UNIVERSIDADE FEDERAL DE PELOTAS

Programa de Pós-Graduação em Biotecnologia

Tese

Expressão heteróloga e utilização da proteína recombinante EMA-1 de Theileria equi como

imunobiológico

Leandro Quintana Nizoli

Pelotas, 2009

LEANDRO QUINTANA NIZOLI

Expressão heteróloga e utilização da proteína recombinante EMA-1 de Theileria equi como

imunobiológico

Orientador: Fábio Pereira Leivas Leite

Co-orientador: Fabricio Rochedo Conceição

Pelotas, 2009

Tese apresentada ao Programa de Pós-Graduação em Biotecnologia da Universidade Federal de Pelotas, como requisito parcial à obtenção do títulode Doutor em Ciências (área de conhecimento: Doenças Parasitárias).

Dados de catalogação na fonte: Ubirajara Buddin Cruz – CRB-10/901 Biblioteca de Ciência & Tecnologia - UFPel

N737e Nizoli, Leandro Quintana

Expressão heteróloga e utilização da proteína recombinante EMA-1 de Theileria equi como imunobiológico / Leandro Quintana Nizoli; orientador Fábio Pereira Leivas Leite ; co-orientador Fabricio Rochedo Conceição. – Pelotas, 2009. – 67f. : il. – Tese (Doutorado). Programa de Pós-Graduação em Biotecnologia. Centro de Biotecnologia. Universidade Federal de Pelotas. Pelotas, 2009.

1.Biotecnologia. 2.Theileria equi. 3.Imunobiológicos.

4.EMA-1. 5.Equinos. 6.Proteína recombinante. 7.Pichia pastoris. I.Leivas Leite, Fábio Pereira. II.Conceição, Fabrício Rochedo. III.Título

CDD: 636.1

Banca examinadora:

Profa. Dra. Tânia Regina Bettin dos Santos, Universidade Federal de Pelotas

Prof. Dr. Carlos Eduardo Wayne Nogueira, Universidade Federal de Pelotas

Prof. Dr. Renato Andreotti e Silva, EMBRAPA - CNPGC

Prof. Dr. Fábio Pereira Leivas Leite, Universidade Federal de Pelotas

AGRADECIMENTOS

A Deus pela luz que a cada dia me fortalece nos momentos difíceis e alegres

da jornada.

Aos professores e funcionários do Programa de Pós-graduação em

Biotecnologia que contribuíram em definitivo para meu crescimento pessoal e

acadêmico.

Ao Prof. Fábio Leite, pela orientação, compreensão, confiança e amizade

durante o decorrer do trabalho.

Ao professor Fabricio Conceição pelo apoio à pesquisa e orientação para a

realização desta tese.

Ao professor Sergio Silva pela grande amizade, conhecimentos transmitidos e

pelo estímulo à vida acadêmica.

A todos colegas e estagiários que foram parte da história que escrevemos

neste período,

Aos meus familiares e amigos por terem me apoiado e incentivado a seguir

com a realização deste projeto.

A CAPES pelo auxilio financeiro durante o doutorado.

A todos de que de uma forma ou outra tenha colaborado e apoiado a

realização deste trabalho.

Muito Obrigado!

RESUMO

NIZOLI, Leandro Quintana. Expressão heteróloga e utilização da proteína recombinante EMA-1 de Theileria equi como imunobiológico . 2009. 67f. Tese (Doutorado) – Programa de Pós-Graduação em Biotecnologia. Universidade Federal de Pelotas, Pelotas. A Theileriose eqüina é considerada uma das principais doenças parasitárias que acometem os eqüinos, acarretando grande impacto econômico na equinocultura. A doença é causada pelo hematozoário Theileria equi. As perdas econômicas associadas à theileriose eqüina estão relacionadas tanto aos fatores clínicos, quanto à restrição ao trânsito internacional de animais soropositivos, já que animais portadores crônicos são passíveis de reagudizações, gerando perda de performance física e reprodutiva, e são potencialmente disseminadores da enfermidade. Nos últimos anos, os estudos sobre o diagnóstico imunológico e vacinação contra T. equi concentram-se na obtenção de frações antigênicas. Na membrana externa deste protozoário foram caracterizadas proteínas principais de superfície denominadas de EMAs (equi merozoite antigen). Dentre estas, a EMA-1 destaca-se como antígeno para diagnóstico em função de sua conservação entre diversos isolados. Seu papel também tem sido caracterizado como imunógeno por estimular forte resposta humoral com produção de anticorpos em animais infectados, podendo ser usado como ferramenta para imunodiagnóstico dessa doença. EMA-1 é também um potencial candidato como antígeno vacinal no controle da theileriose equina. Neste estudo utilizou-se o sistema eucariótico de expressão baseado na levedura metilotrófica Pichia pastoris, para a produção da proteína EMA-1 de T. equi e a avaliação quanto a sua antigenicidade e imunogenicidade. Quanto a sua antigenicidade, a proteína recombinante foi reconhecida por anticorpos de animais portadores crônicos de T. equi, sugerindo que epítopos nativos foram conservados na proteína recombinante. Também foi observado que a proteína recombinante foi capaz de gerar resposta imune em camundongos vacinados com esta proteína. Os dados obtidos neste estudo demonstram que a levedura P. pastoris é um sistema de expressão heterólogo adequado para a produção da proteína EMA-1 de T. equi, podendo ser utilizada como imunobiológico no desenvolvimento de testes diagnósticos e vacina recombinante. Palavras-chave: Theileria equi, equinos, Pichia pastoris, EMA-1, proteína

recombinante.

