilizado é a

tolerância natural a alguns antimicrobianos, implicando na inibição do micro-

organismo dependendo da concentração do agente, contudo somente em altas

concentrações é possível ter ação bactericida (KRISTICH; RICE; ARIAS, 2014)

O ambiente hospitalar fornece um ambiente ideal para a supressão ou

eliminação das cepas susceptíveis à antibióticos e ocasiona a seleção de micro-

organismos resistentes, ademais promove a disseminação da resistência intra e

inter-espécies, como também a dissipação de clones nosocomiais (MURRAY, 1990).

A sobrevida do gênero Enterococcus nesse ambiente está relacionada com a

presença da resistência intrínseca a uma grande variedade de antibióticos utilizados

na rotina clínica (CETINKAYA; FALK; MAYHALL, 2000). Além do mais, a sua grande

plasticidade genômica facilita a aquisição e a transferência de genes de resistência

aos antimicrobianos (CLEWELL, 1990; MURRAY, 1990). As principais resistências

do enterococos tanto intrínsecas como extrínsecas estão resumidas na tabela 1. Os

principais mecanismos de resistência adquirida às classes dos β-lactâmicos, das

tetraciclinas, das quinolonas, dos macrolídeos, dos aminoglicosídios e dos

Page 28: nterococcus sp CIDADE DO NATAL-RN · 2019-06-09 · Oliveira, Em ília Sousa de. Emerg ê ncia de enterococcus sp. resistentes à vancomicina na cidade do Natal - RN / Em ília Sousa

28

glicopeptídios, encontrados no gênero dos enterococos, serão resumidos nos

subitens a seguir.

Tabela 1: Resistência intrínseca e extrínseca dos enterococos.

Antimicrobiano Espécies mais comuns Mecanismo de resistência

Resistência intrínseca

β-lactâmicos Todas as espécies Baixa afinidade às Proteínas Ligadoras de Penicilina (PBP); • Penicilinas -Baixos

concentrações

• Carbapenêmicos

• Cefalosporinas Aminoglicosídios

• Baixas concentrações

Todas as espécies Permeabilidade reduzida da parede celular.

• Concentrações moderadas

E. faecium Produção da enzima cromossomal AAC(6’)li.

Lincosamidas, clindamicina e Estreptograminas A

E. faecalis Bomba de efluxo da família ABC, codificado pelo gene lsa

Estreotogramina B – baixas concentrações

E. faecium Bomba de efluxo da família ABC, codificado pelo gene msrC

Sulfanamidas e Trimetropim

Todas Utilização de ácido fólico pré-sintetizado.

Glicopeptídios (baixo nível) E. gallinarum, E. casseliflavus

Produção de precursores do peptidoglicano (D-Ala-D-Ser).

Resistência adquirida

Ampicilina - alto concentrações

E. faecium, E. hirae Superprodução ou alterações da PBP4 ou 5.

E. faecalis Β-lactamase (rara). Aminoglicosídios – altas concentrações

E. faecalis, E. faecium, E. gallinarum, E. casseliflavus

Produção de enzima modificadoras do aminoglicosídeo; AAC(6’)-APH(2’’). Alteração ribossomal;

Macrolídeos Maioria dos enterococos Metilação ribossomal. Cloranfenicol E. faecium, E. faecalis CAT codificando enzimas. Tetraciclina E. faecium, E. faecalis Modificação de proteína

ribossomal; Bomba de efluxo.

Quinolonas E. faecium, E. faecalis Alterações na DNA girase e Topoisomerase IV; Bomba de efluxo.

Glicopeptídios – altas concentrações

E. faecium, E. faecalis Modificação do sítio alvo.

Oxazolidinonas E. faecium, E. faecalis Mutação no gene 23S ou 16S RNA ribossômico (rRNA); Metilação da rRNA (enzima Cfr); Bomba de efluxos (protetores ribossomais).

Daptomicina E. faecium, E. faecalis Alteração das proteínas de ligação na membrana.

Adaptado de TOP; WILLEMS; BONTEN, 2008.

Page 29: nterococcus sp CIDADE DO NATAL-RN · 2019-06-09 · Oliveira, Em ília Sousa de. Emerg ê ncia de enterococcus sp. resistentes à vancomicina na cidade do Natal - RN / Em ília Sousa

29

2.3.1 Resistências aos β-lactâmicos

Os β-lactâmicos constituem a maior classe farmacológica de

antimicrobianos além de ser a mais amplamente utilizadas no tratamento de

infecções bacterianas, tanto por Gram positivas como por Gram negativas. Esta

classe de fármacos atua na parede celular das bactérias, mais especificamente, liga-

se as Proteínas Ligadoras de Penicilina (PBPs), ocasionando a inativação da enzima

da transpeptidase e interferindo na síntese dos peptídeos de mureína

(peptídeoglicanos) da parede celular. Quimicamente, o anel β-lactâmicos define esta

classe, esse anel é análogo ao dipeptídeo D-Alanina-D-Alanina (D-Ala-D-Ala) e sua

ligação covalente à transpeptase resulta na inibição enzimática irreversível e

posteriormente a autólise e morte celular das células em divisão. (KASMAR;

HOOPER, 2009; KONEMAN et al., 2014). Essa classe está dividida em quatro

famílias que diferem estruturalmente: as penicilinas, as cefalosporinas, os

monobactâmincos e os carbapenêmico.

Os enterococos apresentam intrinsicamente susceptibilidade reduzida

aos β-lactâmicos por expressar PBPs com baixa afinidade a essa classe de

antibióticos. Fato comumente observada na espécie E. faecium, pois apresentam o

gene pbp5 que produz uma proteína com baixa afinidade a ampicilina e

cefalosporinas. Desse modo, essa classe farmacológica não pode ser administrada

de forma isolada. (MILLER; MUNITA; ARIAS, 2014). A resistência total do gênero a

essa classe é consequência da aquisição de genes de resistência ou mutação,

sendo as duas maneiras por alteração nas PBPs (PBP4 e 5) ou por produção de

enzimas β-lactamases. A resistência à penicilina e à ampicilina, normalmente, é

atribuída a enzima β-lactamases, e quase exclusivamente descrito na espécie E.

faecalis com a aquisição do operon da espécie S. aureus (GILMORE; SHEPARD,

2002).

Até 2006, o Clinical and Laboratory Stardards Institute (CLSI)

recomendava que os resultados obtidos tanto para a ampicilina como para penicilina

poderiam predizer a resistência às demais penicilinas, no entanto, começou a

observar isolados de enterococos com fenótipos de resistência à penicilina e

sensibilidade à ampicilina (METZIDIE et al., 2006). Por tanto, as normas atuais são

Page 30: nterococcus sp CIDADE DO NATAL-RN · 2019-06-09 · Oliveira, Em ília Sousa de. Emerg ê ncia de enterococcus sp. resistentes à vancomicina na cidade do Natal - RN / Em ília Sousa

30

que a resistência à ampicilina prediz à resistência à penicilina, contundo o inverso

não é verdadeiro (BRCAST, 2018; CLSI, 2018; EUCAST, 2018).

2.3.2 Resistência às tetraciclinas

A tetraciclina é uma classe de antibióticos bacteriostáticos de amplo

espetro amplamente utilizados na clínica. Algum dos fármacos que constituem essa

classe são a tetraciclina, doxiciclina, minociclina, metaciclina, entre outros. Essa

classe farmacológica age ligando-se reversivelmente ao RNA ribossomal (rRNA)

16S da subunidade 30S, ocasionando a inibição da síntese proteica por bloqueio da

junção do anticódon de RNA transportador (tRNA) – aminoacil tRNA - ao códon do

RNA mensageiro (mRNA) (RYOU; COEN, 2009; SCHNAPPINGER; HILLEN, 1996).

A penetração desses fármacos nas células bacterianas depende da

difusão passiva por porinas e do transporte ativo através da membrana. Por

consequência disso, a resistência a essa classe ocorre normalmente em virtude do

aumento do efluxo ou por redução do influxo. As bombas de efluxo são os

mecanismos mais difundidos e mais eficientes na resistência a tetraciclina. Outros

mecanismos que conferem resistência são a produção de proteínas que interferem

na ligação ao sítio alvo e a inativação enzimática do agente (MILLER; MUNITA;

ARIAS, 2014; RYOU; COEN, 2009).

A resistência à tetraciclina nos enterococos é resultante de múltiplos

genes que mediam tanto produção de bomba de efluxos como também protetores

ribossomais (GUZMAN PRIETO et al., 2016). As bombas de efluxo mais comuns

desse gênero são codificadas pelos genes tetL e tetK, eles são plasmidiais e

codificam uma proteína transmembrânica que conferem resistência à tetraciclina,

mas não à minociclina (CHOPRA; ROBERTS, 2001). Os genes das proteínas

protetoras ribossomais são tetM, tetO e tetS, sendo esses transferíveis por

transposons, e conferem resistência tanto à doxiciclina, à minociclina como também

à tetraciclina (BENTORCHA; DE CESPÉDÈS; HORAUD, 1991; MILLER; MUNITA;

ARIAS, 2014; PEPPER et al., 1987).

Page 31: nterococcus sp CIDADE DO NATAL-RN · 2019-06-09 · Oliveira, Em ília Sousa de. Emerg ê ncia de enterococcus sp. resistentes à vancomicina na cidade do Natal - RN / Em ília Sousa

31

2.3.3 Resistência às quinolonas

A classe das quinolonas constitui um importante grupo, elas são agentes

de amplo espectro que atuam inibindo a topoisomerase II (DNA girase) e

topoisomerase IV, sendo essas responsáveis pelo início da transcrição do DNA

(MILLER; MUNITA; ARIAS, 2014; RYOU; COEN, 2009). Esses fármacos podem

apresentar ação bacteriostática em baixa concentração, no entanto, em altos níveis,

elas convertem rapidamente as topoisomerases e ocasionam a lesão do DNA e a

morte celular. As quinolonas mais conhecidas são o ácido nalidíxido, a

ciprofloxacina, a ofloxacina, a levofloxacina como também as fluroquinolonas.

O enterococos possui baixo nível de resistência intrínseca as quinolonas,

no entanto resistência a altas concentrações ocorre através da aquisição de alguns

genes (MILLER; MUNITA; ARIAS, 2014). Mutação nos genes gyrA e parC já foram

descritos como causadores dessa modificação no fenótipo, isso resulta na alteração

da região de determinante da resistência as quinolonas, levando a diminuição da

afinidade do sítio alvo com o fármaco (LÓPEZ et al., 2011; RICE, 2012). Outro

mecanismo já reportado é a produção de bomba de efluxo (MILLER; MUNITA;

ARIAS, 2014; RICE, 2012). O último mecanismo é a produção de enzimas sendo um

exemplo delas codificadas pelo gene qnr, presentes na porção plasmidial do

genoma (ARSÈNE; LECLERCQ, 2007).

2.3.4 Resistência aos macrolídeos

Os antibióticos da classe dos macrolídeos estão inseridos nesse grupo

por apresentarem anéis lactona fixados a desoxiaçúcares. Eles possuem ação

bacteriostática que agem inibindo a síntese proteica pelo bloqueio da translocação

tendo como sítio alvo o rRNA 23S, subunidade 50S (RYOU; COEN, 2009). O seu

agente mais conhecido é a eritromicina. Juntamente com a licosamida e

estreptogramina, os macrolídeos constituem uma terapia alternativa nos casos de

infecções insidiosas por Enterococcus. Contudo o uso da classe como medicamento

não é fácil em virtude da crescente taxa de bactérias resistentes, sendo estas,

normalmente, decorrente de genes plasmidiais.

Page 32: nterococcus sp CIDADE DO NATAL-RN · 2019-06-09 · Oliveira, Em ília Sousa de. Emerg ê ncia de enterococcus sp. resistentes à vancomicina na cidade do Natal - RN / Em ília Sousa

32

A resistência adquirida nas bactérias Gram positivas ocorre por três

mecanismos principais. A alteração pontual do sítio alvo é um deles, acontece na

subunidade 23S do rRNA, conferindo, assim, resistência cruzada tanto aos

macrolídeos como a licosamidas e estreptogramina. Outro mecanismo são as

bombas de efluxos que resultam na diminuição intracelular da concentração do

agente, alguns genes podem estar envolvidos como os genes mefA, mefE, mreA –

associados à resistência aos macrolídeos – e msrA – associado à resistência aos

macrolídeos e estreptogramina. O terceiro é por inativação enzimática que constitui

o mecanismo mais comum em Gram positivos, tem o objetivo de metilar o ribossomo

resultando na diminuição da afinidade ao agente, um exemplo é a metilase

decodificada pelo gene erm, reportada em Enterococcus (PORTILLO et al., 2000;

RYOU; COEN, 2009).

2.3.5 Resistência aos aminoglicosídios

O aminoglicosídio é uma classe farmacológica com propriedades

bactericidas caracterizada por apresentar um grupo amino e um grupo glicosídio.

Fármacos dessa classe agem na subunidade ribossomal ligando-se ao rRNA 16S da

subunidade 30S resultando na inibição da síntese proteica. Em baixas

concentrações, induzem a leitura incorreta do mRNA durante o alongamento por

ligação incorreta do anticódon de tRNA levando a produção de proteínas aberrantes

(DAVIS, 1987; KRAUSE et al., 2016). Em altas concentrações, o agente causa a

inibição completa da síntese de proteínas. De acordo com o modelo de Davis do

mecanismo de ação do aminoglicosídio, tanto em baixa como alta concentrações

resulta na morte celular, diferente dos outros inibidores da síntese proteica (DAVIS,

1987).

Essa classe inclui fármacos amplamente utilizados como estreptomicina,

gentamicina, amicacina, tobramicina, neomicina entre outros. Os mais utilizados em

virtude da sua baixa toxicidade são gentamicina, amicacina e tobramicina.

O gênero Enterococcus possui resistência inerente à baixos

concentrações dessa classe farmacológica em decorrência da absorção ineficiente

do agente por permeabilidade reduzida da membrana celular. Por esse motivo que

essa classe sempre é utilizada em sinergismos com inibidores da síntese da parede

Page 33: nterococcus sp CIDADE DO NATAL-RN · 2019-06-09 · Oliveira, Em ília Sousa de. Emerg ê ncia de enterococcus sp. resistentes à vancomicina na cidade do Natal - RN / Em ília Sousa

33

celular, como os β-lactâmicos ou os glicopeptídios, com o intuito de aumentar a

permeabilidade da membrana (GILMORE; SHEPARD, 2002; MOELLERING;

WENNERSTEN; WEINBERG, 1971; ZARRILLI et al., 2005). A espécie E. faecium

apresenta resistência a concentrações moderadas de aminoglicosídios por produção

cromossomial da enzima 6’-acetiltransferase (AAC-6’) (COSTA et al., 1993; TOP;

WILLEMS; BONTEN, 2008). A resistência à altas concentrações a esses fármacos

ocorrem por aquisição plasmidial de genes que conferem a produção de enzimas

modificadoras dos aminoglicosídios, sendo estas a AAC-6’ ou a enzima 2-

fosfotransferase (APH-2”) (GILMORE; SHEPARD, 2002; LECLERCQ et al., 1992).

Na rotina laboratorial, para averiguação da resistência à classe dos

aminoglicosídios, de acordo com os CLSI os únicos fármacos testados são a

gentamicina e estreptomicina, pois eles agem como marcadores para os agentes da

classe (KOLAR et al., 2006). Cepas que apresentam resistência à gentamicina são

consideradas resistentes os demais fármacos da classe, com exceção da

estreptomicina. Resultados e interpretações para os testes de susceptibilidade aos

aminoglicosídios estão sumarizados na tabela 2.

Tabela 2: Antibióticos para avaliação do fenótipo da resistência à níveis elevados de aminoglicosídios (HLAR).

GEN (120 µg) EST (300 µg) Interpretação

Sensível Sensível Cepa não apresenta HLAR.

Sensível Resistente HLAR para estreptomicina, sensível para os

demais.

Resistente Resistente HLAR à todos os da classe.

Resistente Sensível HLAR à todos da classe, exceto à

estreptomicina.

HLAR – High-level aminoglycosides resistance (resistência a altos níveis de aminoglicosídeos). Adaptado de Kolar e colaboradores, (2006).

2.3.6 Resistência aos glicopepitídios

A classe dos glicopeptídios apresenta ação bactericida contra as

bactérias Gram positivas, principalmente em infecções por S. aureus, Enterococcus

Page 34: nterococcus sp CIDADE DO NATAL-RN · 2019-06-09 · Oliveira, Em ília Sousa de. Emerg ê ncia de enterococcus sp. resistentes à vancomicina na cidade do Natal - RN / Em ília Sousa

34

spp. e Clostridium difficile (BINDA; MARINELLI; MARCONE, 2014). Esses fármacos

agem através do impedimento da síntese da parece celular bacteriana, ligando-se à

extremidade terminal D-Ala-D-Ala da cadeia lateral da unidade de monômeros de

mureína. Ele sequestra o substrato da transpeptidação e transglicosilação e

interrompe a formação do peptídeoglicano, desestabilizando a integridade da parede

e ocasionando a morte celular por lise osmótica (BINDA; MARINELLI; MARCONE,

2014; COURVALIN, 2006). A vancomicina e a teicoplanina pertencem a primeira

geração dessa classe. Em decorrência da toxicidade, principalmente da

nefrotoxidade, em via de regra, são utilizados somente em casos de infecções com

micro-organismos resistentes à outras classes (KASMAR; HOOPER, 2009).

Tanto a teicoplanina como a vancomicina possuem uma ação semelhante

contra as Gram-positivas, contudo a teicoplanina apresenta um potencial melhor

quando administrado em isolados do gênero Staphylococcus, Streptococcus e

Enterococcus (CYNAMON; GRANATO, 1982). A diferença básica, entre os dois

fármacos, aparenta estar relacionado a conformação do agente. A teicoplanina é um

lipoglicopeptídio enquanto a vancomicina é um composto glicopeptídio não lipídico,

desse modo, a teicoplanina tem a capacidade de ancorar a membrana celular, já o

outro é distribuído amplamente nas camadas dos peptídoglicanos (BEAUREGARD

et al., 1995; BINDA; MARINELLI; MARCONE, 2014; WESTWELL; GERHARD;

WILLIAMS, 1995). Além disso, diversas outras hipóteses estão associadas a

diferença entre as duas. Foi visto que a vancomicina ativa genes regulatórios

(sensor quinase VanS) associados a expressão de genes de resistência à

vancomicina e não à teicoplanina, e mutações nesses genes regulatórios podem

acarretar na resistência à teicoplanina (ARTHUR et al., 1997; BAPTISTA et al.,

1996, 1999; BINDA; MARINELLI; MARCONE, 2014; EVERS; COURVALIN, 1996).