ABSTRACT

NIZOLI, Leandro Quintana. Expressão heteróloga e utilização da proteína recombinante EMA-1 de Theileria equi como imunobiológico . 2009. 67f. Tese (Doutorado) – Programa de Pós-Graduação em Biotecnologia. Universidade Federal de Pelotas, Pelotas.

Equine theileriosis is considered to be one of the most important parasitic diseases that affect horses, and has great economic impact on the equine industry. The disease is caused by the etiologic agent Theileria equi, which is classified as a hematozoan. The losses associated with equine theileriosis are related to clinical manifestation as well as restriction to international travel to positive horses. Chronic infected equines suffer the risk of the disease relapse which leads to losses in reproduction performance and are potentially disseminators of the disease. In the last years, studies on the immunologic diagnosis and vaccination against T. equi have focused to obtain distinct antigenic proteins. On the outer membrane of this protozoan, major surface proteins has been characterized and named as EMAs (equi merozoite antigen). Of these, EMA-1 has been used as antigen for diagnosis due to its conservation in diverse isolates. Its role as a potential immunogen has been well documented due its ability to stimulate a humoral response with production of specific antibodies in infected animals. Through this antibodies one can used as tool for immune diagnostic of this disease. EMA-1 is also a strong candidate to be use as a vaccine in the control of equine theileriosis. In this study we used the Pichia pastoris yeast as expression system for the production of the EMA-1 protein of T. equi and evaluated its antigenicity and immunogenicity. When tested for antigenicity, the recombinant protein was recognized by antibodies form chronic T. equi infected horses, suggesting that epitopes of the native were conserved in the recombinant protein. Also we were able to observe that this protein was immunogenic in mice. The data obtained in this study demonstrated that the yeast P. pastoris is an expression system of heterologous protein suitable for the production of EMA-1 from T. equi.

Keywords: Theileria equi, equines, Pichia pastoris, EMA-1, recombinant protein.

SUMÁRIO

1 INTRODUÇÃO GERAL .................................. ................................................................................ 6

2 OBJETIVOS ......................................... ......................................................................................... 10

OBJETIVO GERAL ................................................................................................................................. 10 OBJETIVOS ESPECÍFICOS ..................................................................................................................... 10

3 ARTIGO 1

EQUINE THEILERIOSIS: EPIDEMIOLOGICAL ASPECTS, DIAGN OSTIC AND TREATMENT ....... 12

ABSTRACT ....................................................................................................................................... 13 INTRODUCTION ............................................................................................................................... 14 EPIDEMIOLOGICAL ASPECTS........................................................................................................ 15 DIAGNOSTIC TESTS ........................................................................................................................ 18 TREATMENT ..................................................................................................................................... 19 CONCLUSIONS ................................................................................................................................ 20 REFERENCES .................................................................................................................................. 21

4 ARTIGO 2

CLONING AND EXPRESSION OF MEROZOITE ANTIGEN 1 OF THEILERIA EQUI GENE IN THE METHYLOTROPHIC YEAST PICHIA PASTORIS ............................................................................... 30

ABSTRACT ....................................................................................................................................... 31 INTRODUCTION ............................................................................................................................... 32 MATERIALS AND METHODS ........................................................................................................... 33 RESULTS AND DISCUSSION .......................................................................................................... 38 CONCLUSION................................................................................................................................... 41 ACKNOWLEDGES ............................................................................................................................ 41 REFERENCES .................................................................................................................................. 41 FIGURES ........................................................................................................................................... 44

5 ARTIGO 3

IMUNOGENICIDADE E ANTIGENICIDADE DA PROTEÍNA RECOMB INANTE EMA-1 DE THEILERIA EQUI EXPRESSA EM PICHIA PASTORIS ...................................................................... 49

ABSTRACT ....................................................................................................................................... 49 RESUMO ........................................................................................................................................... 50 INTRODUCTION ............................................................................................................................... 50 MATERIALS AND METHODS ........................................................................................................... 51 RESULTS AND DISCUSSION .......................................................................................................... 53 ACKNOWLEDGEMENTS ................................................................................................................. 55 REFERENCES .................................................................................................................................. 55 FIGURES ........................................................................................................................................... 57

6 CONSIDERAÇÕES FINAIS .............................. ............................................................................ 58

7 CONCLUSÕES GERAIS ................................. ............................................................................. 60

8 REFERÊNCIAS ............................................................................................................................. 61

1 INTRODUÇÃO GERAL

A primeira descrição do parasito foi feita por Guglielmi em 1899 na África do

Sul, sendo posteriormente classificado e descrito como Babesia equi por Laveran

em 1901. No entanto, descobertas a respeito do ciclo de vida do parasito, como

multiplicação em linfócitos e ausência de transmissão transovariana nos carrapatos

vetores (SCHEIN et al., 1981; SCHEIN, 1988; UETI et al., 2008), indicam que T. equi

não é uma babésia clássica e, desde então, sua taxonomia tem sido questionada.

Considerando similaridades do parasito com organismos da família Theileriidae, a

reclassificação de Babesia equi como Theileria equi passou a ser aceita

(MEHLHORN & SCHEIN, 1998). Entretanto, estudos filogenéticos, utilizando RNA

ribossomal e proteínas de superfície de parasitos de ambas as famílias, indicam que

T. equi pode representar um terceiro grupo, diferente de Babesia ou Theileria

(ALLSOPP et al., 1994; KATZER et al., 1998; ZAHLER et al., 2000a; ZAHLER et al.,

2000b; CRIADO-FORNELIO et al., 2003a,b)

A theileriose equina é uma importante doença parasitária que acomete os

equinos de forma endêmica no território brasileiro, assim como, em diversos outros

países (KERBER at al., 1999; PFEIFER et al., 1995). Esta doença vem sendo

estudada à dezena de anos, principalmente em função do elevado número de

distúrbios que pode acarretar aos animais acometidos, bem como as enormes

perdas econômicas na equideocultura mundial (FRIEDHOFF et al., 1990;

KNOWLES, 1996). Nos Estados Unidos, Canadá, Austrália e Japão, assim como,

em alguns países da Europa e América Latina, onde o parasito não ocorre de forma

endêmica, são mantidas rigorosas medidas de controle que impedem a entrada de

animais soropositivos (OIE, 2008). Nestes países, apesar da doença ser

considerada exótica, o risco de tornar-se endêmica é constante devido à existência

dos carrapatos vetores, pertencentes aos gêneros Amblyomma, Dermacentor e

Rhipicephalus (KERBER et al., 1999; GUIMARÃES et al., 1998a,b; BATTSETSEG et

al., 2002; STILLER et al., 2002; UETI et al., 2008). Portanto, medidas de controle,

além dos testes sorológicos, muitas vezes incluem quarentena e controle de

7

carrapatos (MARTIN, 1999). Estes procedimentos, além de extremamente

dispendiosos, afetam negativamente o mercado internacional de eqüinos e a

participação em competições eqüestres internacionais.

O parasito encontra-se mundialmente distribuído em regiões tropicais e

subtropicais, sendo a prevalência da infecção diretamente relacionada com a

ocorrência dos carrapatos vetores. É estimado que 90% da população mundial de

eqüinos esteja exposta à T. equi, ainda que em alguns países a infecção não ocorra

de forma endêmica (FRIEDHOFF et al., 1990). No Brasil, estudos epidemiológicos

utilizando imunofluorescência indireta para detecção de anticorpos anti T. equi têm

registrado prevalências de 49,2% em São Paulo (HEUCHERT et al., 1999), 57,9%

no Rio Grande do Sul (CUNHA et al., 1996), 60,45% em Minas Gerais (RIBEIRO et

al., 1999) e 72% a 100% no Rio de Janeiro (TENTER & FRIEDHOFF, 1986;

PFEIFER et al., 1995).

Infecções por T. equi caracterizam-se pelo desenvolvimento de anemia

hemolítica progressiva nos animais infectados, sendo a patogenia da enfermidade

determinada principalmente pela lise de eritrócitos durante a invasão e multiplicação

do parasito (KNOWLES, Jr. et al., 1994; LORDING, 2008). Quando eqüinos

suscetíveis são infectados desenvolvem a fase aguda da doença, a qual cursa com

febre, anemia, hemorragias petequiais de mucosas, hemoglobinúria e icterícia

(ZOBBA et al., 2008). A gravidade da doença neste estágio depende da virulência

da cepa, dose do inóculo e condição imunológica do animal (CUNHA et al., 1998;

AMBAWAT et al., 1999). A mortalidade em infecções por T. equi é baixa, em geral

os animais recuperam-se da fase aguda da doença, porém permanecem como

portadores do parasito (UETI et al., 2005). Durante a fase crônica da infecção, sinais

clínicos inespecíficos como inapetência, perda de peso e queda no desempenho

físico e reprodutivo são comuns (SCHEIN, 1988). Em casos de imunossupressão a

reagudização da doença é favorecida e os animais podem apresentar diferentes

graus de anemia, com agravamento dos sinais clínicos (OLADOSU, 1988;

OLADOSU & OLUFEMI, 1992; CUNHA et al., 1997; NOGUEIRA et al., 2005).

Animais infectados por T. equi desenvolvem uma sólida imunidade que

protege contra a doença clínica no caso de re-exposições ao parasito (CUNHA et al.,

2006). Esta proteção tem sido atribuída à contínua estimulação do sistema imune

por parasitos que persistem no organismo durante a fase crônica da enfermidade

(SCHEIN, 1988). Experimentos conduzidos em diferentes modelos de infecções com

8

patógenos intraeritrocitários, que possuem uma patogenia semelhante à de T. equi,

propõe que através da produção de interferon gama (IFN-γ), linfócitos T CD4+ podem

ativar macrófagos e estimular a produção de anticorpos por linfócitos B, mecanismos

estes que atuariam na eliminação dos parasitos (IGARASHI et al., 1999; PALMER et

al., 1999; HELMBY & TROYE-BLOMBERG, 2000). Macrófagos ativados não

somente apresentam uma intensa capacidade fagocitária como produzem uma série

de intermediários reativos de oxigênio e nitrogênio que são tóxicos para parasitos

(SU & STEVENSON, 2000; SHODA et al., 2000). Anticorpos por sua vez também

atuam em mecanismos citotóxicos, como opsonização e fixação de complemento,

importantes no controle da multiplicação dos parasitos (AUCAN et al., 2000; CHEN

et al., 2000a; CHEN et al., 2000b; TAYLOR et al., 2001). A participação de anticorpos

na neutralização de merozoítos, impedindo diretamente a invasão de eritrócitos

também tem sido demonstrada (CAVINATO et al., 2001).