A resistência do enterococos a essa classe farmacológica ocorre pela

alteração no sítio alvo. O D-Ala é modificado para o D-Lactato (D-Lac) ou D-Serina

(D-Ser) dependendo do gene de resistência presente genoma bacteriano. Essa

modificação altera a região terminal da cadeia lateral ocasionado a diminuição da

afinidade entre o complexo antibiótico-percursor por quebra de uma ligação de

hidrogênio da interação (COURVALIN, 2006). Diversos genes já foram descritos

associados a resistência aos glicopeptídios, sendo eles vanA, vanB, vanC, vanD,

vanE, vanG, vanL, vanM e vanN. Contudo, somente dois desses (vanA e vanB)

Page 35: nterococcus sp CIDADE DO NATAL-RN · 2019-06-09 · Oliveira, Em ília Sousa de. Emerg ê ncia de enterococcus sp. resistentes à vancomicina na cidade do Natal - RN / Em ília Sousa

35

apresentam um impacto clínico importante por sua grande disseminação no

ambiente hospitalar, além de serem associados a transferência inter e intra-espécies

(CATTOIR; LECLERCQ, 2013; GUZMAN PRIETO et al., 2016).

Dos diversos genes já descritos associados a essa resistência, diferem

fenotípica e geneticamente. Basicamente suas alterações estão relacionadas a

enzima ligase produzida, o grau de resistência à vancomicina, a indução da

expressão pela teicoplanina e o arranjo estrutural dos genes (GILMORE et al., 2014;

MURRAY, 1998). As características dos três principais operons estão sumarizados

na tabela 3 e sua estrutura genética pode ser observada na figura 1.

Tabela 3: Características dos principais operons van.

VanA VanB VanC

Operon vanA vanB vanC

Localização Plasmídio (Tn1546) Plasmídio (Tn1547) Cromossomo

Expressão Induzível Induzível Constitutiva

Vancomicina Resistente Resistente Resistente

Teicoplanina Resistente Sensível Sensível

Ligase D-Lac D-Lac D-Ser

Figura 1: Organização genética dos três principais operons van (VanA, VanB, VanC), onde as setas indicam a direção da transcrição. Setas verdes: genes de regulação; setas vermelhas: genes de resistência; setas laranjas: genes acessórios.

Page 36: nterococcus sp CIDADE DO NATAL-RN · 2019-06-09 · Oliveira, Em ília Sousa de. Emerg ê ncia de enterococcus sp. resistentes à vancomicina na cidade do Natal - RN / Em ília Sousa

36

Os operons Van apresentam um módulo regulador, responsável por

detectar a presença dos glicopeptídios e, através de um sistema de transdução de

sinal, ativar a expressão do gene de resistência; produz enzimas precursoras de

modificadores de peptídeosglicanos; e D, D-carboxipeptidases que cliva o peptídeo

naturalmente sintetizado pela maquinaria da célula (GILMORE et al., 2014).

O fenótipo VanA é caracterizado por conferir um alto nível de resistência à

vancomicina como também à teicoplanina. O seu operon é normalmente codificado

em transposons (Tn1546, geralmente), que possui sete regiões de leitura aberta

(Figura 1) e dois promotores. Ele apresenta uma região reguladora com dois

componentes: VanR que age regulando a resposta e o VanS (sensor quinase). A

indução da expressão da resistência é ocasionada pela presença do glicopeptídio,

ele é reconhecido pela proteína transmenbrânica codificada pelo vanS, o qual

fosforila a região reguladora vanR. A etapa seguinte após a indução da resistência é

a codificação de uma desidrogenase pela região vanH que permite a produção da D-

Lac a partir do piruvato. O gene vanA produz uma ligase que permite a adição do D-

Lac produzido ao D-Ala. Contudo, antes dessa ligação, as regiões VanX e VanY

produzem peptidases que agem clivando o peptídeo terminal (D-Ala). A região vanZ

codifica uma proteína que não teve sua função elucidada até o momento, no entanto

aparenta estar ligada a resistência à teicoplanina (ELIOPOULOS; GOLD, 2001;

MILLER; MUNITA; ARIAS, 2014; ZIRAKZADEH; PATEL, 2006).

Isolados com o fenótipo VanB demostra normalmente resistência

moderada até alta à vancomicina, contudo não é induzido por teicoplanina.

Geralmente esse operon está contido em transposons (Tn1547), contudo podem

aparecer em plasmídeo ou mesmo no cromossoma. A sua organização genética é

bem similar ao VanA, no entanto apresentam alguns diferença (figura 1). Uma delas

é que o VanB possui o genes acessório homólogo ao VanZ, o VanW – seu papel

também não foi totalmente elucidado (GILMORE et al., 2014; MILLER; MUNITA;

ARIAS, 2014). Diferentemente dos outros dois, o VanC é cromossomial e sua

principal diferença é o peptidoglicano produzido, em vez de produzir D-lac como os

demais, ele expressa a D-ser (Tabela 3) (CATTOIR; LECLERCQ, 2013; GILMORE

et al., 2014; LECLERCQ et al., 1992).

Page 37: nterococcus sp CIDADE DO NATAL-RN · 2019-06-09 · Oliveira, Em ília Sousa de. Emerg ê ncia de enterococcus sp. resistentes à vancomicina na cidade do Natal - RN / Em ília Sousa

37

2.4 DISSEMINAÇÃO CLONAL DO Enterococcus RESISTENTE À

VANCOMICINA

As técnicas de tipagem molecular foram criadas para identificar os

padrões genético dos isolados que circulam e auxiliar no entendimento da sua forma

de dispersão e transmissão. Desse modo, a análise do genoma bacteriano é

recomendada para comensurar o grau de similaridade entre os isolados estudados

e, desse modo, detectar precocemente a sua capacidade epidêmica. Diversas

técnicas são utilizadas para essas avaliações, sendo consideradas padrões ouro a

Eletroforese em Campo Pulsado (PFGE) e a Tipagem por Sequenciamento de

Multilocus (MLST) (WERNER, 2013).

A PFGE consiste na análise completa do genoma bacteriano por

fragmentação enzimática e formação de bandas, denominadas pulsotipos, por uma

eletroforese em campo pulsado (RANJBAR et al., 2014). Esse é uma técnica

excelente para análise local de surtos e dispersões clonais. Contudo, quando o

estudo sugere uma avaliação global ou que apresente um grande espaço de tempo

entre os isolados, a técnica mais apropriada é o MLST. Essa técnica utiliza-se do

sequenciamento de sete regiões extremante conservadas do genoma

(housekeeping) e a tipagem é realizada através da identificação de pequenos snips

desses locus, sendo denominados números para cada um dos locus analisados. A

sequência de diferentes locus formam os Sequence Types (ST) e a junção desses

podem formar Complexos Clonais (CC) (RANJBAR et al., 2014; WERNER, 2013).

Para cada espécie do enterococos são utilizadas diferentes regiões conservadas e,

como consequência, formam ST e CC sem relações entre as espécies.

Normalmente, as cepas de ERV apresentam um perfil policlonal, contudo,

quando associados a surtos hospitalares ou a dispersões clonais o enterococos

possui algumas linhagens genéticas predominantes, dependendo da espécie. Para o

E. faecalis, a linhagens que mais estão associadas ao ambiente hospitalar são as

pertencentes aos complexos clonais CC2, CC9, CC4 e CC87 (ALMEIDA et al., 2014;

LEAVIS; BONTEN; WILLEMS, 2006; RUIZ-GARBAJOSA et al., 2006;

SACRAMENTO et al., 2017; SANTOS et al., 2017). Já em relação a espécie E.

feacium a linhagem genética mais prevalente é a anteriormente conhecida como

CC17. Atualmente já é sabido que esse CC17 do E. faecium é composto por

Page 38: nterococcus sp CIDADE DO NATAL-RN · 2019-06-09 · Oliveira, Em ília Sousa de. Emerg ê ncia de enterococcus sp. resistentes à vancomicina na cidade do Natal - RN / Em ília Sousa

38

diferentes linhagem e origem e, desse modo, não podem ser mais sumarizados em

um único CC, eles devem ser denominados de acordo com a linhagem. Sendo

assim, as mais prevalente são as linhagem genéticas ST18, ST17 e ST78 (FREITAS

et al., 2013; GUZMAN PRIETO et al., 2016).

Page 39: nterococcus sp CIDADE DO NATAL-RN · 2019-06-09 · Oliveira, Em ília Sousa de. Emerg ê ncia de enterococcus sp. resistentes à vancomicina na cidade do Natal - RN / Em ília Sousa

39

3 OBJETIVOS

3.1 OBJETIVO GERAL

Caracterizar geneticamente cepas de Enterococcus sp. resistentes à

vancomicina e relacionar a uma possível dispersão clonal na cidade do Natal, Rio

Grande do Norte.

3.2 OBJETIVOS ESPECÍFICOS

• Confirmar geneticamente os isolados de Enterococcus à nível de

espécie pela técnica de reação em cadeia da polimerase (PCR);

• Verificar o perfil de susceptibilidade aos antibióticos utilizados na rotina

clínica para o tratamento de infecções enterocócicas;

• Detectar por metodologia de PCR, determinantes genéticos envolvidos

na resistência à vancomicina;

• Identificar por metodologia de PCR, genes envolvidos na expressão da

virulência das cepas;

• Traçar o perfil clonal das amostras de Enterococcus pela metodologia

de tipagem molecular por PFGE;

• Avaliar o perfil clonal mais prevalente das amostras de Enterococcus

pela metodologia de tipagem por MLST.

Page 40: nterococcus sp CIDADE DO NATAL-RN · 2019-06-09 · Oliveira, Em ília Sousa de. Emerg ê ncia de enterococcus sp. resistentes à vancomicina na cidade do Natal - RN / Em ília Sousa

40

4 METODOLOGIA

4.1 TIPO DE PESQUISA

Essa pesquisa trata-se de um estudo transversal e descritivo, na qual foi

realizado a caracterização molecular de cepas de Enterococcus sp. resistentes à

vancomicina isoladas a partir de hospitais da cidade do Natal, Rio Grande do Norte.

4.2 AMOSTRA

Nesse estudo foram utilizadas amostras de ERV provenientes de cultura

de vigilância (swab perianal) e outros espécimes clínicos (urina, ponta de cateter,

fragmento de osso, secreção ocular e secreção de úlcera) isolados em diversos

hospitais da cidade do Natal, Rio Grande do Norte. As amostras biológicas foram

coletadas no período de janeiro de 2015 a dezembro de 2016 por solicitação médica

e encaminhadas a um Laboratório de Análises Clínicas para a realização do

diagnóstico laboratorial. Os isolados bacterianos foram cedidos à pesquisa após a

anuência do Laboratório de Análises Clínicas responsável pelo processamento das

amostras biológicas e o parecer de aprovação do Comitê de Ética em Pesquisa

(CEP) da Universidade Federal do Rio Grande do Norte (CAAE:

80922617.0.0000.5537, Nº: 2.512.300; Apêndice A/Anexo A). O estudo teve acesso

somente aos dados sobre as amostras que estavam no sistema do Laboratório de

Análises Clínicas, não foi possível a obtenção das informações sobre os paciente

nos hospitais de origem.

As cepas bacterianas encontram-se armazenadas em biorrepositório

(Apêndice B) no Laboratório de Bacteriologia Médica (LaBMed) no Departamento de

Microbiologia e Parasitologia sob o gerenciamento da professora Maria Celeste

Nunes de Melo. As amostras foram armazenadas em leite enriquecido com glicerol

10% e congeladas a -20°C no LaBMed.

4.3 CONFIRMAÇÃO DA IDENTIFICAÇÃO DOS ISOLADOS BACTERIANOS

Page 41: nterococcus sp CIDADE DO NATAL-RN · 2019-06-09 · Oliveira, Em ília Sousa de. Emerg ê ncia de enterococcus sp. resistentes à vancomicina na cidade do Natal - RN / Em ília Sousa

41

Os isolados bacterianos chegaram ao LaBMed identificados como

Enterococcus resistentes à vancomicina através do sistema automatizado VITEK® 2

(bioMériuex, França). No LaBMed tiveram sua identificação confirmada por testes

laboratoriais convencionais como a coloração de Gram, a prova da catalase, o

semeio em ágar bile-esculina e o semeio em meio com suplementação de NaCl

(Newprov, Brasil). Além disso, foi realizado semeio em meios de cultura seletivos e

diferencial para enterococos: o cromogênico chromID® VRE (bioMériuex, França) e o

ágar Slanetz Bartley com cloreto de trifeniltetrazólio (Liofilchem, Itália). A

identificação molecular das espécies E. faecalis e E. faecium foi realizada pela

técnica da PCR utilizando primers específicos (Tabela 4) (DUTKA-MALEN; EVERS;

COURVALIN, 1995; JACKSON; FEDORKA-CRAY; BARRETT, 2004). A etapa da

caracterização genética das espécies foi realizada no Laboratório de Microbiologia

da Faculdade de Farmácia da Universidade de Porto, em Portugal.

Tabela 4: Primers utilizados para confirmação da espécie dos isolados de Enterococcus.

Gene e espécie

Sequência (5’ para 3’) Tamanho

do produto (pb)

Referência

sodA (E. faecalis)

E1: ACTTATGTGACTAACTTAACC E2: TAATGGTGAATCTTGGTTTGG

360 (JACKSON;

FEDORKA-CRAY; BARRETT, 2004)

ddl (E. faecium)

F1: TAGAGACATTGAATATGCC F2: TCGAATGTGCTACAATC

550

(DUTKA-MALEN; EVERS;

COURVALIN, 1995)

pb: pares de base.

A PCR singleplex foi feita em volume final de 25 µL contendo: 10 µL de

água ultrapura, 12,5 µL de NZYTaq II 2x Green Master Mix (NZYtech, Portugal) e

0,25 µM do primer forward e do reverse e, por fim, 2 µL da suspensão bacteriana.

Foi utilizado o termociclador T100® (BioRad, Estados Unidos).

O protocolo de amplificação descrito por DUTKA-MALEN, EVERS E

COURVALIN (1995) foi utilizado para a determinação das espécies E. faecium (ddl):

1 ciclo de 94°C por 15 minutos para extração do DNA, posteriormente 30 ciclos de

Page 42: nterococcus sp CIDADE DO NATAL-RN · 2019-06-09 · Oliveira, Em ília Sousa de. Emerg ê ncia de enterococcus sp. resistentes à vancomicina na cidade do Natal - RN / Em ília Sousa

42

94°C por 30 segundos, 54°C por 30 segundos e 72 °C por 30 segundos e, por fim,

foi submetido a uma extensão final a 72 °C por 10 minutos. Para a determinação da

espécie E. faecalis (sodA), foi utilizado o protocolo descrito por JACKSON;

FEDORKA-CRAY; BARRETT (2004): inicialmente 94°C por 15 minutos para

extração do DNA, posteriormente 30 ciclos de 94°C por 30 segundos, 55°C por 30

segundos e 72 °C por 30 segundos e, por fim, 72 °C por 10 minutos.

Após a amplificação dos fragmentos os produtos da PCR foram aplicados

em gel de agarose a 1% com SYBR® safe (Thermo Fisher, Estados Unidos). O

marcador de peso molecular de 100pb NZYDNA ladder VI (NZYtech, Portugal) foi

aplicado no gel e a corrida de eletroforese foi realizada a 100V por 30 minutos em

solução tampão TBE 0,5X (0,05M Tris; 0,05M ácido bórico; 0,5mM EDTA Na2). E por

fim, o resultado foi fotografado com o auxílio do fotodocumentador Gel Doc® XR+

(BioRad, Estados Unidos).

4.4 AVALIAÇÃO DA SUSCEPTIBILIDADE AOS ANTIMICROBIANOS

Para avaliação do perfil da susceptibilidade aos antimicrobiano foi

empregada a técnica qualitativa de disco-difusão de acordo com as normas do CLSI

(CLSI, 2018). Os antimicrobianos testados foram: ampicilina (10 μg), ciprofloxacina

(05 μg), tetraciclina (30 μg), linezolida (30 μg), cloranfenicol (30 μg), vancomicina (30

μg), teicoplanina (30 μg), eritromicina (15 μg) e gentamicina (120 μg) e

estreptomicina (300 μg) (DME, Brasil).

Os halos de inibição foram interpretados utilizando também os pontos de

corte do European Committee on Antimicrobial Susceptibility Testing (EUCAST,

2018) e do Brazilian Committee on Antimicrobial Susceptibility Testing (BRCAST,

2018). Para avaliação por essas normas foram empregados os mesmos antibióticos,

contudo, alguns foram retestados em concentrações diferentes, sendo eles:

ampicilina (2 μg), linezolida (10 μg), vancomicina (5 μg) e gentamicina (30 μg)

(Oxoid, Estados Unidos).

A partir de um crescimento recente em meio de cultura não seletivo, ágar

Brain Heart Infusion (BHI), foram suspendidos inóculos bacterianos em solução de

salina estéril 0,9%, até a turbidez 0,5 da escala de McFarland. Com auxílio de um

swab estéril, a suspensão foi semeada em meio ágar Müeller Hinton II (Becton

Page 43: nterococcus sp CIDADE DO NATAL-RN · 2019-06-09 · Oliveira, Em ília Sousa de. Emerg ê ncia de enterococcus sp. resistentes à vancomicina na cidade do Natal - RN / Em ília Sousa

43

Dickinson, Estados Unidos). Posteriormente, os discos impregnados com os

antibióticos foram distribuídos na superfície do meio. A leitura dos halos de inibição

e, posteriori, interpretação dos resultados foi realizado após a incubação das placas

por 16-18 horas a 37±1ºC.

As amostras de referência, recomendadas pelo CLSI (2018) foram

utilizadas como controles desse teste, foram elas: E. faecalis (ATCC 29212), E.

faecalis (ATCC 51299) e S. aureus (ATCC 25923).

4.5 AVALIAÇÃO DA CONCENTRAÇÃO INIBITÓRIA MÍNIMA

Em relação aos antimicrobianos vancomicina e teicoplanina foram

pesquisadas as Concentração Inibitória Mínima (CIM), utilizando a técnica da fita

contendo gradiente do fármaco e a técnica de diluição em ágar, de acordo com o

recomendado pelo CLSI (CLSI, 2018), o qual preconiza a utilização desses métodos

de avaliação da CIM para esses dois antibióticos em questão.