Eqüinos infectados com T. equi desenvolvem altos títulos de anticorpos contra

proteínas de superfície de merozoítos, o que sugere que os mesmos estão

envolvidos no controle da multiplicação e eliminação do parasito. Assim sendo, tanto

mecanismos celulares como aqueles dependentes de anticorpos parecem

desempenhar papéis fundamentais no controle de hematozoários (KNOWLES et al.,

1994; CUNHA et al. 2006). Em T. equi, a proteína equi merozoite antigen–1 (EMA-1)

é um antígeno de 34 kDa expresso na superfície do merozoíto, predominantemente

reconhecido por anticorpos de eqüinos infectados por T. equi (KNOWLES et al.,

1997). Comparações entre seqüências de aminoácidos da EMA-1, obtidas de

diferentes isolados de T. equi, têm revelado identidades superiores a 80%

(NICOLAIEWSKY et al., 2001; XUAN et al., 2001).

O desenvolvimento de vacinas representa um campo de grande interesse na

pesquisa envolvendo hemoparasitos de importância veterinária. Os principais

obstáculos nesta área são o desconhecimento a respeito da imunidade protetora

desenvolvida pelo hospedeiro e a grande variedade de mecanismos de evasão do

sistema imune utilizados pelos parasitos (JENKINS, 2001). Vários estudos têm sido

realizados buscando elucidar estes aspectos e um modelo de como o hospedeiro

mantém hemoparasitos sob controle e evita surtos clínicos em subseqüentes

exposições ao agente tem sido proposto (BROWN & PALMER, 1999; BROWN,

2001).

9

Estudos desenvolvimentos no campo da biologia molecular tornaram possível

expressar genes de antígenos de diferentes patógenos em sistemas heterólogos.

Pichia pastoris é uma levedura metilotrófica, capaz de utilizar o metanol como fonte

de carbono e energia que pode ser geneticamente modificada para expressar

proteínas heterólogas (CEREGHINO L.G.P. & CREGG, 1999; CEREGHINO L.J. &

CREGG, 2000). Durante os últimos anos, ela tem se tornado um importante sistema

de produção de uma variedade de proteínas heterólogas (NIZOLI et al., 2007;

DUMMER et al., 2007). A produção destas proteínas recombinantes possibilita

determinar os antígenos que representam os principais alvos da resposta imune dos

hospedeiros vertebrados. A partir da identificação destes antígenos, é possível

testar, por imunização ativa, o potencial imunoprotetor de cada uma destas

proteínas. Estes estudos tornam os antígenos protetores, ou seus epítopos mais

importantes, fortes candidatos para serem utilizados como constituintes de vacinas

recombinantes contra o respectivo patógeno.

Assim, os grandes desafios nas pesquisas envolvendo T. equi concentram-se

principalmente no desenvolvimento de vacinas e no diagnóstico do parasito,

especialmente na detecção de portadores assintomáticos.

2 OBJETIVOS

Objetivo Geral

Produzir a proteína EMA-1 de Theileria equi recombinante em Pichia pastoris.

Objetivos Específicos

- Clonar o gene EMA-1 em sistema Pichia pastoris;

- Expressar a proteína EMA-1 de Theileria equi em levedura Pichia pastoris;

- Avaliar a potencial antigênico e imunogênico da proteína EMA-1.

3 ARTIGO 1

EQUINE THEILERIOSIS: EPIDEMIOLOGICAL ASPECTS, DIAGN OSTIC AND

TREATMENT

Artigo científico formatado segundo as normas da re vista Journal of Equine

Veterinary Science

EQUINE THEILERIOSIS: EPIDEMIOLOGICAL ASPECTS, DIAGN OSTIC 1

AND TREATMENT 2

3

EQUINE THEILERIOSIS 4

5

Leandro Quintana Nizolia, Marcelo Mendes Götzea, Fabricio Rochedo Conceiçãoa, 6

Fábio Pereira Leivas Leiteab* 7

8

9

10

a Centro de Biotecnologia, b Instituto de Biologia Departamento de Microbiologia e 11

Parasitologia, Universidade Federal de Pelotas, Pelotas, RS, Brazil. 12

13

14

* Corresponding author: Phone: +55 53 3227-2770; fax: +55 53 3275-7555; E-mail address: 15

fabio_leite@ufpel.tche.br (F. P. L. Leite). Centro de Biotecnologia, Universidade Federal de 16

Pelotas, CP 354, CEP: 96010-900, Pelotas, RS, Brazil. 17

18

19

20

21

22

23

24

13

ABSTRACT 25

26

Equine theileriosis is a tick-borne protozoal disease of horses, mules, donkeys and zebras. The 27

etiological agent is blood parasite named Theileria equi. Infected animals may remain carriers 28

of these parasites for long periods and act as sources of infection for ticks, which act as 29

vectors. The parasites are found inside the erythrocytes of the infected animals. Animals 30

which are low-level carriers of T. equi parasite or ticks which may act as reservoirs pose a risk 31

of introduction of these parasites to diseases-free areas as a result of the increased movement 32

of horses worldwide. In this review, the biology, distribution, pathogenicity as well diagnosis 33

and treatment of equine theileriosis are discussed. 34

35

Key words: equine theileriosis, Theileria equi, diagnostic, treatment 36

37

38

39

40

41

42

43

44

45

14

INTRODUCTION 46

47

Equine theileriosis, caused by Theileria equi (formerly Babesia equi) (1), is considered 48

to be the most important tick-borne disease of horse in tropical and subtropical areas 49

including Central and South America, Africa, Asia and Southern Europe (2). At present, only 50

Australia, Canada, New Zealand, Japan, UK, and USA are considered equine piroplasmosis-51

free and have in place stringent regulatory important restrictions to prevent introduction of 52

these parasites (3). 53

T. equi are intraerythrocytic protozoa of equids that are transmitted by ixodid ticks (4). 54

Ticks belonging to the genera Hyalomma, Dermacentor, and Rhipicephalus transmit these 55

parasites (4-7). Recent work has shown the potential for transmission of T. equi by 56