Para o antibiótico vancomicina foi realizado o CIM por MIC Strip Test com

vancomicina em gradiente de 0,016 µg/ml a 256 µg/ml (Liofilchem, Itália). Utilizando

de cultura recente em ágar BHI, o teste foi realizado semelhante ao experimento por

metodologia de disco-difusão descrito no item 4.4. A leitura foi realizada após 18-24

horas de incubação. O E. faecalis ATCC 29212 foi utilizado como controle para a

realização do teste.

O CIM para teicoplanina (União Química, Brasil) foi realizado por diluição

em ágar. As concentrações testadas graduaram de 1 µg/ml a 256 µg/ml, sendo a

solução inicial obtida da solução estoque 133,33 mg/ml. As diluições seriadas foram

realizadas como preconizado pelo CLSI (2018), em cada placa a diluição do fármaco

em relação ao meio ágar Müller Hinton foi de 1:10. As placas com o fármaco e a

placa controle (sem o fármaco) foram identificadas e divididas e, com o auxílio de

uma pipeta, foi inoculado 5 µL a suspensão bacteriana 0,5 na escala de McFarland,

com posterior diluição de 1:10. Leitura e interpretação foram realizadas após

incubação por 18-24 horas a 37±1ºC.

Page 44: nterococcus sp CIDADE DO NATAL-RN · 2019-06-09 · Oliveira, Em ília Sousa de. Emerg ê ncia de enterococcus sp. resistentes à vancomicina na cidade do Natal - RN / Em ília Sousa

44

4.6 CARACTERIZAÇÃO MOLECULAR DA RESISTÊNCIA

A caracterização molecular da resistência à vancomicina foi realizada pela

pesquisa dos operon vanA e vanB através PCR, utilizando os seguintes primers

específicos sumarizado na tabela 5.

Tabela 5: Primers utilizados para avaliar a resistência à vancomicina

Gene Sequência (5’ para 3’) Tamanho do produto (pb)

Referência

vanA A1: GGGAAAACGACAATTGC A2: GTACAATGCGGCCGTTA

732 (DUTKA-MALEN;

EVERS; COURVALIN, 1995)

vanB B1: ACGGAATGGGAAGCCGA B2: TGCACCCGATTTCGTTC

635 (DUTKA-MALEN;

EVERS; COURVALIN, 1995)

pb: pares de bases.

A PCR singleplex foi feita em volume final de 25 µL contendo: 22 µL de

SuperMix PCR (Invitrogen, Estados Unidos) e 1 µL do primer forward e reverse e,

por fim, 2 µL da suspensão bacteriana. Foi utilizado o termociclador T100® (BioRad,

Estados Unidos).

O protocolo de amplificação descrito por DUTKA-MALEN, EVERS E

COURVALIN (1995) foi utilizado para a determinação dos genes de resistência: 1

ciclo de 94°C por 15 minutos para extração do DNA e, posteriormente, 30 ciclos de

94°C por 60 segundos, 55°C por 60 segundos e 72 °C por 60 segundos, por fim, foi

submetido a 1 ciclo de 72 °C por 10 minutos.

Após a amplificação dos fragmentos os produtos da PCR foram aplicados

em gel de agarose a 1% com brometo de etídio (0,04 µL/mL). O marcador de peso

molecular de 100pb DNA ladder (New England Biolabs, Estados Unidos) foi aplicado

no gel e a corrida de eletroforese foi realizada a 100V por 30 minutos em solução

tampão TBE 0,5X (0,05M Tris; 0,05M ácido bórico; 0,5mM EDTA Na2). E por fim,

visualizados e fotografados com auxílio do transiluminador UVIpure (Uvitec, Reino

Unido).

Page 45: nterococcus sp CIDADE DO NATAL-RN · 2019-06-09 · Oliveira, Em ília Sousa de. Emerg ê ncia de enterococcus sp. resistentes à vancomicina na cidade do Natal - RN / Em ília Sousa

45

4.7 PESQUISA DE GENES DE VIRULÊNCIA

A pesquisa dos genes relacionados com expressão dos fatores de

virulência esp, cylA, gelE e asa1 foi realizada por técnica da PCR utilizando primers

específicos (VANKERCKHOVEN et al., 2004). Os primers estão sumarizados na

tabela 6. Etapa realizada no Laboratório de Microbiologia da Faculdade de Farmácia

da Universidade de Porto, em Portugal.

Tabela 6: Primers para pesquisa dos genes de virulência esp, cylA, gelE e asa1.

Gene Sequência (5’ para 3’)

Tamanho do

produto (pb)

Referência

esp (Proteína de superfície de Enterococcus)

ESP14F:AGATTTCATCTTTGATTCTTGG ESP12R:AATTGATTCTTTAGCATCTGG

510 (VANKERCKHOVEN

et al., 2004)

cylA (Citolisina)

CYTI: ACTCGGGGATTGATAGGC CYTIIb: GCTGCTAAAGCTGCGCTT

688 VANKERCKHOVEN

et al., 2004)

gelE (Gelatinase)

GEL11: TATGACAATGCTTTTTGGGAT GEL12: AGATGCACCCGAAATAATATA

213 VANKERCKHOVEN

et al., 2004)

asa1 (Substância de agregação)

ASA11: GCACGCTATTACGAACTATGA ASA12: TAAGAAAGAACATCACCACGA

375 VANKERCKHOVEN

et al., 2004)

pb: pares de bases.

Foi utilizado o protocolo de amplificação descrito por VANKERCKHOVEN

et al. (2004) para a determinação dos genes de virulência: 1 ciclo de 94°C por 15

minutos para extração do DNA e, posteriormente, 30 ciclos de 94°C por 60

segundos, 56°C por 60 segundos e 72 °C por 60 segundos e, por fim, foi submetido

a uma extensão final a 72 °C por 10 minutos.

Os componentes da PCR singleplex, a corrida da eletroforese, como

também a revelação do gel de agarose foram realizados como descrito no item 4.3.

Page 46: nterococcus sp CIDADE DO NATAL-RN · 2019-06-09 · Oliveira, Em ília Sousa de. Emerg ê ncia de enterococcus sp. resistentes à vancomicina na cidade do Natal - RN / Em ília Sousa

46

4.8 TIPAGEM MOLECULAR DAS CEPAS DE Enterococcus

As cepas foram analisadas quanto a relação genética entre si através da

técnica de Eletroforese em Campo Pulsado (PFGE), com a utilização da enzima de

restrição SmaI, de acordo com as recomendações de Teixeira et al. (TEIXEIRA et

al., 1997), e analisadas por critério de Tenover (TENOVER et al., 1995).

A partir de crescimento recente de uma única colônia bacteriana, em 2 mL

de caldo BHI, foram preparadas suspensões bacterianas em 500 µL de tampão PIV

(1M NaCl, 10mM Tris, pH 7,6), após a retirada do caldo BHI por centrifugação 4.000

rpm por 5 minutos. Igual volume (500 µL) de agarose de baixo ponto de fusão

(Promega, Estados Unidos) a 2% foi adicionado à suspensão, homogeneizado e

imediatamente inserido nos moldes dos plugs, para a confecção dos discos. Em

seguida esses plugs foram tratados com enzimas para obtenção do genoma

bacteriano. Eles foram incubados em solução lise com tampão EC (6mM Tris, pH

7,6; 1M NaCl; 100mM EDTA Na2; 0,2% Disoxicolato de sódio, 0,5% Lauril

sarcosinato) com 1 mg/mL de lisozima, 5 U/mL de mutanolisina e 0,5% BRIJ®

(Sigma, Estados Unidos) por 18-24 horas a 37±1°C sob agitação leve.

Posteriormente, essa solução lise foi substituída pelo tampão ESP (0,5mM EDTA

Na2, pH 8; 1% Lauril Sarcosinato) com 1mg/mL de proteinase K (Sigma, Estados

Unidos) com incubação por 18-24 horas a 50°C, em banho-maria. Somente então,

os discos foram submetidos a lavagem com tampão TE (10 mM Tris-HCl, pH 7,6; 0,1

mM EDTA Na2) com agitação leve, sendo duas, por 2 horas e outras duas, por 1

hora. Após as quatro lavagens, iniciou-se a restrição enzimática do genoma

bacteriano. Os discos foram incubados por 30 minutos em 100 µL do tampão

específico da enzima Smal (Sigma, Estados Unidos) diluída (1:10) em água

ultrapura. Após a incubação inicial, o tampão foi retirado e adicionado o tampão

diluído com água e com a enzima SmaI (10U/µL) por 18-24 horas a 20-25°C. Após a

restrição enzimática os plugs foram inseridos em gel de agarose de baixo ponto de

fusão a 1,2% em TBE 0,5X. Foi utilizado na corrida o marcador de peso molecular

de Lambda Ladder PFGE Marker (New Englad Biolabs, Estados Unidos). A corrida

da eletroforese foi realizada em campo elétrico pulsado - CHEF DR II Variable Angle

System (BioRad. Estados Unidos) por 22 horas a 12°C com pulso inicial de 5

segundos e final de 35 segundos, ângulo 120° e 6V/cm. Os géis foram corados com

Page 47: nterococcus sp CIDADE DO NATAL-RN · 2019-06-09 · Oliveira, Em ília Sousa de. Emerg ê ncia de enterococcus sp. resistentes à vancomicina na cidade do Natal - RN / Em ília Sousa

47

0,04 µl/mL de brometo de etídio por 1 hora, em seguida visualizados e fotografados

com auxílio do transiluminador UVIpure (Uvitec, Reino Unido).

4.9 ANÁLISE POR SEQUENCIAMENTO DE MULTILOCUS

Os pulsotipos mais prevalentes encontrados após análise da técnica de

PFGE foram submetidos à técnica de tipagem por Sequenciamento de Multilocus

(MLST). Foram utilizadas as seguintes sequências de amplificação (somente foi

realizado a amplificação para a espécie E. faecalis) sumarizados na tabela 7 (RUIZ-

GARBAJOSA et al., 2006). Essa etapa foi realizada no Laboratório de Microbiologia

da Faculdade de Farmácia da Universidade de Porto, em Portugal.

Tabela 7: Primers utilizados na análise do MLST.

Gene Sequência (5’ para 3’) Tamanho do produto (pb)

Referência

gdh

gdh-1 GGCGCACTAAAAGATATGGT gdh-2 CCAAGATTGGGCAACTTCGTCCCA

530 (RUIZ-

GARBAJOSA et al., 2006)

gyd

gyd-1 CAAACTGCTTAGCTCCAATGGC gyd-2 CATTTCGTTGTCATACCAAGC

395 (RUIZ-

GARBAJOSA et al., 2006)

pstS pstS-1 CGGAACAGGACTTTCGC pstS-2 ATTTACATCACGTTCTACTTGC

583 (RUIZ-

GARBAJOSA et al., 2006)

gki gki-1 GATTTTGTGGGAATTGGTATGG gki-2 ACCATTAAAGCAAAATGATCGC

438 (RUIZ-

GARBAJOSA et al., 2006)

aroE

aroE-1 TGGAAAACTTTACGGAGACAGC aroE-2 GTCCTGTCCATTGTTCAAAAGC

459 (RUIZ-

GARBAJOSA et al., 2006)

Page 48: nterococcus sp CIDADE DO NATAL-RN · 2019-06-09 · Oliveira, Em ília Sousa de. Emerg ê ncia de enterococcus sp. resistentes à vancomicina na cidade do Natal - RN / Em ília Sousa

48

xpt

xpt -1 AAAATGATGGCCGTGTATTAGG xpt-2 AACGTCACCGTTCCTTCACTTA

456 (RUIZ-

GARBAJOSA et al., 2006)

yiqL yiqL-1 CAGCTTAAGTCAAGTAAGTGCCG yiqL-2 GAATATCCCTTCTGCTTGTGCT

436 (RUIZ-

GARBAJOSA et al., 2006)

pb: pares de bases.

Foi utilizado o protocolo de amplificação dos genes para o MLST descrito

por RUIZ-GARBAJOSA et al. (2006). Sendo as condições da ciclo da PCR:

desnaturação inicial a 94°C por 15 minutos para extração do DNA e, posteriormente,

30 ciclos de 94°C por 30 segundos, 51°C por 30 segundos e 72 °C por 30 segundos

e, por fim, foi submetido a uma extensão final a 72 °C por 10 minutos. As

amplificações foram verificadas por eletroforese como já descrito no item 4.3.

Antes do envio para o sequenciamento, os produtos das amplificações

foram purificados pelo kit NZYGelpure (NZYtech, Portugal). O volume completo da

reação da PCR foi transferido para um microtubo de 1,5 ml e adicionado 5 volumes

do tampão e homogeneizado. A solução foi adicionada a uma coluna NYZtech e

centrifugada por 1 minuto e descartado o filtrado. 600 µL do tampão de lavagem foi

adicionado a coluna e centrifugada por 1 minuto, sendo descartado o líquido filtrado.

Foi inserido o tampão de eluição e incubado a temperatura ambiente por 1 minuto,

posteriormente centrifugado a 10.000-15.000 rpm por 1 minuto. Novamente, a

eletroforese como descrita no item 4.3 foi performada com 2 µL para verificar a

qualidade da purificação. Os produtos já purificados foram sequenciados pela

empresa Eurofins Genomics, na Alemanha.

Após o sequenciamento, a qualidade das sequências foi avaliada pelo

software Chromas (Technelysium, Austrália) e, posteriormente, foram inseridas no

banco de dados pubMLST E. faecalis (pubmlst.org), onde foi verificado os snips e

adotado numerações para os alelos e para os ST das sequências.

Page 49: nterococcus sp CIDADE DO NATAL-RN · 2019-06-09 · Oliveira, Em ília Sousa de. Emerg ê ncia de enterococcus sp. resistentes à vancomicina na cidade do Natal - RN / Em ília Sousa

49

5 RESULTADOS

5.1 CARACTERIZAÇÃO DA AMOSTRA

Foram caracterizadas 62 cepas de ERV de seis hospitais diferentes

públicos (A, B, C e E) e privados (D e F), coletados em um período de dois anos,

janeiro de 2015 a dezembro 2016, na cidade do Natal. As 62 cepas de ERV foram

provenientes de 51 pacientes, os quais em 11 destes, foram coletados material

biológico duas a três vezes. A distribuição dos isolados de acordo com a instituição

de origem está representado na tabela 8.

O maior percentual de isolados foi proveniente do hospital A (40,3%;

25/62) seguido pelo hospital C (21,0%; 13/62) e hospital B (19,4%; 12/62), os

demais hospitais (D-F) somaram 19,4% dos isolados. Dentre os ERV pesquisados,

98,4% eram pertencentes à espécie E. faecalis (61/62) e somente 1 isolado (1,6%)

foi identificada como E. faecium (Tabela 8, Figura 2).

Tabela 8: Distribuição dos ERV em relação ao hospital de origem e as espécies identificadas.

Cultura de vigilânciaa Outros espécimes clínicosb Total

(N=56) (N=6) (N=62)

n % n % n %

Hospitais

A 24 42.9% 1 16.7% 25 40.3%

B 10 17.9% 2 33.3% 12 19.4%

C 12 21.4% 1 16.7% 13 21.0%

D 3 5.4% 1 16.7% 4 6.5%

E 3 5.4% - - 3 4.8%

F 2 3.6% 1 16.7% 3 4.8%

OD 2 3.6% - - 2 3.2%

Espécies

E. faecalis 55 98.2% 6 100.0% 61 98.4%

E. faecium 1 100.0% - - 1 1.6% a:isolados de swab perianal; b:isolados de urina, ponta de cateter, fragmento de osso, secreção ocular e secreção de úlcera N: número de isolados testados; n: valor absoluto de resistentes; %: valor percentual de resistência; OD: origem desconhecida; -: nenhum isolado.

Page 50: nterococcus sp CIDADE DO NATAL-RN · 2019-06-09 · Oliveira, Em ília Sousa de. Emerg ê ncia de enterococcus sp. resistentes à vancomicina na cidade do Natal - RN / Em ília Sousa

50

Figura 2: Produto da PCR para os genes sodA, específico para a espécie E. faecalis e ddl, específico para a espécie E. faecium.

PM: Padrão de peso molecular (100pb); A: Controle positivo da espécie E. faecalis, gene sodA (360 pb); B: controle positivo da espécie E. faecium, gene ddl (550 pb).

As amostras foram isoladas de swab perianal (90,3%; 59/62), urina (3,2%

2/62), ponta de cateter (1,6% 1/62), fragmento de osso (1,6% 1/62), secreção ocular

(1,6% 1/62) e secreção de úlcera (1,6% 1/62). As culturas de vigilância foram todas

coletadas no momento de admissão do paciente, quando procedia de outras

instituições de saúde. Dois pacientes apresentaram cultura positiva para ERV tanto

do material biológico coletado (fragmento de osso e ponta de cateter) quanto na

cultura de vigilância.

5.2 AVALIAÇÃO DA SUSCEPTIBILIDADE AOS ANTIMICROBIANOS

Todos os ERV pesquisados foram resistentes a quatro classes diferentes

de antibióticos (quinolona, tetraciclina, macrolídeo e glicopeptídios). Com relação à

classe dos aminoglicosídeos, 88,7% (55/62) e 40,3% (25/62) apresentaram

resistência a elevadas concentrações de gentamicina e estreptomicina,

respectivamente. Todos os isolados foram sensíveis à linezolida e ao cloranfenicol

(62/62; 100%). Somente a espécie E. faecium demostrou resistência à ampicilina

(1/62; 1,5%) (Gráfico 1).

Page 51: nterococcus sp CIDADE DO NATAL-RN · 2019-06-09 · Oliveira, Em ília Sousa de. Emerg ê ncia de enterococcus sp. resistentes à vancomicina na cidade do Natal - RN / Em ília Sousa

51

Gráfico 1: Perfil de resistência em porcentagem dos isolados de Enterococcus aos antimicrobianos testados.

N: número de isolados testados; HLAR: High-Level Aminoglycoside Resistance.

Dos 62 ERV triados com relação a susceptibilidade aos aminoglicosídios

(gentamicina de 30 µg, gentamicina de 120 µg, estreptomicina de 300 µg), 38,7%

(24/62) apresentaram resistência a altas concentrações tanto para a estreptomicina

(300 µg) quanto para a gentamicina (120 µg) e 50% (31/62) foram resistentes

somente à gentamicina (120 µg). No entanto, 1,6% (1/62) do total dos ERV foram

resistentes unicamente à estreptomicina (300 µg). Dos 57 isolados que foram triados

para a resistência à gentamicina 30 µg, seis não apresentaram resistência nem a

estreptomicina e nem a gentamicina de alta concentração, não possuindo assim o

fenótipo HLRA (Tabela 9).

100.0%

1.6%

100.0%

100.0%

98.4%

88.7%

40.3%

100.0%

100.0%

0.0% 20.0% 40.0% 60.0% 80.0% 100.0%

Ciprofloxacina

Ampicilina

Tetraciclina

Linezolida

Cloranfenicol

Eritromicina

Gentamicina

Gentamicina (HLRA)

Estreptomicina (HLRA)

Vancomicina

Teicoplanina

Isolados (N=62)

Page 52: nterococcus sp CIDADE DO NATAL-RN · 2019-06-09 · Oliveira, Em ília Sousa de. Emerg ê ncia de enterococcus sp. resistentes à vancomicina na cidade do Natal - RN / Em ília Sousa

52

Tabela 9: Perfil de susceptibilidade para o teste do fenótipo de resistência a níveis elevados de aminoglicosídios.

Cultura de vigilância

(N=56)

Outros espécimes

clínicos (N=6)

Total de ERV (N=62)

n % n % n %

Gena (120 µg) 27 48,2% 4 66,7% 31 50,0%

Estb (300 µg) 1 1,8% - - 1 1,6%

Gen/Estc (120/300 µg) 22 39,3% 2 33,3% 24 38,7%

Não HLRAd 6 10,7% - - 6 9,7%

a. Amostras resistentes somente à gentamicina; b. Amostras resistentes somente à estreptomicina; c. Amostras resistentes tanto à gentamicina quanto à estreptomicina; d. Amostras sensíveis tanto à gentamicina quanto à estreptomicina. Gen: Gentamicina; Est: Estreptomicina; HLAR: High-Level Aminoglycoside Resistance; N: número de isolados testados; n: valor absoluto de resistentes; %: valor percentual de resistência; -: nenhum isolado.

5.3 AVALIAÇÃO DA CONCENTRAÇÃO INIBITÓRIA MÍNIMA

Todas os isolados foram resistentes à vancomicina, segundo o ponto de

corte do CLSI (2018) que determina uma CIM ≥ 8 µg/mL para o fenótipo de

resistência. A CIM para vancomicina variou de 16 ≥ 256 µg/mL. Dos isolados, 63,1%

(41/62) apresentam a CIM ≥ 256 µg/mL. Para o glicopeptídio teicoplanina o CLSI

(2018) determina um ponto de corte ≥ 16 µg/mL para o fenótipo de resistência, no

entanto de acordo com EUCAST/BRCAST, 2018 o ponto de corte reduz para > 2

µg/mL. De acordo com CLSI, 58,1% (36/62) dos isolados foram resistentes à

teicoplanina com CIM ≥ 16 µg/mL. Contudo, de acordo com o EUCAST/BRCAST,

98,4% (61/62) das amostras foram resistentes à teicoplanina (> 2 µg/mL). A CIM

para a teicoplanina dos isolados analisados variou de 2 até 64 µg/mL.

5.4 CARACTERIZAÇÃO MOLECULAR DA RESISTÊNCIA

Todos os ERV que foram pesquisados amplificaram o gene vanA na PCR.

Nenhum isolado apresentou o gene vanB (Figura 3).

Page 53: nterococcus sp CIDADE DO NATAL-RN · 2019-06-09 · Oliveira, Em ília Sousa de. Emerg ê ncia de enterococcus sp. resistentes à vancomicina na cidade do Natal - RN / Em ília Sousa

53

Figura 3: Gel demonstrando os amplicons vanA e vanB, determinantes de resistência à vancomicina.

PM: Padrão de peso molecular (100pb); A: controle positivo do gene vanA (732 pb); B: controle positivo do gene vanB (635 pb); C-E: Isolados de ERV.

5.5 PESQUISA DE GENES DE VIRULÊNCIA

A pesquisa dos determinantes da virulência foi realizada nos isolados da

espécie E. faecalis. O gel representativo da amplificação da PCR para os genes de

virulência está apresentado na figura 4.

Os genes de virulência mais prevalentes nos isolados analisados foram

os genes para a gelatinase (gelE) (98,4%; 60/61) e a substância agregativa (asa1)

(100%; 61/61). 9,8% (6/61) dos isolados apresentaram o gene esp (proteína de

superfície do Enterococos) e somente 16,4% (10/61) possuíram o gene para a

citolisina (cylA) (Gráfico 2).

Figura 4: Gel representando os amplicons para os genes de virulência pesquisados (cylA, gelE, asa1 e esp), pela técnica de PCR.

PM: Padrão de peso molecular (100pb); A: controle positivo do gene cylA (688 pb); B: controle positivo do gene gelE (213 pb); C: controle positivo do gene esp (510 pb); D: controle positivo do gene asa1 (375 pb);

Page 54: nterococcus sp CIDADE DO NATAL-RN · 2019-06-09 · Oliveira, Em ília Sousa de. Emerg ê ncia de enterococcus sp. resistentes à vancomicina na cidade do Natal - RN / Em ília Sousa

54

Gráfico 2: Distribuição dos determinantes da virulência pesquisados.

gelE: gene da gelatinase; asa1: gene da substância agregativa; cylA: gene da

citolisina; esp: gene da proteína da superfície do enterococos.

A maior prevalência dos genótipos de virulência foi o asa+gel (82,0%;

50/61). Os demais genótipos apresentaram frequências menores: asa+gel+cyl com

8,2% (5/61), asa+gel+cyl+esp também com 8,2% (5/61) e gel com 1,6% (1/61)

(Tabela 10).

Tabela 10: Distribuição do genótipo de virulência para a espécie E. faecalis.

Isolados (N=61)

n %

gel 1 1.6%

asa+gel 50 82.0%

asa+gel+cyl 5 8.2%

asa+gel+cyl+esp 5 8.2%

gel: gelatinase; asa: substância agregativa; cyl: citolisina; esp: proteína da superfície do enterococos; N: número de isolados testados; n: valor absoluto de isolados testados; %: valor percentual de testados; -: nenhum paciente.

9.8%

16.4%

100.0%

98.4%

0.0% 20.0% 40.0% 60.0% 80.0% 100.0%

esp

cylA

asa1

gelE

Isolados (N=61)

Page 55: nterococcus sp CIDADE DO NATAL-RN · 2019-06-09 · Oliveira, Em ília Sousa de. Emerg ê ncia de enterococcus sp. resistentes à vancomicina na cidade do Natal - RN / Em ília Sousa

55

5.6 AVALIAÇÃO DO PERFIL CLONAL POR TIPAGEM MOLECULAR

A tipagem molecular pela técnica de eletroforese em campo pulsado

(PFGE) foi utilizada apenas para a espécie E. faecalis. O único isolado de E.

faecium não foi avaliado por essa técnica. Foi observado somente dois perfis

diferentes denominados A e B (Figura 5). A distribuição entre os clones foi

semelhante, o cluster A foi levemente mais predominante entre os isolados com

50,8% (31/61) em comparação ao B com 49,2% (30/61) (Tabela 11).

Quando comparado entre os mesmos hospitais ou o genótipo de

virulência, a distribuição dos clones A e B apresentou uma leve diferença, sem

grandes alterações entre as suas porcentagens. A maior diferença entre eles foi em

relação a virulência. Nenhum dos isolados do clone A apresentou somente o gene

gelE, como também nenhum dos do clone B demostrou o genótipo asa+gel+cyl.

Além do mais, somente um isolado do clone B foi positiva para o gene cylA, por

outro lado nove dos 31 isolados de outro perfil clonal apresentaram esse gene.

Page 56: nterococcus sp CIDADE DO NATAL-RN · 2019-06-09 · Oliveira, Em ília Sousa de. Emerg ê ncia de enterococcus sp. resistentes à vancomicina na cidade do Natal - RN / Em ília Sousa

56

Figura 5: Gel com os perfis de PFGE. A: isolados do clone A; B: isolados do clone B; Seta azul: controle do clone A (Ef.71); Seta vende: controle do clone B (Ef.24).

A.

B.

2

Page 57: nterococcus sp CIDADE DO NATAL-RN · 2019-06-09 · Oliveira, Em ília Sousa de. Emerg ê ncia de enterococcus sp. resistentes à vancomicina na cidade do Natal - RN / Em ília Sousa

57

Tabela 11: Distribuição dos perfis PFGE da espécie E. faecalis com relação ao hospital de origem e determinantes de virulência.

Clone A (N=31) Clone B (N=30) Total (N=61)

n % n % n %

Hospital

A 14 45.2% 11 36.7% 25 41.0%

B 5 16.1% 7 23.3% 12 19.7%

C 6 19.4% 6 20.0% 12 19.7%

D 3 9.7% 1 3.3% 4 6.6%

E 1 3.2% 2 6.7% 3 4.9%

F 2 6.5% 1 3.3% 3 4.9%

OD - - 2 6.7% 2 3.3%

Virulência

gel - - 1 3.3% 1 1.6%

asa+gel 22 71.0% 28 90.3% 50 82.0%

asa+gel+cyl 5 16.1% - - 5 8.2%

asa+gel+cyl+esp 4 12.9% 1 3.3% 5 8.2%

gel: gelatinase; asa: substância agregativa; cyl: citolisina; esp: proteína da superfície do enterococos; N: número de isolados; n: valor absoluto dos isolados; %: valor percentual dos isolados; OD: origem desconhecida; -: nenhum isolado.

A análise por metodologia de sequenciamento de multilocus (MLST) dos

dois perfis clonais, encontrado por intermédio da corrida do PFGE, constatou que o

clone A pertencia ao ST525, enquanto o clone B ao ST6. Os dois ST encontrado

fazem parte do complexo clonal CC2. A Sumarização dos locus e ST observados

após a análise do sequenciamento está demostrando na tabela 12.

Page 58: nterococcus sp CIDADE DO NATAL-RN · 2019-06-09 · Oliveira, Em ília Sousa de. Emerg ê ncia de enterococcus sp. resistentes à vancomicina na cidade do Natal - RN / Em ília Sousa

58

Tabela 12: Perfil alélico encontrado após o sequenciamento por MLST e a análise dos locus dos isolados

Clone Locus

ST gdh gyd pstS gki aroE xpt yqiL

A 12 7 3 32 6 26 5 525

B 12 7 3 7 6 1 5 6

ST: Sequence Type.

Page 59: nterococcus sp CIDADE DO NATAL-RN · 2019-06-09 · Oliveira, Em ília Sousa de. Emerg ê ncia de enterococcus sp. resistentes à vancomicina na cidade do Natal - RN / Em ília Sousa

59

6 DISCUSSÃO

Sendo um dos principais agentes causadores das IRAS, além de serem

considerados importante reservatório de genes tanto de resistência como de

virulência, o ERV vem emergindo nas últimas décadas como um dos principais

patógenos oportunistas, resultantes de propagação clonal e ocasionando surtos em

instituições de saúde. Anteriormente a essa pesquisa, em 2012, foi realizado um

estudo com 117 isolados de Enterococcus provenientes de quadros infeciosos de

quatro instituições de saúde da cidade do Natal (COSTA, 2012). Essas cepas foram

obtidas de diferentes sítios como urina, secreções, cateter e dreno, tanto de

pacientes internados quanto de ambulatorial. No entanto, nenhum isolado foi

proveniente de cultura de vigilância. Nesse estudo, foi observado que os

Enterococcus apresentaram alta sensibilidade aos antimicrobianos, incluindo aos

glicopeptídios. 86,3% foram resistentes a pelo menos um antimicrobiano e somente

uma cepa foi identificada como ERV, pertencente a espécie E. faecium e abrigando

o gene vanA. Ademais foi demostrado, que diferentemente do que era descrito em

outras regiões, as infecções enterocócicas, na região de Natal, permaneciam com

um perfil de sensibilidade aos antibióticos bastante elevada (COSTA, 2012).

Diferente do estudo realizado por Costa (2012), essa pesquisa demostrou

uma ocorrência muito elevada do ERV, revelando uma emergência dessa linhagem

na cidade do Natal. Nessa pesquisa também foi observado uma ocorrência maior da

espécie E. faecalis. Esse dado está em acordo com estudos mais antigos, os quais

demostravam que, divergentemente do que é encontrado nos EUA e na Europa, o

Brasil apresentava uma maior prevalência da resistência à vancomicina nos isolados

de Enterococcus da espécie E. faecalis (BENDER et al., 2009; CAIAFFA FILHO et

al., 2003; ROSSI, 2011). Contudo, com o passar dos anos, a epidemiologia brasileira

das infecções enterocócicas vem sofrendo mudanças, tornando-se mais semelhante

à das demais regiões do mundo. SACRAMENTO e colaboradores (2017)

observaram, em um estudo retrospectivo, de 18 anos, com isolados do sudeste

brasileiro, a emergência de casos e surtos por E. faecium.

Quase a totalidade dos isolados de ERV, desse estudo, foi proveniente de

cultura de vigilância. Estudos brasileiros já demostraram que infecção por ERV ainda

possuem baixa prevalência, contudo são registrados, em todo o país, altos índices

Page 60: nterococcus sp CIDADE DO NATAL-RN · 2019-06-09 · Oliveira, Em ília Sousa de. Emerg ê ncia de enterococcus sp. resistentes à vancomicina na cidade do Natal - RN / Em ília Sousa

60

de isolamento a partir da pesquisa da colonização intestinal, pelas culturas de

vigilância através de swab anal ou perianal (FURTADO et al., 2005; RIBAS et al.,

2007). FURTADO e colaboradores (2005) observaram uma prevalência de 32,6% de

pacientes colonizados por ERV nas UTI de um hospital em São Paulo, e que alguns

fatores estavam intimamente associados a alta taxa de colonização, como a

hospitalização prévia, as infeções hospitalares, o tempo de estadia no hospital e nas

UTI e o período de tratamento antimicrobiano. Além disso, a colonização por ERV

também são encontrados em outros tipos de unidades de cuidados à saúde (BADEN

et al., 2001; FREITAS et al., 2018; NUCLEO et al., 2018).Um paciente dessa

pesquisa, o qual foi positivo para a cultura de vigilância por swab perianal,

desenvolveu infecção por ERV, provavelmente em virtude da colonização por esse

micro-organismo. Este paciente possuía ulcera de pé diabético de calcâneo e

apresentou o micro-organismo em cultura de fragmento de osso. Sendo assim,

mesmo a taxa de infecção sendo baixa, a colonização por ERV é considerada um

fator primordial para o desenvolvimento da infecção, pois a partir desse nicho

biológico eles são capazes de penetrar na corrente sanguínea ou mesmo persistir

por longos períodos (UBEDA et al., 2010).

Tanto a colonização como a contaminação do ambiente são considerados

excelentes reservatórios e estão associadas às formas de disseminação desse

micro-organismo. Além disso, pacientes alojados em quartos ou enfermarias com

contaminação por ERV apresentam alta possibilidade de desenvolver infecções

decorrentes desses micro-organismos (DREES et al., 2008). Desse modo, a

pesquisa da colonização dos pacientes pela cultura de vigilância é uma importante

forma de controle das IRAS e auxilia no monitoramento de surtos e dispersões

silenciosas dos micro-organismos, como também mapeia áreas de riscos e verifica a

eficácia dos protocolos de intervenção (PITTET et al., 2008).

Nos EUA, em consequência do aumento das taxas de colonização e

infecção pelo ERV no país, em 1995, o Hospital Infection Control Practices Advisory

Commitee publicou uma lista de recomendações para prevenir a disseminação

desse micro-organismo (LARSON et al., 1995). Igualmente, o Brasil sancionou a Lei

nº 9.431 de 6 de janeiro de 1997 e a Portaria nº 2616, de 12 de maio de 1998 as

quais decretavam a obrigatoriedade dos hospitais a manutenção do Programa de

Controle de Infecções Hospitalares, além da constituição das Comissões de

Page 61: nterococcus sp CIDADE DO NATAL-RN · 2019-06-09 · Oliveira, Em ília Sousa de. Emerg ê ncia de enterococcus sp. resistentes à vancomicina na cidade do Natal - RN / Em ília Sousa

61

Controle de Infecções Hospitalares (CCIH) (BRASIL, 1997, 1998). Entre as

orientações incluem o controle rigoroso do uso do antibiótico vancomicina, a

pesquisa ativa da colonização por cultura de vigilância, a detecção precoce nas

amostras clínicas, o isolamento do paciente com a cultura positiva, a higiene das

mãos, o uso de luvas e capotes, a desinfecção do ambiente e a capacitação dos

profissionais de saúde (BRASIL, 2007; LARSON et al., 1995).

Cada hospital tem a autonomia para adotar as recomendações de acordo

com a realidade econômica e epidemiológica da instituição. De acordo com as

CCIH dos hospitais pesquisados nesse estudo, no momento da admissão do

paciente proveniente de outra instituição de saúde é realizado a pesquisa de

colonização por MMR. Por conseguinte, todos os isolados de cultura de vigilância

desse estudo foram coletados no momento da admissão do paciente. Desse modo,

as formas de dispersões dessas cepas entre os pacientes não puderam ser

verificadas.

Já é sabido que isolados de ERV apresentam outras resistências

concomitante aos glicopeptídios (CETINKAYA; FALK; MAYHALL, 2000). Os isolados

pesquisadas demostraram inefetividade in vitro dos antibióticos das classes dos

macrolídeos, quinolonas, tetraciclina além dos glicopeptídios. Com relação à

resistência a altos níveis de aminoglicosídeos, um percentual bastante elevado

(84,6%) apresentou resistência a pelo menos um dos aminoglicosídeos testados.

Perfis de resistência semelhantes são encontrados em outros ERV analisados pelo

mundo (AKPAKA et al., 2017; AKPAKA; KISSOON; JAYARATNE, 2016; VILELA et

al., 2006). A resistência a altos níveis de gentamicina, descrito nesse estudo,

também foi encontrado por MONDINO e colaboradores (2003), o qual descreveu

43,4% de resistência dos isolados culturas de vigilância. No entanto, as resistências

somente à estreptomicina, desse estudo, foram mais baixas dos que normalmente

são observados nesses isolados de ERV.