Rhipicephalus (Boophilus) microplus (8-11). 57

T. equi is one of the small species of protozoa and has piroplasms in the erythrocytes 58

that appear oval, circle, ameboid, or as double pears, and measure 2 to 3 µm in length. 59

Theileria spp. has a schizogony period in the lymphoblastoid cells different from the genera 60

Babesia. (12-14). 61

Of the estimated world population of 58 million horses, 90% are bred in endemic areas 62

(2). In endemic countries, the control of equine piroplasmosis is important to keep 63

international markets open to the horse industry (15). For this reason many countries prohibit 64

the importation of horses because of the high prevalence of asymptomatic carrier animals in 65

the region. 66

Sub-clinical infections have particular relevance to the horse-racing industry where the 67

geographical movement of presumably healthy horses may aid in the spread of T. equi or 68

where sub-clinical infection may negatively affect the animal’s performance. It has also been 69

shown that strenuous exercise, such as that experienced with horse-racing, can cause sub-70

15

clinical infections to become acute (16,17). Thus there is a real need for the diagnosis of both 71

clinical and sub-clinical infections. In this review, the biology, distribution, pathogenicity as 72

well diagnostic and treatment of equine theileriosis are discussed. 73

74

EPIDEMIOLOGICAL ASPECTS 75

76

Thoroughbred racing industry is particularly strong affected by equine theileriosis, 77

acute infections resulting in missed training sessions and races and hence serious loss of 78

income to owners and trainers. Income is also lost to owners through abortion in stud mares 79

which are T. equi carriers (2,18). 80

Authors have demonstrated occurrences varying from 49.2% to 100% in the southern 81

and south-eastern states of Brazil. They cited different epidemiologic conditions but with high 82

tick infections (19-24). 83

The effects of the variation of prevalence has been observed with different categories 84

and breeding systems in different regions of Brazil (21,25). Previous studies have shown that 85

the prevalence of equine theileriosis in Brazil is serious (26-28). Transmission of theileriosis 86

is usually influenced by the dynamics of vector populations, and these are directly influenced 87

by climatic conditions (29). 88

Animals sensitive to the disease die within 24 to 48 hours after the development of 89

first clinical signs (30). In chronic cases, the disease continues for months and these animals 90

deteriorate to a worse condition within 3 to 4 years. The protozoa may not be seen 91

microscopically during the subclinical phase of the disease; therefore, serologic tests need to 92

be done to diagnose the disease (31-33). 93

Clinical signs of infection vary from asymptomatic to acute, fever, jaundice, anaemia, 94

icterus, and even death may occur (30). Intra-uterine infections with T. equi may result in 95

16

abortion and neonatal death (30,34). Horses that recover from acute infection may act as 96

reservoirs for transmission to ticks which subsequently infect other equids. Various authors 97

postulate that T. equi persists for life-long infection in its equine host (2,18,35,36). 98

In T. equi infection, clinical parasitaemia may exceed 20% but 1-5% parasitaemia is 99

more commonly observed in field conditions (37). In latent carrier equids, it is very difficult 100

to demonstrate the parasite in stained blood smears because the parasitaemia is extremely low. 101

Equids reared in endemic areas usually get infected at early age and become immune tolerant 102

throughout their life span. Nevertheless, outbreak of T. equi infection may occur in these 103

equids consequent to unfavorable health conditions (16). 104

Foals born of pre immune mares are naive at birth and acquire passive immunity 105

through colostrum (38). Maternal antibodies, against T. equi, decline steadily to extinction by 106

about four months from birth (38); however in endemic areas it is expected that primary 107

infection takes place before they decrease. It has been demonstrated that under these 108

conditions foals acquire the infection shortly after birth with the majority showing patent 109

parasitemia before 42 days of age (39). Regarding T. equi, transplacental transmission can 110

occurs and takes place during the first four months of gestation and appears to be a rule rather 111

than an exception, as recently demonstrated by a DNA probe (40). Recently was demonstrated 112

the presence of DNA of T. equi parasite in neonate foal’s blood born from a latently infected 113

mare, using specific DNA probe (41). They opined that parasite transmission occurred during 114

pregnancy despite the fact that latently infected mare was having normal placenta as the 115

foaling and foals were normal. Passage of infected erythrocytes or extra cellular parasitic 116

form across the placental barrier is the probable mode of transmission of T. equi and this may 117

occur as a result of damage to placental vessel in the event of abortion which could have lead 118

to mixing of maternal and foetal blood (42). 119

17

Kumar et al. (43) indicated that new-born foals were born naive and passively 120

transferred immunity is transitory which wanes after a period of time rendering the foals 121

susceptible to natural T. equi infection, after 63-77 days after foaling. This will help in 122

reducing the losses due to disease condition in new-born foals by following suitable 123

management practices at farm after waning of antibody titers. 124

Positive titers for T. equi from the first day of life on can be explained by maternal 125

antibodies, especially in those cases where the foals became negative thereafter. This occurred 126

between the first and fourth month. Maternal antibodies for T. equi have been demonstrated 127

before until about 4 months of age (in the CF test) in foals of field-infected mares (38). 128

Immunocompetent young horses infected with T. equi preferentially produce 129

antibodies to erythrocyte-stage antigens of 30 and 34 kDa during resolution of acute infection 130

(15,44). These antigens (equi merozoite antigens-1 and -2) are erythrocyte-stage which 131

possess a surface epitope that is conserved worldwide and induce specific high antibody 132

levels (15, 45, 46). Knowles Jr.(1991) had shown that a protein epitope shared by EMA-1 and 133