A resistência aos aminoglicosídios, principalmente a resistência à

gentamicina, já foi observada sendo mais associadas a cepas adaptadas ao

ambiente hospitalar (MONDINO et al., 2003). Além disso, a emergência do ERV tem

surgido em paralelo com o aumento da resistência tanto à penicilina como aos

aminoglicosídios. Essa classe de antibióticos, juntamente com as penicilinas, é

utilizada no tratamento de bacteremias e endocardites graves. Desse modo, a

Page 62: nterococcus sp CIDADE DO NATAL-RN · 2019-06-09 · Oliveira, Em ília Sousa de. Emerg ê ncia de enterococcus sp. resistentes à vancomicina na cidade do Natal - RN / Em ília Sousa

62

importância da pesquisa dessa resistência está relacionada a limitação do

tratamento, pois a resistência resulta na perda do sinergismo farmacológico

(GILMORE; SHEPARD, 2002).

O único isolado resistente a ampicilina pertence a espécie E. faecium.

Fato que já era esperado, tendo em vista que cepas de ERV dessa espécie

apresentam naturalmente resistência aos β-lactâmicos. Todos os isolados do E.

faecalis foram sensíveis à ampicilina. Outros estudos também descreveram

resultados similares (GORDTS et al., 1995; PEREIRA et al., 2010).

Por outro lado, todas as cepas analisadas mostraram-se sensíveis à

linezolida e ao cloranfenicol. De modo geral, a resistência à linezolida ainda é

incomum, contudo por terapia farmacológica inadequada, já foi reportado casos de

disseminação de clones resistentes no Brasil (VILELA et al., 2006) e no mundo

(NTOKOU et al., 2012). Contudo, a sensibilidade ao fármaco cloranfenicol é

extremante elevada quando comparada a outros estudos brasileiros, talvez em

decorrência da baixa utilização desse medicamento nos hospitais pesquisados

(MONDINO et al., 2003; VILELA et al., 2006).

A característica básica dos isolados que apresentam resistência à

vancomicina é a resistência concomitante à teicoplanina. O fato é determinado pelo

tipo de operon presente no genoma do enterococo. Desse modo, a susceptibilidade

a esses dois antibióticos foi analisada. Todas as cepas mostraram-se resistentes às

duas drogas, quando avaliadas pelas técnicas do disco-difusão. Todavia, ao

determinar a CIM para o antibiótico teicoplanina, somente 58,1%, de acordo com o

ponto de corte do CLSI (2018), se mostraram resistentes. Porém quando avaliadas

pelo ponto de corte do EUCAST/BRCAST (2018) esse percentual aumentou para

98,4%. Como preconizado, o teste de disco difusão foi utilizado somente como um

indicativo inicial da resistência (BRCAST, 2018; CLSI, 2018; EUCAST, 2018).

Todas as cepas analisadas foram positivas para o gene vanA,

demonstrando assim, que vários isolados apresentavam incongruência entre o

fenótipo e o genótipo apresentado. Esse tipo de incompatibilidade já foi reportado

em vários lugares do mundo, como também no Brasil (HASHIMOTO, 2000;

HENRIQUE et al., 2008; LAUDERDALE et al., 2002; LEE et al., 2004; ZANELLA et

al., 2006). Essa mesma alteração foi observada no único isolado de ERV reportado

por COSTA (2012), o qual apresentava resistência intermediária à teicoplanina e

Page 63: nterococcus sp CIDADE DO NATAL-RN · 2019-06-09 · Oliveira, Em ília Sousa de. Emerg ê ncia de enterococcus sp. resistentes à vancomicina na cidade do Natal - RN / Em ília Sousa

63

resistência completa à vancomicina, com o gene vanA. Estudos sugerem que essa

divergência entre o fenótipo e o genótipo ocorre em resultado a deleções na região

terminal do transposon Tn1546, o qual abriga o operon vanA, podendo ser por

mutações na região regulatório (vanS) ou mesmo por rearranjo do operon vanA com

alterações na porção dos genes acessórios (vanX, vanY e vanZ) (HASHIMOTO,

2000; HENRIQUE et al., 2008; LEE et al., 2004). É bem documentado que esse

operon vanA é o mais prevalente tanto em isolados brasileiros como em outras

partes do mundo (CAIAFFA FILHO et al., 2003; DESHPANDE et al., 2007; NOVAIS

et al., 2008; SACRAMENTO et al., 2016; VAN HAL et al., 2016; VILELA et al., 2006;

ZANELLA et al., 2003).

Os fatores de virulência apresentam papel importante na colonização,

permanência, invasão tecidual e evasão do sistema imune, por consequência

entender os padrões dos genótipos de virulência nos isolados de ERV auxilia na

compreensão da epidemiologia das infecções por esses micro-organismos. Os

fatores de virulência mais comuns desse gênero diferem entre as espécies de

Enterococcus. Em virtude da grande diferença entre os números dos isolados, foram

pesquisados somente os genes de virulência para a E. faecalis. Foi observado a

prevalência da presença da Gel, Esp, Asa e Cyl que já foram descritos como

capazes de influenciar a relação parasito hospedeiro (COBURN; GILMORE, 2003;

KRISTICH et al., 2004; SHANKAR et al., 1999). Os genes de virulência mais

prevalentes encontrados foram o de produção da gelatinase e o da substância de

agregação, os quais estavam presentes em quase totalidade dos isolados. Esses

dados demostraram que as cepas pesquisadas são menos virulentas do que a

grande maioria dos isolados reportados, os quais demostram altos índices de

positividade para os genes produtores de Esp, Asa, Cyl e Gel (CAMARGO et al.,

2008; COMERLATO et al., 2013; LIU et al., 2011). Quando comparado a

caracterização dos Enterococcus realizada há sete anos com isolados da região de

Natal, foi observado uma maior prevalência do gene gelE, semelhante aos nossos,

contudo, em relação a frequência de esp e cylA foram relatados com uma

porcentagem maior que o encontrado no nosso estudo, enquanto o asa1 possuía um

baixo índice (COSTA, 2012).

Diferentemente do observado nesse estudo, pesquisa realizada em

Londrina, observou que mais da metade das amostras pesquisadas foram positivas

Page 64: nterococcus sp CIDADE DO NATAL-RN · 2019-06-09 · Oliveira, Em ília Sousa de. Emerg ê ncia de enterococcus sp. resistentes à vancomicina na cidade do Natal - RN / Em ília Sousa

64

para Esp, e somente cerca de 36% e 43% para Asa e Gel, respectivamente

(MARQUES; SUZART, 2004). COMERLATO e colaboradores (2013) observaram

que isolados de ERV de E. faecalis apresentaram altos índices de positividade para

os genes associados a formação de biofilme (asa, esp, gel), sendo a gel com maior

prevalência (95%), seguido por esp (80%) e asa (65%). Além dos mais, vale

ressaltar que já foi demostrado a correlação entre a presença do gene esp e gel com

a habilidade de produzir biofilme em clones epidêmicos. (ARCIOLA et al., 2008).

A utilização dos métodos moleculares de tipagens vem colaborando para

o esclarecimento da etiologia dos isolados de ERV, além de ser uma importante

ferramenta para a elucidação dos padrões de disseminação desses patógenos.

Diversos estudos já relataram surtos e dispersões por clones geneticamente

relacionados de ERV. Além disso, clones relacionados geneticamente foram

reportados sugerindo transmissão cruzada entre diferentes hospitais, que podem

esta associados a transferência do paciente entre as instituições de saúde ou

através dos profissionais de saúde (MORETTI et al., 2004; PARK et al., 2012;

PEREIRA et al., 2010). Além dos mais, estudo moleculares já constataram padrões

de colonização persistente. BADEN e colaboradores (2001), verificaram a

colonização prolongada de ERV por mais de um ano em pacientes de uma casa de

repouso.

Nesse estudo, foi observado, através da metodologia tipagem molecular

por PFGE, que os isolados pesquisados pertenciam apenas a dois perfis clonais,

denominados clones A e B. O clone A, levemente mais prevalente que o clone B.

Os dois clones encontram-se distribuídos entre os pacientes de todos os hospitais

pesquisados. No entanto, o clone A apresentou mais fatores de virulência quando

comparado ao clone B.

Estudos já demostraram que a transmissão clonal pode estar associada a

presença de alguns tipos de resistência. Já foram relatados surtos por ERV

produtores de β-lactamases e por enterococos com fenótipo de HLRA,

principalmente com resistência à gentamicina (ANTALEK et al., 1995; CLARK et al.,

1993; HANDWERGER et al., 1993; MARKOWITZ et al., 1991; MONDINO et al.,

2003; MURRAY et al., 1992; ZERVOS et al., 1987). No entanto, nenhuma correlação

entre o perfil de resistência e o clone mais prevalente foi observado no estudo.

Page 65: nterococcus sp CIDADE DO NATAL-RN · 2019-06-09 · Oliveira, Em ília Sousa de. Emerg ê ncia de enterococcus sp. resistentes à vancomicina na cidade do Natal - RN / Em ília Sousa

65

Adicionalmente, a tipagem por MLST foi desenvolvida com intuito de ser

utilizada em investigações mais global e de longo prazo. Através dessa técnica

foram identificados dois ST (Sequence Type) diferentes. O clone A pertence ao

ST525, enquanto o clone B ao ST6. Esses dois ST representam cepas epidêmicas

extremamente bem adaptadas as pressões do ambiente hospitalar e com grande

capacidade de persistir nesse tipo de ambiente. O ST6 vem sendo descrito por todo

o mundo (ALONSO et al., 2017; FREITAS et al., 2009; KUCH et al., 2012; LÓPEZ et

al., 2012; RUIZ-GARBAJOSA et al., 2006; SANTOS et al., 2017). Por outro lado, o

ST525 foi unicamente reportado no Brasil (ALMEIDA et al., 2014; SANTOS et al.,

2017). No estudo de ALMEIDA e colaboradores (2014) foi reportado o primeiro

isolamento do ST525, sendo esses isolados resistentes a vários antibióticos,

inclusive à linezolida. Entretanto, SANTOS e colaboradores (2017) isolaram cepas

apresentando esse ST com o fenótipo de resistência semelhante ao observado no

nesse estudo. Essa pesquisa apresenta o primeiro relato que observa esse ST no

nordeste brasileiro.

De acordo com o database pubMLST, as diferenças básicas entre os dois

ST são unicamente em dois alelos, o gki e o xpt. Para o gki são somente quatro

alterações na sequência o que modificou do alelo 7 para o alelo 32. As diferenças

foram nas regiões: 57 (citosina para timina), 141 (guanina para adenina), 220

(adenina para guanina) e 438 (citosina para timina). Desse modo, os dois

apresentando uma similaridade de 99,09%. Já o locus xpt houve somente uma

alteração na sequência, do alelo 1 para 26, em um aminoácido na região 15, uma

guanina foi trocada por uma adenina.

Os dois ST são incluídos ao complexo clonal CC2 juntamente com o ST2

e ST51. Além disso, conjuntamente com o CC9 e CC4, são os tipos moleculares

mais prevalentes em amostras tanto de infecção como de colonização no Brasil

(RUIZ-GARBAJOSA et al., 2006; SACRAMENTO et al., 2017; SANTOS et al., 2017).

RUIZ-GARBAJOSA e colaboradores (2006), utilizando-se de 110 isolados de E.

faecalis de diferentes regiões do mundo para tipagem por MLST, observou

complexos genéticos adaptados ao ambiente hospitalar e entre os maiores

complexos encontrava-se o CC2. Outras análises genéticas do E. faecalis

revelaram que a resistência adquirida aos antibióticos mais prevalentes foram nas

Page 66: nterococcus sp CIDADE DO NATAL-RN · 2019-06-09 · Oliveira, Em ília Sousa de. Emerg ê ncia de enterococcus sp. resistentes à vancomicina na cidade do Natal - RN / Em ília Sousa

66

linhagem genéticas CC2, além de ser encontrado quase que unicamente

proveniente de amostras hospitalares (KUCH et al., 2012; MCBRIDE et al., 2007).

Como observado, o estudo ilustra a relevância da vigilância

epidemiológica nas instituições de saúde com o intuito de identificar, monitorar e

controlar a disseminação desses micro-organismos no ambiente hospitalar. Além

disso, a presença ERV no trato gastrointestinal demonstra a existência de um

grande reservatório dessas bactérias. Sendo assim, surtos tornam-se difíceis de

controlar após a sua introdução nos hospitais, tendo em vista a colonização dos

pacientes. Além do mais, contaminação do ambiente e da equipe assistencial

também estão intimamente relacionados com a dispersão desses organismos e a

dificuldade na erradicação do mesmo.

A realização de programas de vigilância para MMR são imprescindíveis

para detectar os portadores e implementar as medidas de controle. Por não haver

concordância entre os protocolos de descolonização do paciente ERV positivo, a

metodologia recomendada para esses casos e adotado pelos hospitais pesquisados

são a prevenção de contato, a higiene das mãos, o uso de aventais e de luvas, além

da descontaminação do ambiente e do material utilizado. Como também, o uso

prudente dos antibióticos no tratamento. Desse modo, é possível diminuir a

prevalência de casos por ERV (BRASIL, 2007, 2009).

Embora a forma que ocorreu essa disseminação e emergência desse

micro-organismo, pelos pacientes e hospitais da cidade do Natal, ainda permaneça

incerta, com necessidades de mais esclarecimentos, a dispersão inter-hospitalar

durante um período prolongado de tempo destaca a necessidade de medidas de

melhoria na higiene e na melhor administração da terapia antimicrobiana com intuito

de conter esse cenário de potencial epidemia de infecção por ERV.

Page 67: nterococcus sp CIDADE DO NATAL-RN · 2019-06-09 · Oliveira, Em ília Sousa de. Emerg ê ncia de enterococcus sp. resistentes à vancomicina na cidade do Natal - RN / Em ília Sousa

67

7 CONCLUSÃO

Essa pesquisa permitiu concluir que:

• A espécie E. faecalis é a mais prevalente nos hospitais pesquisados;

• Os ERV apresentaram multirresistência, com resistência a pelo menos

quatro classes diferentes (glicopeptídio, macrolídeo, tetraciclina e

quinolonas) de antimicrobianos utilizados na rotina clínica;

• Ocorreu uma alta prevalência de isolados ERV apresentando o fenótipo

HLRA.

• A elevada susceptibilidade observada à linezolida sugere que essa

droga pode ser utilizada como opção viável para o tratamento de

infecções enterocócicas;

• Todos os ERV pertencem ao genótipo vanA;

• Todos os ERV apresentaram pelo menos um fator de virulência, sendo

os genes gelE (gelatinase) e asa1 (substância agregativa) os mais

prevalentes;

• A tipagem com PFGE evidenciou uma disseminação de dois clones (A

e B), que possivelmente dispersaram igualmente pelos hospitais da

cidade do Natal;

• A tipagem por MLST demostrou que os clones A e B pertencem aos

ST6 e ST525, do complexo clonal CC2. O primeiro, associado a infecções

humanas em hospitais de todo mundo e o segundo, epidêmico no Brasil.

Page 68: nterococcus sp CIDADE DO NATAL-RN · 2019-06-09 · Oliveira, Em ília Sousa de. Emerg ê ncia de enterococcus sp. resistentes à vancomicina na cidade do Natal - RN / Em ília Sousa

68

REFERENCIAL BIBLIOGRÁFICO

AKPAKA, Patrick Eberechi et al. Genetic characteristics and molecular epidemiology of vancomycin-resistant Enterococci isolates from Caribbean countries. PLOS ONE, [s. l.], v. 12, n. 10, p. 1–11, 2017.

AKPAKA, Patrick Eberechi; KISSOON, Shivnarine; JAYARATNE, Padman. Molecular Analysis of Vancomycin-Resistant Enterococci Isolated from Regional Hospitals in Trinidad and Tobago. Advances in Medicine, [s. l.], v. 2016, p. 1–8, 2016.

ALMEIDA, Lara M. De et al. Linezolid Resistance in Vancomycin-Resistant Enterococcus faecalis and Enterococcus faecium Isolates in a Brazilian Hospital. Antimicrobial Agents and Chemotherapy, [s. l.], v. 58, n. 5, p. 2993–2994, 2014.

ALONSO, Carla Andrea et al. Persistencia de un clon ST6 de Enterococcus faecalis con genotipo van B2 en dos hospitales de Aragón. Enfermedades Infecciosas y Microbiología Clínica, [s. l.], v. 35, n. 9, p. 578–581, 2017.

ALOTAIBI, Fawzia E.; BUKHARI, Elham E. Emergence of Vancomycin-resistant Enterococci at a Teaching Hospital, Saudi Arabia. Chinese Medical Journal, [s. l.], v. 130, n. 3, p. 340–346, 2017.

ANTALEK, Matthew D. et al. Clinical and molecular epidemiology of Enterococcus faecalis bacteremia, with special reference to strains with high-level resistance to gentamicin. Clinical infectious diseases : an official publication of the Infectious Diseases Society of America, [s. l.], v. 20, n. 1, p. 103–9, 1995.

ARCIOLA, Carla Renata et al. Strong biofilm production, antibiotic multi-resistance and high gelE expression in epidemic clones of Enterococcus faecalis from orthopaedic implant infections. Biomaterials, [s. l.], v. 29, n. 5, p. 580–586, 2008.

ARSÈNE, Stéphanie; LECLERCQ, Roland. Role of a qnr-Like Gene in the Intrinsic Resistance of Enterococcus faecalis to Fluoroquinolones. Antimicrobial Agents and Chemotherapy, [s. l.], v. 51, n. 9, p. 3254–3258, 2007.

ARTHUR, Michel et al. The VanS sensor negatively controls VanR-mediated transcriptional activation of glycopeptide resistance genes of Tn1546 and related elements in the absence of induction. Journal of Bacteriology, [s. l.], v. 179, n. 1, p.

Page 69: nterococcus sp CIDADE DO NATAL-RN · 2019-06-09 · Oliveira, Em ília Sousa de. Emerg ê ncia de enterococcus sp. resistentes à vancomicina na cidade do Natal - RN / Em ília Sousa

69

97–106, 1997.

BADEN, Lindsey. R. et al. Prolonged Colonization with Vancomycin‐Resistant

Enterococcus faecium in Long‐Term Care Patients and the Significance of “Clearance”. Clinical Infectious Diseases, [s. l.], v. 33, n. 10, p. 1654–1660, 2001.

BALDASSARRI, Lucilla et al. Pathogenesis of implant infections by enterococci. The International journal of artificial organs, [s. l.], v. 28, n. 11, p. 1101–9, 2005.

BAPTISTA, Marina et al. Specificity of induction of glycopeptide resistance genes in Enterococcus faecalis. Antimicrobial agents and chemotherapy, [s. l.], v. 40, n. 10, p. 2291–5, 1996.

BAPTISTA, Marina et al. Single-cell analysis of glycopeptide resistance gene expression in teicoplanin-resistant mutants of a VanB-type Enterococcus faecalis. Molecular Microbiology, [s. l.], v. 32, n. 1, p. 17–28, 1999.

BARLOW, Miriam; HALL, Barry G. Phylogenetic Analysis Shows That the OXA b-Lactamase Genes Have Been on Plasmids for Millions of Years. Journal of Molecular Evolution, [s. l.], v. 55, n. 3, p. 314–321, 2002.

BEAUREGARD, Daniel A. et al. Dimerization and membrane anchors in extracellular targeting of vancomycin group antibiotics. Antimicrobial Agents and Chemotherapy, [s. l.], v. 39, n. 3, p. 781–785, 1995.

BELL, Jan M.; PATON, J. C.; TURNIDGE, J. Emergence of vancomycin-resistant enterococci in Australia: phenotypic and genotypic characteristics of isolates. Journal of clinical microbiology, [s. l.], v. 36, n. 8, p. 2187–90, 1998.

BENDER, Eduardo André; et al. Identification, Antimicrobial Resistance and Genotypic Characterization of Enterococcus spp. isolated in Porto Alegre, Brasil. Brazilian Journal of Microbiology, [s. l.], v. 40, p. 693–700, 2009.

BENTORCHA, Fairouze; DE CESPÉDÈS, Gilda; HORAUD, Thea. Tetracycline resistance heterogeneity in Enterococcus faecium. Antimicrobial agents and chemotherapy, [s. l.], v. 35, n. 5, p. 808–12, 1991.

BINDA, Elisa; MARINELLI, Flavia; MARCONE, Giorgia. Old and New Glycopeptide Antibiotics: Action and Resistance. Antibiotics, [s. l.], v. 3, n. 4, p. 572–594, 2014.

Page 70: nterococcus sp CIDADE DO NATAL-RN · 2019-06-09 · Oliveira, Em ília Sousa de. Emerg ê ncia de enterococcus sp. resistentes à vancomicina na cidade do Natal - RN / Em ília Sousa

70

BONTEN, Marc JM et al. Epidemiology of colonisation of patients and environment with vancomycin-resistant enterococci. The Lancet, [s. l.], v. 348, n. 9042, p. 1615–1619, 1996.

BOYCE, J. M. et al. Outbreak of multidrug-resistant Enterococcus faecium with transferable vanB class vancomycin resistance. Journal of clinical microbiology, [s. l.], v. 32, n. 5, p. 1148–53, 1994.

BRANDL, Katharina et al. Vancomycin-resistant enterococci exploit antibiotic-induced innate immune deficits. Nature, [s. l.], v. 455, n. 7214, p. 804–807, 2008.

BRASIL. Decreto-Lei no 9.431, de 6 de janeiro de 1997 da Presidência da República. 1997. Disponível em: <http://www.planalto.gov.br/ccivil_03/leis/l9431.htm>. Acesso em: 10 jan. 2019.

BRASIL. Portaria no 2616, de 12 de maio de 1998 do Ministério da Saúde. 1998. Disponível em: <http://bvsms.saude.gov.br/bvs/saudelegis/gm/1998/prt2616_12_05_1998.html>. Acesso em: 10 jan. 2019.

BRASIL. Investigação e Controle de Bactérias Multirresistentes. 2007. Disponível em: <http://www.anvisa.gov.br/servicosaude/controle/reniss/manual _controle_bacterias.pdf>. Acesso em: 10 jan. 2019.

BRASIL. SEGURANÇA DO PACIENTE EM SERVIÇOS DE SAÚDE: Higienização das mãos. 2009. Disponível em: <www.anvisa.gov.br>. Acesso em: 10 jan. 2019.

BRASIL. Boletim de Segurança do Paciente e Qualidade em Serviços de Saúde no 16: Avaliação dos indicadores nacionais das Infecções Relacionadas à Assistência à Saúde (IRAS) e Resistência microbiana do ano de 2016. 2016. Disponível em: <https://www20.anvisa.gov.br/segurancadopaciente/index.php/publicacoes/item/boletim-de-seguranca-do-paciente-e-qualidade-em-servicos-de-saude-n-13-avaliacao-dos-indicadores-nacionais-das-infeccoes-relacionadas-a-assistencia-a-saude-iras-e-resistencia-micro>. Acesso em: 10 jan. 2019.

BRCAST. Tabela de Pontos de Corte Clínicos do BrCAST. 2018. Disponível em: <http://www.brcast.org.br>. Acesso em: 15 set. 2018.

CAIAFFA FILHO, Helio H. et al. Molecular characterization of van genes found in

Page 71: nterococcus sp CIDADE DO NATAL-RN · 2019-06-09 · Oliveira, Em ília Sousa de. Emerg ê ncia de enterococcus sp. resistentes à vancomicina na cidade do Natal - RN / Em ília Sousa

71

vancomycin-resistant Enterococcus spp. isolated from Hospital das Clínicas, FMUSP, São Paulo, Brazil. Brazilian Journal of Infectious Diseases, [s. l.], v. 7, n. 3, p. 173–174, 2003.

CAMARGO, Ilana L. B. C. et al. Virulence factors in vancomycin-resistant and vancomycin- susceptible Enterococcus faecalis from Brazil. Brazilian journal of microbiology : [publication of the Brazilian Society for Microbiology], [s. l.], v. 39, n. 2, p. 273–8, 2008.

CATTOIR, Vincent; LECLERCQ, Roland. Twenty-five years of shared life with vancomycin-resistant enterococci: is it time to divorce? Journal of Antimicrobial Chemotherapy, [s. l.], v. 68, n. 4, p. 731–742, 2013.

CETINKAYA, Yesim; FALK, Pamela; MAYHALL, C. Glen. Vancomycin-Resistant Enterococci. Clinical Microbiology Reviews, [s. l.], v. 13, n. 4, p. 686–707, 2000.

CHOPRA, Ian.; ROBERTS, Marilyn. Tetracycline Antibiotics: Mode of Action, Applications, Molecular Biology, and Epidemiology of Bacterial Resistance. Microbiology and Molecular Biology Reviews, [s. l.], v. 65, n. 2, p. 232–260, 2001.

CLARK, Nancye. C. et al. Characterization of glycopeptide-resistant enterococci from U.S. hospitals. Antimicrobial Agents and Chemotherapy, [s. l.], v. 37, n. 11, p. 2311–2317, 1993.

CLEWELL, Don. B. Movable genetic elements and antibiotic resistance in enterococci. European journal of clinical microbiology & infectious diseases : official publication of the European Society of Clinical Microbiology, [s. l.], v. 9, n. 2, p. 90–102, 1990.

CLSI. Performance Standards for Antimicrobial Susceptibility Testing. Wayne, PA, v. 28, n. Supplement_M100, p. 1–224, 2018.

COBURN, Phillip S.; GILMORE, Michael S. The Enterococcus faecalis cytolysin: a novel toxin active against eukaryotic and prokaryotic cells. Cellular Microbiology, [s. l.], v. 5, n. 10, p. 661–669, 2003.

COELHO, Camila Gomes Virginio et al. Incidência de Enterococcus resistente à vancomicina em hospital terciário na cidade de Fortaleza-Ceará. Anais do 26o Congresso Brasileiro de Microbiologia, Foz do Iguaçu, p. 2019, 2011.

Page 72: nterococcus sp CIDADE DO NATAL-RN · 2019-06-09 · Oliveira, Em ília Sousa de. Emerg ê ncia de enterococcus sp. resistentes à vancomicina na cidade do Natal - RN / Em ília Sousa

72

COMERLATO, Carolina Baldisserotto et al. Presence of virulence factors in Enterococcus faecalis and Enterococcus faecium susceptible and resistant to vancomycin. Memorias do Instituto Oswaldo Cruz, [s. l.], v. 108, n. 5, p. 590–5, 2013.

CORREA, Adriana Aparecida Feltrin et al. Small hospitals matter: insights from the emergence and spread of vancomycin-resistant enterococci in 2 public hospitals in inner Brazil. Diagnostic Microbiology and Infectious Disease, [s. l.], v. 82, n. 3, p. 227–233, 2015.

COSTA, Mizia Karla de Carvalho Martins. Caracterização fenotípica e molecular de amostras de Enterococcus isoladas em hospitais da cidade do Natal/ RN. 2012. Universidade Federal do Rio de Janeiro, [s. l.], 2012.

COSTA, Yuri et al. Characterization of the chromosomal aac(6’)-Ii gene specific for Enterococcus faecium. Antimicrobial Agents and Chemotherapy, [s. l.], v. 37, n. 9, p. 1896–1903, 1993.

COURVALIN, Patrice. Vancomycin Resistance in Gram-Positive Cocci. Clinical Infectious Diseases, [s. l.], v. 42, n. Supplement_1, p. S25–S34, 2006.

CRISTINA, Bazet et al. Enterococos resistentes a vancomicina: Un problema emergente en Uruguay. Revista Médica del Uruguay, [s. l.], v. 21, p. 151–158, 2005.

CYNAMON, Michael H.; GRANATO, Paul A. Comparison of the in vitro activities of teichomycin A2 and vancomycin against staphylococci and enterococci. Antimicrobial agents and chemotherapy, [s. l.], v. 21, n. 3, p. 504–5, 1982.

DALLA COSTA, Libera M. et al. Vancomycin-Resistant Enterococcus faecium: First Case in Brazil. The Brazilian journal of infectious diseases : an official publication of the Brazilian Society of Infectious Diseases, [s. l.], v. 2, n. 3, p. 160–163, 1998.

DAVIS, Bernard D. Mechanism of bactericidal action of aminoglycosides. Microbiological reviews, [s. l.], v. 51, n. 3, p. 341–50, 1987.

DESHPANDE, Lalitagauri M. et al. Antimicrobial resistance and molecular epidemiology of vancomycin-resistant enterococci from North America and Europe: a report from the SENTRY antimicrobial surveillance program. Diagnostic

Page 73: nterococcus sp CIDADE DO NATAL-RN · 2019-06-09 · Oliveira, Em ília Sousa de. Emerg ê ncia de enterococcus sp. resistentes à vancomicina na cidade do Natal - RN / Em ília Sousa

73

Microbiology and Infectious Disease, [s. l.], v. 58, n. 2, p. 163–170, 2007.

DEVRIESE, Luc A. et al. Identification of Enterococcus species isolated from foods of animal origin. International Journal of Food Microbiology, [s. l.], v. 26, n. 2, p. 187–197, 1995.

DREES, Marci. et al. Prior Environmental Contamination Increases the Risk of Acquisition of Vancomycin-Resistant Enterococci. Clinical Infectious Diseases, [s. l.], v. 46, n. 5, p. 678–685, 2008.

DUNNY, Gary M. Enterococcal Sex Pheromones: Signaling, Social Behavior, and Evolution. Annual Review of Genetics, [s. l.], v. 47, n. 1, p. 457–482, 2013.

DUTKA-MALEN, Sylvie; EVERS, Stefan; COURVALIN, Patrice. Detection of glycopeptide resistance genotypes and identification to the species level of clinically relevant enterococci by PCR. Journal of Clinical Microbiology, [s. l.], 1995.

ECDC. The European Centre for Disease Prevention and Control (ECDC) pilot point prevalence survey of healthcare-associated infections and antimicrobial use. Euro surveillance, Estocomo, v. 17, n. 46, p. 1–16, 2012.

EDMOND, Michael B. et al. Vancomycin-Resistant Enterococcal Bacteremia : Natural History and Attributable Mortality Vancomycin-Resistant Enterococcal Bacteremia : Natural History and Attributable Mortality. Clinical Infectious Diseases, [s. l.], v. 23, n. 6, p. 1234–1239, 1997.

ELIOPOULOS, George M.; GOLD, Howard. S. Vancomycin‐Resistant Enterococci: Mechanisms and Clinical Observations. Clinical Infectious Diseases, [s. l.], v. 33, n. 2, p. 210–219, 2001.

EUCAST. Breakpoint tables for interpretation of MICs and zone diameters. 2018. Disponível em: <http://www.eucast.org/clinical_breakpoints/>. Acesso em: 15 set. 2018.

EVERS, Stefan; COURVALIN, Patrice. Regulation of VanB-type vancomycin resistance gene expression by the VanS(B)-VanR (B) two-component regulatory system in Enterococcus faecalis V583. Journal of bacteriology, [s. l.], v. 178, n. 5, p. 1302–1309, 1996.

Page 74: nterococcus sp CIDADE DO NATAL-RN · 2019-06-09 · Oliveira, Em ília Sousa de. Emerg ê ncia de enterococcus sp. resistentes à vancomicina na cidade do Natal - RN / Em ília Sousa

74

FACKLAM, Richard R.; CARVALHO, Maria da Gloria S.; TEIXEIRA, Lucia M. History, Taxonomy, Biochemical Characteristics, and Antibiotic Susceptibility Testing of Enterococci. In: The Enterococci. [s.l.] : American Society of Microbiology, 2002. p. 1–54.

FOULQUIÉ MORENO, Maria R. et al. The role and application of enterococci in food and health. International Journal of Food Microbiology, [s. l.], v. 106, n. 1, p. 1–24, 2006.

FRANZ, Charles M. A. P. et al. Enterococci in foods - A conundrum for food safety. International Journal of Food Microbiology, [s. l.], v. 88, n. 2–3, p. 105–122, 2003.

FRANZ, Charles M. A. P. et al. Enterococci as probiotics and their implications in food safety. International Journal of Food Microbiology, [s. l.], v. 151, n. 2, p. 125–140, 2011.

FREITAS, ALYNE SOARES. Perfil epidemiológico de Enterobacteriaceae resistentes aos carbapenêmicos e de Enterococcus spp. resistentes à vancomicina isolados de cultura de vigilância, em um hospital terciário de Fortaleza, Ceará. 2018. Universidade Federal do Ceará, [s. l.], 2018.

FREITAS, Ana R. et al. Clonal expansion within clonal complex 2 and spread of vancomycin-resistant plasmids among different genetic lineages of Enterococcus faecalis from Portugal. Journal of Antimicrobial Chemotherapy, [s. l.], v. 63, n. 6, p. 1104–1111, 2009.

FREITAS, Ana R. et al. Microevolutionary Events Involving Narrow Host Plasmids Influences Local Fixation of Vancomycin-Resistance in Enterococcus Populations. PLoS ONE, [s. l.], v. 8, n. 3, p. 1–11, 2013.

FREITAS, Ana R. et al. High rates of colonisation by ampicillin-resistant enterococci in residents of long-term care facilities in Porto, Portugal. International Journal of Antimicrobial Agents, [s. l.], v. 51, n. 3, p. 503–507, 2018.

FRIEDEN, Thomas R. et al. Emergence of vancomycin-resistant enterococci in New York City. The Lancet, [s. l.], v. 342, n. 8863, p. 76–79, 1993.

FURTADO, Guilherme H. C. et al. Prevalence and factors associated with rectal vancomycin-resistant enterococci colonization in two intensive care units in São Paulo, Brazil. The Brazilian journal of infectious diseases : an official

Page 75: nterococcus sp CIDADE DO NATAL-RN · 2019-06-09 · Oliveira, Em ília Sousa de. Emerg ê ncia de enterococcus sp. resistentes à vancomicina na cidade do Natal - RN / Em ília Sousa

75

publication of the Brazilian Society of Infectious Diseases, [s. l.], v. 9, n. 1, p. 64–9, 2005.

GALLI, Dominique.; LOTTSPEICH, Friedrich; WIRTH, Reinhard. Sequence analysis of Enterococcus faecalis aggregation substance encoded by the sex pheromone plasmid pAD1. Molecular Microbiology, [s. l.], v. 4, n. 6, p. 895–904, 1990.

GAO, Wei; HOWDEN, Benjamin P.; STINEAR, Timothy P. Evolution of virulence in Enterococcus faecium, a hospital-adapted opportunistic pathogen. Current Opinion in Microbiology, [s. l.], v. 41, p. 76–82, 2018.

GILMORE, Michael S. et al. Enterococci From Commensals to Leading Causes of Drug Resistant Infection [Internet]. Boston: Massachusetts Eye and Ear Infirmary, 2014.

GILMORE, Michael S.; LEBRETON, Francois; VAN SCHAIK, Willem. Genomic Transition of Enterococci from Gut Commensals to Leading Causes of Multidrug-resistant Hospital Infection in the Antibiotic Era. Curr Opin Microbiol, [s. l.], v. 16, n. 1, p. 10–16, 2013.

GILMORE, Michael S.; SHEPARD, Brett D. Antibiotic-resistant enterococci: The mechanisms and dynamics of drug introduction and resistance. Microbes and Infection, [s. l.], v. 4, n. 2, p. 215–224, 2002.

GIRAFFA, Giorgio. Enterococci from foods. FEMS Microbiology Reviews, [s. l.], v. 26, n. 2, p. 163–171, 2002.

GORDTS, Bart et al. Vancomycin-resistant enterococci colonizing the intestinal tracts of hospitalized patients. Journal of clinical microbiology, [s. l.], v. 33, n. 11, p. 2842–6, 1995.

GUZMAN PRIETO, Ana M. et al. Global Emergence and Dissemination of Enterococci as Nosocomial Pathogens: Attack of the Clones? Frontiers in Microbiology, [s. l.], v. 7, n. May, p. 1–15, 2016.

HANDWERGER, Sandra et al. Nosocomial outbreak due to Enterococcus faecium highly resistant to vancomycin, penicillin, and gentamicin. Clinical infectious diseases : an official publication of the Infectious Diseases Society of America, [s. l.], v. 16, n. 6, p. 750–5, 1993.

Page 76: nterococcus sp CIDADE DO NATAL-RN · 2019-06-09 · Oliveira, Em ília Sousa de. Emerg ê ncia de enterococcus sp. resistentes à vancomicina na cidade do Natal - RN / Em ília Sousa

76

HASHIMOTO, Yuriko. Amino acid substitutions in the VanS sensor of the VanA-type vancomycin-resistant enterococcus strains result in high-level vancomycin resistance and low-level teicoplanin resistance. FEMS Microbiology Letters, [s. l.], v. 185, n. 2, p. 247–254, 2000.

HENDRICKX, Antoni P. A. et al. LPxTG surface proteins of enterococci. Trends in microbiology, [s. l.], v. 17, n. 9, p. 423–30, 2009.