EMA-2 was immunodominant for antibody induction and shared by isolates worldwide (46). 134

To survive and replicate in the erythrocyte, members of the Apicomplexa phylum and 135

the intra-erythrocytic parasite Plasmodium falciparum export proteins that interacts with and 136

dramatically modify the properties of the host erythrocyte. As part of this process, P. 137

falciparum appears to establish a system within the erythrocyte cytosol that allows the correct 138

trafficking of parasite proteins to their final cellular destinations (47). 139

The pathways and components of these complex trafficking processes are fundamental 140

to the survival of P. falciparum in vivo, and are major determinants of this parasite’s unique 141

pathogenicity (47). Recently has been showed that the parasite T. equi EMA-2 in the infected 142

erythrocytic cytoplasm can be exported to the membrane and this can affect the parasite’s 143

erythrocytic binding behavior (48). 144

18

DIAGNOSTIC TESTS 145

146

Several direct and indirect detection methods, including blood smears (49), in-vitro 147

cultures (50,51), DNA probes (13) and serology (52), have been used to diagnose T. equi 148

infection. 149

Microscopic detection from blood smears has been used for the most standard 150

diagnosis of equine theileriosis (53); however, it has many limitations. The technique is 151

relatively laborious when large numbers of blood smear samples need to be simultaneously 152

quantified. While the identification of parasites in blood smears constitutes the definitive 153

diagnosis of equine infection, it bears certain limitations, particularly during apparent or 154

chronic infection due to low parasitemias (54). 155

Among the molecular tools, PCR is the most commonly used, including other PCR-156

derived tools, such as the multiplex and nested PCR (13,55). However, these molecular tools 157

require thermo cyclers and several other expensive operations, which make them unsuitable 158

for routine diagnosis, especially in resource-poor countries (56). 159

A primary PCR has been shown to detect T. equi infection in horses however, in all 160

cases the parasitemia level was sufficiently high for the organism to be detected by 161

microscopic examination (30). More recently, a nested PCR for T. equi based on the 162

merozoite antigen ema-1 gene sequence has been reported to give increased sensitivity (13). 163

A variety of serological tests such as indirect fluorescent antibody test (IFAT), 164

enzyme-linked immunosorbent assay (ELISA) and complement fixation test (CFT) have been 165

used to detect specific antibodies. Both the complement fixation test and the 166

immunofluorescent antibody test have been used for many years for diagnosis (57). 167

19

These methods have a low sensitivity for detecting latent infections. However, it has 168

been reported that because of its low sensitivity and specificity, the complement fixation test 169

fails to discriminate accurately between negative and carrier animals (19). 170

Compared with ELISA, however, IFAT is time consuming and requires large amounts 171

of parasites. Moreover, the estimation of the intensity of fluorescence is subjective and 172

requires the participation of experts, which has hindered the standardization and 173

comparability of the results (58). 174

Recently, the competitive ELISA (cELISA) using recombinant antigens was 175

developed as a more specific method than CFT, IFAT and other iELISA for the serodiagnosis 176

of piroplasmosis (32,47,59-64). Thus, several serological assays such as ELISAs are often 177

more sensitive and specific have been developed to advance diagnosis of equine 178

piroplasmosis. 179

A competitive inhibition ELISA, employing a monoclonal antibody and a recombinant 180

T. equi merozoite protein (EMA-1), was shown to be specie-specific for anti-T. equi 181

antibodies, as horses infected with B. caballi tested negative (46). It has been shown that an 182

ELISA using recombinant EMA-1 expressed in insect cells by baculovirus (65) and Pichia 183

pastoris (66) can be a useful diagnostic reagent for detection of T. equi infection in horses, 184

being more sensitive than CFT and IFAT. 185

186

TREATMENT 187

188

Treatment of piroplasmosis varies depending on the location of the horse and the goal 189

of treatment. In endemic regions, suppressing clinical signs without eliminating the organism 190

from the body is desirable because premonition depends on the continued presence of the 191

parasite at low levels (67). 192

20

The use of the dipropionate of imidocarb is recommended in solution 10%, 2.4.mg.kg1 193

four times, with break of 72 hours. However, the protocol of one dose of 1.2 mg.kg1 is 194

efficient to T. equi, not presenting difference of the treated animals with 2.4 mg.kg1, with the 195

advantages of reduce costs and diminish risks of effects to the horses (17). 196

Babesiacidal/theilericidal drugs used in the treatment of equine theileriosis are limited 197

and are either ineffective in completely eliminating the parasites and/or cause severe side 198

effects (68,69). Thus, a continuous search for alternative and effective chemotherapeutic 199

drugs is necessary. 200

The most reliable method to control equine piroplamosis remains preventing entry of 201

infected equine and ensuring that animals entering from endemic countries are thoroughly 202

checked and found to be free of ticks. 203

204

CONCLUSIONS 205

206

As a result, equine theileriosis is a very important equine disease. Serologic 207

examination is better than microscopic examination to determine the prevalence of the 208

disease. To combat the disease, the animal owners should be informed about the importance 209

of the disease and the danger of tick infestation. Considering the high prevalence of T. equi 210

infection in Brazil further studies are required to define the population of the infection. 211

Control strategies for horses used for recreational riding should based on reducing their 212

exposure to ticks by preventing them grazing areas with high tick infestation, preventing 213

contact with high tick infestation, preventing contact with wild horses, spraying horses with 214

acaricides and treating positive horses. In conclusion, the hardest challenges in the researches 215

involving T. equi concentrate mainly in the development of treatment protocols and in the 216

diagnosis of the parasite, especially in the detection of chronic cases of equine theileriosis. 217