HENRIQUE, Priscila Moraes et al. Molecular characterization of enterococci harboring genotype and phenotype incongruence related to glycopeptide resistance isolated in Brazilian hospitals. Memorias do Instituto Oswaldo Cruz, [s. l.], 2008.

HUYCKE, Mark M.; SAHM, Daniel F.; GILMORE, Michael S. Multiple-drug resistant enterococci: the nature of the problem and an agenda for the future. Emerging infectious diseases, [s. l.], v. 4, n. 2, p. 239–49, 1998.

JACKSON, Charlene R.; FEDORKA-CRAY, Paula J.; BARRETT, John B. Use of a genus- and species-specific multiplex PCR for identification of enterococci. Journal of Clinical Microbiology, [s. l.], v. 42, n. 8, p. 3558–3565, 2004.

KASMAR, Anne G.; HOOPER, David. Farmacologia das Infecções Bacterianas: Síntese da Parede Celular. In: GOLAN, David E. et al. (Eds.). Princípios de farmacologia: a base fisiopatológica da farmacoterapia. 2a ed. Rio de Janeiro: Guanabara Koogan, 2009. p. 562–578.

KAYAOGLU, Güven; ØRSTAVIK, Dag. Virulence factors of Enterococcus faecalis: relationship to endodontic disease. Critical reviews in oral biology and medicine : an official publication of the American Association of Oral Biologists, [s. l.], v. 15, n. 5, p. 308–20, 2004.

KEARNS, A. M.; FREEMAN, R.; LIGHTFOOT, N. F. Nosocomial enterococci: resistance to heat and sodium hypochlorite. The Journal of hospital infection, [s. l.], v. 30, n. 3, p. 193–9, 1995.

KINNEBREW, Melissa A. et al. Bacterial Flagellin Stimulates Toll‐Like Receptor 5–

Dependent Defense against Vancomycin‐Resistant Enterococcus Infection. The Journal of Infectious Diseases, [s. l.], v. 201, n. 4, p. 534–543, 2010.

KÖHLER, Werner. The present state of species within the genera Streptococcus and Enterococcus. International journal of medical microbiology : IJMM, [s. l.], v. 297,

Page 77: nterococcus sp CIDADE DO NATAL-RN · 2019-06-09 · Oliveira, Em ília Sousa de. Emerg ê ncia de enterococcus sp. resistentes à vancomicina na cidade do Natal - RN / Em ília Sousa

77

n. 3, p. 133–50, 2007.

KOLAR, Milan. et al. The influence of antibiotic use on the occurrence of vancomycin-resistant enterococci. Journal of Clinical Pharmacy and Therapeutics, [s. l.], v. 31, n. 1, p. 67–72, 2006.

KONEMAN, Elmer. W. et al. Enterococcus. In: KONEMAN, Elmer W. (Ed.). Diagnóstico microbiológico. 7. ed. Rio de Janeiro: Guanabara Koogan, 2014. p. 589–659.

KRAUSE, Kevin M. et al. Aminoglycosides: An Overview. Cold Spring Harbor Perspectives in Medicine, [s. l.], v. 6, n. 6, p. a027029, 2016.

KREFT, Burkhard et al. Aggregation substance of Enterococcus faecalis mediates adhesion to cultured renal tubular cells. Infection and immunity, [s. l.], v. 60, n. 1, p. 25–30, 1992.

KRISTICH, Christopher J. et al. Esp-Independent Biofilm Formation by Enterococcus faecalis. Journal of Bacteriology, [s. l.], v. 186, n. 1, p. 154–163, 2004.

KRISTICH, Christopher J.; RICE, Louis B.; ARIAS, Cesar A. Enterococcal Infection - Treatment and Antibiotic Resistance. In: GILMORE, Michael S. et al. (Eds.). Enterococci: From Commensals to Leading Causes of Drug Resistant Infection [Internet]. Boston: Massachusetts Eye and Ear Infirmary, 2014. p. 1–58.

KUCH, Alicja et al. Insight into antimicrobial susceptibility and population structure of contemporary human Enterococcus faecalis isolates from Europe. Journal of Antimicrobial Chemotherapy, [s. l.], v. 67, n. 3, p. 551–558, 2012.

LARSON, Elaine L. et al. Recommendations for preventing the spread of vancomycin resistance: Recommendations of the Hospital Infection Control Practices Advisory Committee (HICPAC). American Journal of Infection Control, [s. l.], v. 23, n. 2, p. 87–94, 1995.

LAUDERDALE, Tsai-Ling. et al. Vancomycin-Resistant Enterococci from Humans and Retail Chickens in Taiwan with Unique VanB Phenotype-vanA Genotype Incongruence. Antimicrobial Agents and Chemotherapy, [s. l.], v. 46, n. 2, p. 525–527, 2002.

Page 78: nterococcus sp CIDADE DO NATAL-RN · 2019-06-09 · Oliveira, Em ília Sousa de. Emerg ê ncia de enterococcus sp. resistentes à vancomicina na cidade do Natal - RN / Em ília Sousa

78

LEAVIS, Helen L.; BONTEN, Marc JM; WILLEMS, Rob JL. Identification of high-risk enterococcal clonal complexes: global dispersion and antibiotic resistance. Current Opinion in Microbiology, [s. l.], v. 9, n. 5, p. 454–460, 2006.

LEBRETON, François et al. Tracing the Enterococci from Paleozoic Origins to the Hospital. Cell, [s. l.], v. 169, n. 5, p. 849–861.e13, 2017.

LECLERCQ, Roland. et al. Resistance of Enterococci to Aminoglycosides and Glycopeptides. Clinical Infectious Diseases, [s. l.], v. 15, n. 3, p. 495–501, 1992.

LECLERCQ, Roland et al. Plasmid-mediated resistance to vancomycin and teicoplanin in Enterococcus faecium. The New England journal of medicine, [s. l.], v. 319, n. 3, p. 157–61, 1988.

LEE, Wee Gyo et al. Reduction in Glycopeptide Resistance in Vancomycin-Resistant Enterococci as a Result of vanA Cluster Rearrangements. Antimicrobial Agents and Chemotherapy, [s. l.], v. 48, n. 4, p. 1379–1381, 2004.

LIU, Yingmei et al. Molecular Characterization of Vancomycin-Resistant Enterococci in a Chinese Hospital Between 2003 and 2009. Microbial Drug Resistance, [s. l.], 2011.

LIVORNESE, Lawrence L. et al. Hospital-acquired infection with vancomycin-resistant Enterococcus faecium transmitted by electronic thermometers. Annals of internal medicine, [s. l.], v. 117, n. 2, p. 112–6, 1992.

LOCHAN, Harsha et al. Emergence of vancomycin-resistant Enterococcus at a tertiary paediatric hospital in South Africa. South African Medical Journal, [s. l.], v. 106, n. 6, p. 562–566, 2016.

LÓPEZ, M. et al. Characterization of the Mechanisms of Fluoroquinolone Resistance in Vancomycin-Resistant Enterococci of Different Origins. Journal of Chemotherapy, [s. l.], v. 23, n. 2, p. 87–91, 2011.

LÓPEZ, M. et al. Detection and characterization of a ST6 clone of vanB2-Enterococcus faecalis from three different hospitals in Spain. European Journal of Clinical Microbiology & Infectious Diseases, [s. l.], v. 31, n. 3, p. 257–260, 2012.

MARKOWITZ, Sheldon M. et al. Antimicrobial susceptibility and molecular

Page 79: nterococcus sp CIDADE DO NATAL-RN · 2019-06-09 · Oliveira, Em ília Sousa de. Emerg ê ncia de enterococcus sp. resistentes à vancomicina na cidade do Natal - RN / Em ília Sousa

79

epidemiology of beta-lactamase-producing, aminoglycoside-resistant isolates of Enterococcus faecalis. Antimicrobial Agents and Chemotherapy, [s. l.], v. 35, n. 6, p. 1075–1080, 1991.

MARQUES, Elisa Bittencourt De; SUZART, Sérgio. Occurrence of virulence-associated genes in clinical Enterococcus faecalis strains isolated in Londrina, Brazil. Journal of medical microbiology, [s. l.], v. 53, n. Pt 11, p. 1069–73, 2004.

MARTIN, Johathan D.; MUNDT, J. Orvin. Enterococci in insects. Applied microbiology, [s. l.], v. 24, n. 4, p. 575–80, 1972.

MCBRIDE, Shonna M. et al. Genetic Diversity among Enterococcus faecalis. PLoS ONE, [s. l.], v. 2, n. 7, p. e582, 2007.

MENEZES, Y. K. T. et al. Identification of methicillin-resistant Staphylococcus aureus (MRSA) and vancomycin-resistant Enterococcus (VRE) on surfaces of clinical hospitals of Pernambuco. Anais do 28o Congresso Brasileiro de Microbiologia, Florianópolis, 2015.

METZIDIE, Evgenia et al. Spread of an unusual penicillin- and imipenem-resistant but ampicillin-susceptible phenotype among Enterococcus faecalis clinical isolates. Journal of Antimicrobial Chemotherapy, [s. l.], v. 57, n. 1, p. 158–160, 2006.

MILLER, William R.; MUNITA, Jose M.; ARIAS, Cesar A. Mechanisms of antibiotic resistance in enterococci. Expert Review of Anti-infective Therapy, [s. l.], v. 12, n. 10, p. 1221–1236, 2014.

MOELLERING, Robert. C.; WENNERSTEN, Christine; WEINBERG, Arnold N. Synergy of Penicillin and Gentamicin against Enterococci. Journal of Infectious Diseases, [s. l.], v. 124, n. Supplement 1, p. S207–S213, 1971.

MONDINO, Silvia S. B. et al. Phenotypic and Genotypic Characterization of Clinical and Intestinal Enterococci Isolated from Inpatients and Outpatients in Two Brazilian Hospitals. Microbial Drug Resistance, [s. l.], v. 9, n. 2, p. 167–174, 2003.

MORETTI, Maria Luiza et al. Clonal dissemination of VanA-type glycopeptide-resistant Enterococcus faecalis between hospitals of two cities located 100 km apart. Brazilian Journal of Medical and Biological Research, [s. l.], v. 37, n. 9, p. 1339–1343, 2004.

Page 80: nterococcus sp CIDADE DO NATAL-RN · 2019-06-09 · Oliveira, Em ília Sousa de. Emerg ê ncia de enterococcus sp. resistentes à vancomicina na cidade do Natal - RN / Em ília Sousa

80

MUNDT, J. Orvin. Occurrence of enterococci on plants in a wild environment. Applied microbiology, [s. l.], v. 11, n. October, p. 141–4, 1963.

MURRAY, Barbara E. The Life and Times of the Enterococcus. Clinical Microbiology Reviews, [s. l.], v. 3, n. 1, p. 46–65, 1990.

MURRAY, Barbara E. et al. Intrahospital spread of a single gentamicin-resistant, β-lactamase- producing strain of Enterococcus faecalis in Argentina. Antimicrobial Agents and Chemotherapy, [s. l.], v. 36, n. 1, p. 230–232, 1992.

MURRAY, Barbara E. Diversity among Multidrug-Resistant Enterococci. Emerging Infectious Diseases, [s. l.], v. 4, n. 1, 1998.

NOVAIS, Carla et al. Diversity of Tn1546 and its role in the dissemination of vancomycin-resistant enterococci in Portugal. Antimicrobial Agents and Chemotherapy, [s. l.], v. 52, n. 3, p. 1001–1008, 2008.

NTOKOU, Eleni et al. Intensive care unit dissemination of multiple clones of linezolid-resistant Enterococcus faecalis and Enterococcus faecium. Journal of Antimicrobial Chemotherapy, [s. l.], v. 67, n. 8, p. 1819–1823, 2012.

NUCLEO, Elisabetta et al. Colonization of long-term care facility residents in three Italian Provinces by multidrug-resistant bacteria. Antimicrobial Resistance & Infection Control, [s. l.], v. 7, n. 1, p. 33, 2018.

NUNES, L. E.; CAMPELO, P.; XIMENES, E. A. Antibacterial resistance profiles of Enterococcus faecalis from blood cultures. Anais do 29o Congresso Brasileiro de Microbiologia, Foz do Iguaçu, p. 1024, 2017.

PARK, Shin Yong et al. Immune Evasion of Enterococcus faecalis by an Extracellular Gelatinase That Cleaves C3 and iC3b. The Journal of Immunology, [s. l.], v. 181, p. 6328–6336, 2008.

PARK, Shin Young et al. Vancomycin-resistant Enterococcus faecium outbreak caused by patient transfer in 2 separate intensive care units. American Journal of Infection Control, [s. l.], v. 40, n. 6, p. 565–567, 2012.

PARTE, Aidan C. LPSN—list of prokaryotic names with standing in nomenclature. Nucleic Acids Research, [s. l.], v. 42, n. D1, p. D613–D616, 2014.

Page 81: nterococcus sp CIDADE DO NATAL-RN · 2019-06-09 · Oliveira, Em ília Sousa de. Emerg ê ncia de enterococcus sp. resistentes à vancomicina na cidade do Natal - RN / Em ília Sousa

81

PEPPER, Karen. et al. Location of antibiotic resistance markers in clinical isolates of Enterococcus faecalis with similar antibiotypes. Antimicrobial Agents and Chemotherapy, [s. l.], v. 31, n. 9, p. 1394–1402, 1987.

PEREIRA, Graziella H. et al. Outbreak of vancomycin-resistant enterococci in a tertiary hospital: The lack of effect of measures directed mainly by surveillance cultures and differences in response between Enterococcus faecium and Enterococcus faecalis. American Journal of Infection Control, [s. l.], v. 38, n. 5, p. 406–409, 2010.

PIDOT, Sacha J. et al. Increasing tolerance of hospital Enterococcus faecium to handwash alcohols. Science Translational Medicine, [s. l.], v. 10, n. 452, p. 1–10, 2018.

PINTO, Bruno da Silveira et al. Avaliação da resistência de Enterococcus spp. em relação as drogas beta-lactâmicas e aos aminoglicosídeos. Anais do 26o Congresso Brasileiro de Microbiologia, Foz do Iguaçu, 2011.

PITTET, Didier. et al. Infection control as a major World Health Organization priority for developing countries. Journal of Hospital Infection, [s. l.], v. 68, n. 4, p. 285–292, 2008.

PORTILLO, Aránzazu et al. Macrolide Resistance Genes in Enterococcus spp. Antimicrobial Agents and Chemotherapy, [s. l.], v. 44, n. 4, p. 967–971, 2000.

PORTO, Wanda Rachel Rebouças et al. Incidência de Enterococcus resistente à vancomicina na UTI clínica em hospital de ensino. Anais do 17o Seminário Nacional de Pesquisa em Emfermagem, Natal/RN, v. 1, n. 1, p. 2620, 2013.

RANJBAR, Reza et al. Typing methods used in the molecular epidemiology of microbial pathogens: a how-to guide. The new microbiologica, [s. l.], v. 37, n. 1, p. 1–15, 2014.

RESENDE, Mariah et al. Emergence of vanA vancomycin-resistant Enterococcus faecium in a hospital in Porto Alegre, South Brazil. The Journal of Infection in Developing Countries, [s. l.], v. 8, n. 02, 2014.

RIBAS, Rosineide Marques et al. Vancomycin-resistant van a phenotype Enterococcus faecalis: first case in Minas Gerais state and epidemiological considerations. Brazilian Journal of Infectious Diseases, [s. l.], v. 11, n. 4, p. 439–

Page 82: nterococcus sp CIDADE DO NATAL-RN · 2019-06-09 · Oliveira, Em ília Sousa de. Emerg ê ncia de enterococcus sp. resistentes à vancomicina na cidade do Natal - RN / Em ília Sousa

82

440, 2007.

RICE, Eugene W. et al. Occurrence of high-level aminoglycoside resistance in environmental isolates of enterococci. Applied and environmental microbiology, [s. l.], v. 61, n. 1, p. 374–6, 1995.

RICE, Louis B. Mechanisms of Resistance and Clinical Relevance of Resistance to β-Lactams, Glycopeptides, and Fluoroquinolones. Mayo Clinic Proceedings, [s. l.], v. 87, n. 2, p. 198–208, 2012.

ROSSI, Flávia. The challenges of antimicrobial resistance in Brazil. Clinical Infectious Diseases, [s. l.], 2011.

ROUX, Agnès; PAYNE, Shelley M.; GILMORE, Michael S. Microbial Telesensing: Probing the Environment for Friends, Foes, and Food. Cell Host & Microbe, [s. l.], v. 6, n. 2, p. 115–124, 2009.

ROZDZINSKI, Eva et al. Aggregation substance-mediated adherence of Enterococcus faecalis to immobilized extracellular matrix proteins. Microbial Pathogenesis, [s. l.], v. 30, n. 4, p. 211–220, 2001.

RUIZ-GARBAJOSA, Patricia et al. Multilocus sequence typing scheme for Enterococcus faecalis reveals hospital-adapted genetic complexes in a background of high rates of recombination. Journal of Clinical Microbiology, [s. l.], v. 44, n. 6, p. 2220–2228, 2006.

RUOFF, Kathryn L. et al. Species identities of enterococci isolated from clinical specimens. Journal of clinical microbiology, [s. l.], v. 28, n. 3, p. 435–7, 1990.

RYOU, Marvin; COEN, Donald M. Farmacologia das Infecções Bacterianas: Replicação, Transcrição e Tradução do DNA. In: GOLAN, David E. et al. (Eds.). Princípios de farmacologia: a base fisiopatológica da farmacoterapia. 2a ed. Rio de Janeiro: Guanabara Koogan, 2009. p. 567–561.

SACRAMENTO, Andrey G. et al. Environmental dissemination of vanA -containing Enterococcus faecium strains belonging to hospital-associated clonal lineages: Table 1. Journal of Antimicrobial Chemotherapy, [s. l.], v. 71, n. 1, p. 264–266, 2016.

SACRAMENTO, Andrey G. et al. Changed epidemiology during intra and

Page 83: nterococcus sp CIDADE DO NATAL-RN · 2019-06-09 · Oliveira, Em ília Sousa de. Emerg ê ncia de enterococcus sp. resistentes à vancomicina na cidade do Natal - RN / Em ília Sousa

83

interhospital spread of high-risk clones of vanA-containing Enterococcus in Brazilian hospitals. Diagnostic Microbiology and Infectious Disease, Diagnostic Microbiology and Infectious Disease, [s. l.], 2017.

SANTOS, Barbara A. et al. Major globally disseminated clonal complexes of antimicrobial resistant enterococci associated with infections in cancer patients in Brazil. Infection, Genetics and Evolution, [s. l.], v. 55, n. September, p. 56–62, 2017.