21

REFERENCES 218

219

1. Mehlhorn H, Schein E. Redescription of Babesia equi Laveran, 1901 as Theileria equi. 220

Parasitol Res 1998;84:467-475. 221

2. Schein E. Equine babesiosis. In: Babesiosis of Domestic Animals and Man, Ristic M (Ed.), 222

CRC Press, Inc., Boca Raton, FL, 1988, pp. 197-208. 223

3. Friedhoff KT, Tenter AM, Muller I. Haemoparasites of equines: impact on international 224

trade of horses. Rev Sci Tech Off Int Epiz 1990;9:1187-1194. 225

4. Friedhoff KT. Transmission of babesia. In: Babesiosis of Domestic Animals and Man, 226

Ristic M. (Ed.), CRC Press, Boca Raton, FL, 1988. pp. 23-52. 227

5. Kumar S, Malhotra DV, Sangwan AK, Goel P, Kumar A , Kumar S. Infectivity rate and 228

transmission potential of Hyalomma anatolicum anatolicum ticks for Babesia equi 229

infection. Vet Parasitol 2007;144:338-343. 230

6. Battsetseg B, Lucero S, Xuan X, Claveria F, Byambaa B, Battur B, Boldbaatar D, Batsukh 231

Z, Khaliunaa T, Battsetseg G, Igarashi I, Nagasawa H, Fujisaki K. Detection of equine 232

Babesia spp. gene fragments in Dermacentor nuttalli Olenev 1929 infesting mongolian 233

horses, and their amplification in egg and larval progenies. J Vet Med Sci 2002;64:727-234

730. 235

7. Stiller D, Goff WL, Johnson LW, Knowles DP. Dermacentor variabilis and Boophilus 236

microplus (Acari: Ixodidae): experimental vectors of Babesia equi to equids. J Med 237

Entomol 2002;39:667-670. 238

8. Ueti MW, Palmer GH, Kappmeyer LS, Statdfield M, Scoles GA, Knowles DP. Ability of 239

the vector tick Boophilus microplus to acquire and transmit Babesia equi following feeding 240

on chronically infected horses with low-level parasitemia. J Clin Microbiol 2005;43:3755-241

3759. 242

22

9. Ueti MW, Palmer GH, Kappmeyer LS, Scoles GA, Knowles DP. Expression of equi 243

merozoite antigen 2 during development of Babesia equi in the midgut and salivary gland 244

of the vector tick Boophilus microplus. J Clin Microbiol 2003;41:5803-5809. 245

10. Battsetseg B, Lucero S, Xuan X, Claveria FG, Inoue N, Alhassan A, Kanno T, Igarashi I, 246

Nagasawa H, Mikami T, Fujisaki K. Detection of natural infection of Boophilus microplus 247

with Babesia equi and Babesia caballi in Brazilian horses using nested polymerase chain 248

reaction. Vet Parasitol 2002;107:351-357. 249

11. Guimarães AM, Lima JD, Ribeiro MFB. Sporogony and experimental transmission of 250

Babesia equi by Boophilus microplus. Parasitol Res 1998;84:323-327. 251

12. Inci A. Detection of Babesia caballi (Nuttall, 1910) and Babesia equi (Laveran, 1901) in 252

horses by microscopic examination in a military farm in Gemlik. Tr J Vet Anim Sci 253

1997;21:43-46. 254

13. Nicolaiewsky TB, Richte MF, Lunge VR, Cunha CW, Delagostin O, Ikuta N, Fonseca 255

AS, Silva SS, Ozaki LS. Detection of Babesia equi (Laveran, 1901) by nested polymerase 256

chain reaction. Vet. Parasitol 2001;101:9-21. 257

14. Kettle DS. Medical and veterinary entomology. 2nd ed. UK: CAB International, 1995. 258

15. Knowles DP. Control of Babesia equi parasitemia. Parasitol Today 1996;12:195-198. 259

16. Hailat NQ, Lafi SQ, Al-Darraji AM, Al-Ani FK. Equine babesiosis associated with 260

strenuous exercise: clinical and pathological studies in Jordan. Vet Parasitol 1997;69:1-8. 261

17. Ribas LM, Silva SS, Nogueira CEW, Nizoli LQ, Krause LE. Avaliação da eficácia 262

terapêutica do dipropionato de imidocarb no tratamento de eqüinos durante infecção aguda 263

por Babesia equi. A Hora Veterinária 2003;139:21-24. 264

18. Ueti MW, Palmer GH, Scoles GA, Kappmeyer LS, Knowles DP. Persistently infected 265

horses are reservoirs for intrastadial tick-borne transmission of the apicomplexan parasite 266

Babesia equi. Infect Immun 2008;76:3525-3529. 267

23

19. Tenter AM, Friedhoff KT. Serodiagnosis of experimental and natural Babesia equi and B. 268

caballi infections. Vet Parasitol 1986;20:49-61. 269

20. Cunha CW. Babesiose Eqüina: Padronização da Reação de Imunofluorescência Indireta 270

para sorodiagnóstico em eqüinos Puro Sangue Inglês. Pelotas-RS. 57p. Dissertação 271

(Mestrado) - Curso de Pós-Graduação em Veterinária, Universidade Federal de Pelotas, 272

1993. 273

21. Cunha CW, Silva SS, Pimentel CA, Dapper E. Avaliação da freqüência de eqüinos 274

soropositivos a Babesia equi no Jóquei Clube de Pelotas e em dois Haras da zona sul do 275