SCHLEIFER, Karl H.; KILPPER-BÄLZ, Renate. Transfer of Streptococcus faecalis and Streptococcus faecium to the Genus Enterococcus nom. rev. as Enterococcus faecalis comb. nov. and Enterococcus faecium comb. nov. International Journal of Systematic Bacteriology, [s. l.], v. 34, n. 1, p. 31–34, 1984.

SCHNAPPINGER, Dirk; HILLEN, Wolfgang. Tetracyclines: antibiotic action, uptake, and resistance mechanisms. Archives of microbiology, [s. l.], v. 165, n. 6, p. 359–69, 1996.

SHANKAR, Viswanathan et al. Infection-derived Enterococcus faecalis strains are enriched in esp, a gene encoding a novel surface protein. Infection and immunity, [s. l.], v. 67, n. 1, p. 193–200, 1999.

SHERMAN, James M. The Streptococci. Bacteriological reviews, [s. l.], v. 1, n. 1, p. 3–97, 1937.

SIVERTSEN, Audun et al. Silenced vanA gene cluster on a transferable plasmid cause outbreak of vancomycin variable enterococci. Antimicrobial agents and chemotherapy, [s. l.], v. 60, n. 7, p. 4419–4127, 2016.

SONG, Xiaoyan et al. Effect of Nosocomial Vancomycin-Resistant Enterococcal Bacteremia on Mortality, Length of Stay, and Costs. Infection Control & Hospital Epidemiology, [s. l.], v. 24, n. 04, p. 251–256, 2003.

TACCONELLI, Evelina et al. Discovery, research, and development of new antibiotics: the WHO priority list of antibiotic-resistant bacteria and tuberculosis. The Lancet Infectious Diseases, [s. l.], v. 18, n. 3, p. 318–327, 2018.

TANG, Shaoyu et al. Aerobic degradation of BDE-209 by Enterococcus casseliflavus : Isolation, identification and cell changes during degradation process. Journal of Hazardous Materials, [s. l.], v. 308, p. 335–342, 2016.

Page 84: nterococcus sp CIDADE DO NATAL-RN · 2019-06-09 · Oliveira, Em ília Sousa de. Emerg ê ncia de enterococcus sp. resistentes à vancomicina na cidade do Natal - RN / Em ília Sousa

84

TEIXEIRA, Lúcia M. et al. Recent Approaches on the Taxonomy of the Enterococci and Some Related Microorganisms. In: HORAUD, T. et al. (Eds.). Streptococci and the Host: Advances in Experimental Medicine and Biology. Boston: Springer, 1997. p. 397–400.

TENOVER, Fred. C. et al. Interpreting chromosomal DNA restriction patterns produced by pulsed- field gel electrophoresis: Criteria for bacterial strain typing. Journal of Clinical Microbiology, [s. l.], v. 33, n. 9, p. 2233–2239, 1995.

THIERCELIN, M. E. Sur un diplocoque saprophyte de l’intestin susceptible de devenir pathogene. CR Soc Biol, [s. l.], v. 5, p. 269–71, 1899.

THOMAS, Vinai Chittezham et al. A fratricidal mechanism is responsible for eDNA release and contributes to biofilm development of Enterococcus faecalis. Molecular Microbiology, [s. l.], v. 72, n. 4, p. 1022–1036, 2009.

THURLOW, Lance R. et al. Gelatinase Contributes to the Pathogenesis of Endocarditis Caused by Enterococcus faecalis. Infection and Immunity, [s. l.], v. 78, n. 11, p. 4936–4943, 2010.

TIMMERS, Gert Jan et al. Outbreak of vancomycin-resistant Enterococcus faecium in a haematology unit: risk factor assessment and successful control of the epidemic. British Journal of Haematology, [s. l.], v. 116, n. 4, p. 826–833, 2002.

TOLEDO-ARANA, Alejandro et al. The Enterococcal Surface Protein, Esp, Is Involved in Enterococcus faecalis Biofilm Formation. APPLIED AND ENVIRONMENTAL MICROBIOLOGY, [s. l.], v. 67, n. 10, p. 4538–4545, 2001.

TOP, Janetta; WILLEMS, Rob; BONTEN, Marc. Emergence of CC17 Enterococcus faecium: From commensal to hospital-adapted pathogen. FEMS Immunology and Medical Microbiology, [s. l.], v. 52, n. 3, p. 297–308, 2008.

TORNIEPORTH, Nadia G. et al. Risk factors associated with vancomycin-resistant Enterococcus faecium infection or colonization in 145 matched case patients and control patients. Clinical infectious diseases : an official publication of the Infectious Diseases Society of America, [s. l.], v. 23, n. 4, p. 767–72, 1996.

UBEDA, Carles et al. Vancomycin-resistant Enterococcus domination of intestinal microbiota is enabled by antibiotic treatment in mice and precedes bloodstream invasion in humans. Journal of Clinical Investigation, [s. l.], v. 120, n. 12, p. 4332–

Page 85: nterococcus sp CIDADE DO NATAL-RN · 2019-06-09 · Oliveira, Em ília Sousa de. Emerg ê ncia de enterococcus sp. resistentes à vancomicina na cidade do Natal - RN / Em ília Sousa

85

4341, 2010.

UBEDA, Carles et al. Intestinal Microbiota Containing Barnesiella Species Cures Vancomycin-Resistant Enterococcus faecium Colonization. Infection and Immunity, [s. l.], v. 81, n. 3, p. 965–973, 2013.

UTTLEY, Anne H. et al. Vancomycin-resistant enterococci. Lancet, [s. l.], v. 1, n. 8575–6, p. 57–8, 1988.

VAN HAL, Sebastiaan J. et al. Polyclonal emergence of vanA vancomycin-resistant Enterococcus faecium in Australia. Journal of Antimicrobial Chemotherapy, [s. l.], p. dkw539, 2016.

VAN TYNE, Daria; GILMORE, Michael S. Friend Turned Foe: Evolution of Enterococcal Virulence and Antibiotic Resistance. Annual Review of Microbiology, [s. l.], v. 68, n. 1, p. 337–356, 2014.

VAN TYNE, Daria; MARTIN, Melissa; GILMORE, Michael. Structure, Function, and Biology of the Enterococcus faecalis Cytolysin. Toxins, [s. l.], v. 5, n. 5, p. 895–911, 2013.

VANKERCKHOVEN, Vanessa et al. Development of a Multiplex PCR for the Detection of asa1, gelE, cylA, esp, and hyl Genes in Enterococci and Survey for Virulence Determinants among European Hospital Isolates of Enterococcus faecium. Journal of Clinical Microbiology, [s. l.], v. 42, n. 10, p. 4473–4479, 2004.

VILELA, Marinalda Anselmo et al. Identification and molecular characterization of Van A-type vancomycin-resistant Enterococcus faecalis in Northeast of Brazil. Memórias do Instituto Oswaldo Cruz, [s. l.], v. 101, n. 7, p. 715–9, 2006.

WEINER, Lindsey M. et al. Antimicrobial-Resistant Pathogens Associated With Healthcare-Associated Infections: Summary of Data Reported to the National Healthcare Safety Network at the Centers for Disease Control and Prevention, 2011–2014. Infection Control & Hospital Epidemiology, [s. l.], v. 37, n. 11, p. 1288–1301, 2016.

WERNER, Guido. Molecular Typing of Enterococci/Vre. Journal of Bacteriology & Parasitology, [s. l.], v. 01, n. S5, 2013.

Page 86: nterococcus sp CIDADE DO NATAL-RN · 2019-06-09 · Oliveira, Em ília Sousa de. Emerg ê ncia de enterococcus sp. resistentes à vancomicina na cidade do Natal - RN / Em ília Sousa

86

WESTWELL, Martin S.; GERHARD, Ute; WILLIAMS, Dudley H. Two conformers of the glycopeptide antibiotic teicoplanin with distinct ligand binding sites. Journal of antibiotics, [s. l.], v. 48, n. 11, p. 1292–1298, 1995.

WHO. Global priority list of antibiotic-resistant bacteria to guide research, discovery, and development of new antibiotics. Geneva, p. 1–7, 2017.

ZANELLA, Rosemeire Cabo et al. First Confirmed Case of a Vancomycin-Resistant Enterococcus faecium with vanA Phenotype from Brazil: Isolation from a Meningitis Case in São Paulo. Microbial Drug Resistance, [s. l.], v. 5, n. 2, p. 159–162, 1999.

ZANELLA, Rosemeire Cabo et al. Phenotypic and Genotypic Characterization of VanA Enterococcus Isolated During the First Nosocomial Outbreak in Brazil. Microbial Drug Resistance, [s. l.], v. 9, n. 3, p. 283–291, 2003.

ZANELLA, Rosemeire Cobo et al. Emergence of VanB phenotype-vanA genotype in vancomycin-resistant enterococci in Brazilian hospital. Brazilian Journal of Microbiology, [s. l.], v. 37, n. 2, p. 117–118, 2006.

ZARRILLI, Raffaele et al. Molecular epidemiology of high-level aminoglycoside-resistant enterococci isolated from patients in a university hospital in southern Italy. Journal of Antimicrobial Chemotherapy, [s. l.], v. 56, n. 5, p. 827–835, 2005.

ZERVOS, Marcus J. et al. Nosocomial infection by gentamicin-resistant Streptococcus faecalis. An epidemiologic study. Annals of internal medicine, [s. l.], v. 106, n. 5, p. 687–91, 1987.

ZIRAKZADEH, Ali; PATEL, Robin. Vancomycin-Resistant Enterococci: Colonization, Infection, Detection, and Treatment. Mayo Clinic Proceedings, [s. l.], v. 81, n. 4, p. 529–536, 2006.

Page 87: nterococcus sp CIDADE DO NATAL-RN · 2019-06-09 · Oliveira, Em ília Sousa de. Emerg ê ncia de enterococcus sp. resistentes à vancomicina na cidade do Natal - RN / Em ília Sousa

87

APÊNDICE A

TERMO DE CONSENTIMENTO LIVRE E ESCLARECIDO

Este é um convite para você participar da pesquisa: intitulado Caracterização

fenotípica e molecular de cepas de Enterococcus sp. resistentes à

vancomicina (VRE) relacionadas a um surto na cidade do Natal-RN, que tem

como pesquisador, Emília Sousa de Oliveira.

Pedimos a sua autorização para o depósito, o armazenamento, a utilização e

descarte do material biológico humano: cepas bacterianas de Enterococcus sp. -

isolados de cultura de vigilância, cultura de fragmento de osso, cultura de urina,

cultura de ponta de cateter, cultura de secreção de úlcera ou cultura de secreção

ocular. A utilização do seu material biológico está vinculada somente a este projeto

de pesquisa ou se você concordar em outros futuros. Nesta pesquisa pretendemos

caracterizar as bactérias da espécie Enterococcus que são resistentes ao antibiótico

vancomicina que estão relacionadas a um surto infeccioso na cidade do Natal/RN. O

motivo que nos leva a fazer este estudo é que a melhoria do conhecimento e

entendimento sobre esses microrganismos pode resultar em um melhor controle e

prevenção dessas infecções na nossa cidade.

Para esta pesquisa adotaremos os seguintes procedimentos: as bactérias

isoladas serão testadas para averiguar a resistência aos antibióticos que são

utilizados nos hospitais, além disso testaremos quais são os genes encontrados que

resultam na falha ao tratamento ao antibiótico vancomicina e também analisaremos

a semelhança genética entre as bactérias coletadas. Todo o material testado será

armazenado em freezer à -20°C para conservação e a destruição será por vapor de

água em alta temperatura e pressão.

Os riscos envolvidos na pesquisa serão mínimos, todos os recursos serão

utilizados para garantir o seu anonimato nessa pesquisa. Os materiais serão

nomeados somente por numeração para quem não haja identificação. A pesquisa

contribuirá para um entendimento das infecções relacionadas ao Enterococcus na

Rubrica do pesquisador: ____________ Rubrica do participante:____________

Page 88: nterococcus sp CIDADE DO NATAL-RN · 2019-06-09 · Oliveira, Em ília Sousa de. Emerg ê ncia de enterococcus sp. resistentes à vancomicina na cidade do Natal - RN / Em ília Sousa

88

região metropolitana de Natal, e dessa forma, podermos fornecer dados para o

tratamento dessas infecções e para a prevenção das doenças.

Durante todo o período da pesquisa você poderá tirar suas dúvidas ligando

para Emília, telefone: (84) 98743-1008, ou para Profa Maria Celeste, telefone: (84)

98826-4688.

Você tem o direito de se recusar a participar ou retirar seu consentimento, em

qualquer fase da pesquisa, sem nenhum prejuízo para você.

Os dados que você irá nos fornecer serão confidenciais e serão divulgados

apenas em congressos ou publicações científicas, não havendo divulgação de

nenhum dado que possa lhe identificar. Esses dados serão guardados pelo

pesquisador responsável por essa pesquisa por um período de 5 anos na sala Profa

Maria Celeste Nunes de Melo do Departamento de Microbiologia e Parasitologia da

Universidade Federal do Rio Grande do Norte e após esse tempo serão destruídos.

Os pesquisadores tratarão a sua identidade com padrões profissionais de sigilo,

atendendo a legislação brasileira (Resoluções Nº 466/12; 441/11 e a Portaria 2.201

do Conselho Nacional de Saúde e suas complementares), utilizando as informações

somente para fins acadêmicos e científicos.

Se você tiver algum gasto pela sua participação nessa pesquisa, ele será

assumido pelo pesquisador e reembolsado para você. Se você sofrer algum dano

comprovadamente decorrente desta pesquisa, você será indenizado.

Qualquer dúvida sobre a ética dessa pesquisa você deverá ligar para o

Comitê de Ética em Pesquisa da Universidade Federal do Rio Grande do Norte,

telefone 3215-3135.

Este documento foi impresso em duas vias. Uma ficará com você e a outra

com o pesquisador responsável Profa Maria Celeste Nunes de Melo.

Rubrica do pesquisador: ____________ Rubrica do participante:____________

Page 89: nterococcus sp CIDADE DO NATAL-RN · 2019-06-09 · Oliveira, Em ília Sousa de. Emerg ê ncia de enterococcus sp. resistentes à vancomicina na cidade do Natal - RN / Em ília Sousa

89

Consentimento Livre e Esclarecido

Eu, _____________________________________________, portador do documento de

Identidade ____________________ fui informado (a) dos objetivos, métodos, riscos e benefícios da

pesquisa Caracterização fenotípica e molecular de cepas de Enterococcus sp. resistentes à

vancomicina (VRE) relacionadas a um surto na cidade do Natal-RN, de maneira clara e detalhada

e esclareci minhas dúvidas. Sei que a qualquer momento poderei solicitar novas informações e

modificar minha decisão de participar se assim o desejar.

( ) Concordo que o meu material biológico seja utilizado somente para esta pesquisa.

( ) Concordo que o meu material biológico possa ser utilizado em outras pesquisas, mas serei

comunicado pelo pesquisador novamente e assinarei outro termo de consentimento livre e

esclarecido que explique para que será utilizado o material.

Natal, _____ de _______________de ______

Assinatura do participante da pesquisa

Declaração do pesquisador responsável

Como pesquisador responsável pelo estudo Caracterização fenotípica e molecular de

cepas de Enterococcus sp. resistentes à vancomicina (VRE) relacionadas a um surto na cidade

do Natal-RN, declaro que assumo a inteira responsabilidade de cumprir fielmente os procedimentos

metodologicamente e direitos que foram esclarecidos e assegurados ao participante desse estudo,

assim como manter sigilo e confidencialidade sobre a identidade do mesmo.

Declaro ainda estar ciente que na inobservância do compromisso ora assumido estarei

infringindo as normas e diretrizes propostas pela Resolução 466/12 do Conselho Nacional de Saúde

– CNS, que regulamenta as pesquisas envolvendo o ser humano.

Natal _____ de _______________de ______

Assinatura do pesquisador responsável

Impressão datiloscópica do

participante

Page 90: nterococcus sp CIDADE DO NATAL-RN · 2019-06-09 · Oliveira, Em ília Sousa de. Emerg ê ncia de enterococcus sp. resistentes à vancomicina na cidade do Natal - RN / Em ília Sousa

90

APÊNDICE B

Page 91: nterococcus sp CIDADE DO NATAL-RN · 2019-06-09 · Oliveira, Em ília Sousa de. Emerg ê ncia de enterococcus sp. resistentes à vancomicina na cidade do Natal - RN / Em ília Sousa

91

Page 92: nterococcus sp CIDADE DO NATAL-RN · 2019-06-09 · Oliveira, Em ília Sousa de. Emerg ê ncia de enterococcus sp. resistentes à vancomicina na cidade do Natal - RN / Em ília Sousa

92

ANEXO A

Page 93: nterococcus sp CIDADE DO NATAL-RN · 2019-06-09 · Oliveira, Em ília Sousa de. Emerg ê ncia de enterococcus sp. resistentes à vancomicina na cidade do Natal - RN / Em ília Sousa

93

Page 94: nterococcus sp CIDADE DO NATAL-RN · 2019-06-09 · Oliveira, Em ília Sousa de. Emerg ê ncia de enterococcus sp. resistentes à vancomicina na cidade do Natal - RN / Em ília Sousa

94

Page 95: nterococcus sp CIDADE DO NATAL-RN · 2019-06-09 · Oliveira, Em ília Sousa de. Emerg ê ncia de enterococcus sp. resistentes à vancomicina na cidade do Natal - RN / Em ília Sousa

95

Page 96: nterococcus sp CIDADE DO NATAL-RN · 2019-06-09 · Oliveira, Em ília Sousa de. Emerg ê ncia de enterococcus sp. resistentes à vancomicina na cidade do Natal - RN / Em ília Sousa

96

Page 97: nterococcus sp CIDADE DO NATAL-RN · 2019-06-09 · Oliveira, Em ília Sousa de. Emerg ê ncia de enterococcus sp. resistentes à vancomicina na cidade do Natal - RN / Em ília Sousa

97

Page 98: nterococcus sp CIDADE DO NATAL-RN · 2019-06-09 · Oliveira, Em ília Sousa de. Emerg ê ncia de enterococcus sp. resistentes à vancomicina na cidade do Natal - RN / Em ília Sousa

98

Page 99: nterococcus sp CIDADE DO NATAL-RN · 2019-06-09 · Oliveira, Em ília Sousa de. Emerg ê ncia de enterococcus sp. resistentes à vancomicina na cidade do Natal - RN / Em ília Sousa

99