Rio Grande do Sul, RS. Rev Bras Paras Vet 1996;5:119-122. 276

22. Souza AP, Bellato V, Sartor AA, Silva AB. Prevalência de anticorpos anti-Babesia equi 277

em eqüinos no planalto catarinense. Ciência Rural 2000;30:119-121. 278

23. Xuan X, Nagai A, Battsetseg B, Fukumoto S, Makala LH, Inoue N, Igarashi I, Mikami T, 279

Fujisaki K. Diagnosis of equine piroplasmosis in Brazil by serodiagnostic methods with 280

recombinant antigens. J Vet Med S 2001;63:1159-1160. 281

24. Heim A, Passos LM, Ribeiro MF, Costa-Júnior LM, Bastos CV, Cabral DD, Hirzmann J, 282

Pfister K. Detection and molecular characterization of Babesia caballi and Theileria equi 283

isolates from endemic areas of Brazil. Parasitol Res 2007;102:63-68. 284

25. Botteon PT, Botteon RCCM, Linhares GFC, Massard CL, Loss ZG. Seroprevalencia de 285

Babesia equi en tres diferentes sistemas de crianza de equinos de Brasil. Parasitol 286

Latinoam 2002; 57:141-145. 287

26. Kerber CE, Ferreira F, Pereira MC. Control of equine piroplasmosis in Brazil. Onder J 288

Vet Res 1999;66:123-127. 289

27. Heuchert CMS, Giulli V, Athaide DF, Böse R, Friedhoff KT. Seroepidemiologic studies 290

on Babesia equi and Babesia caballi infections in Brazil. Vet Parasitol 1999;85:1-11. 291

24

28. Ribeiro MF, Costa JO, Guimarães AM. Epidemiological aspects of Babesia equi in horses 292

in Minas Gerais, Brazil. Vet Res Commun 1999;23:385-390. 293

29. Pfeifer BI, Bose R, Peymann B, Friedhoff KT. Epidemiological aspects of equine 294

babesioses in a herd of horses in Brazil. Vet Parasitol 1995;58:1-8. 295

30. Zobba R, Ardu M, Niccolini S, Chessa B, Manna L, Cocco R, Parpagliae MLP. Clinical 296

and laboratory findings in Equine Piroplasmosis. J Equine Vet Science 2008;28:301-308. 297

31. Bashiruddin JB, Camma C, Rebelo E. Molecular detection of Babesia equi and Babesia 298

caballi in horse blood by PCR amplification of parts of the 16S rRNA gene. Vet Parasitol 299

1999;84:75-83. 300

32. Ikadai H, Osorio CR, Xuan X, Igarashi I, Nagasawa H, Fujisaki K, Suzuki N, Mikami T. 301

Detection of Babesia caballi infection by enzyme-linked immunosorbent assay using 302

recombinant 48-kDa merozoite rhoptry protein. Int J Parasitol 2000;30: 633-635. 303

33. Shkap V, Cohen I, Leibovitz B, Savitsky I, Pipano E, Avni G, Shofer S, Giger U, 304

Kappmeyer L, Knowles D. Seroprevalence of Babesia equi among horses in Israel using 305

competitive inhibition ELISA and IFA assays. Vet Parasitol 1998;76:251-259. 306

34. Phipps LP, Otter A. Transplacental transmission of Theileria equi in two foals born and 307

reared in the United Kingdom. Vet Rec 2004;154:406-408. 308

35. Hourrigan JL, Knowles RC. Equine piroplamsosis (EP). Am Assoc Equine Pract 309

1979;1:119-128. 310

36. De Waal DT, Van Heerden J. Equine babesiosis. In: Infectious Diseases of Livestock with 311

Special Reference to South Africa, Coetzer J, Thomson GR, Tustin RC (Eds), Oxford 312

University Press, Cape Town, 1994, pp. 295-304. 313

37. Kumar S, Kumar R. Diagnosis of Babesia equi infection: an update on the methods 314

available. CAB Reviews: Perspectives in Agriculture, Veterinary Science, Nutrition and 315

Natural Resources 2007; 2:1-14. 316

25

38. Donnelly J, Phipps LP, Watkins KL. Evidence of maternal antibodies to Babesia equi and 317

Babesia caballi in foals of seropositive mares. Equine Vet J 1982;14:126-128. 318

39. Ribeiro MFB, Saito JF, Pimentel PV. Babesiose equina. Primo-infecção de potros em área 319

endêmica. Arq Bras Med Vet Zootec 1995;47:641-647. 320

40. Lewis B, Penzhorn B, Allsopp P. Transplacental transmission of Babesia (Theileria) equi 321

in horses: the rule rather than exception? Fifth Biennial Conference STVM, Proceedings, 322

Key West, p.113, 1999. 323

41. Allsopp MT, Lewis BD, Penzhorn BL. Molecular evidence for transplacental transmission 324

of Theileria equi from carrier mares to their apparently healthy foals. Vet Parasitol 325

2007;148:130-136. 326

42. Erbsloh JK. Babesiosis in the newborn foal. J Reprod Fertil Suppl. 1975;23:725-726. 327

43. Kumar S, Kumar R, Gupta AK, Dwivedi SK. Passive transfer of Theileria equi antibodies 328

to neonate foals of immune tolerant mares. Vet Parasitol 2008;151:80-85. 329

44. Knowles DP, Kappmeyer LS, Perryman LE. Specific immune responses are required to 330

control parasitemia in Babesia equi infection. Infect Immun 1994;62:1909-1913. 331

45. Kappmeyer LS, Perryman LE, Knowles DP. A Babesia equi gene encodes a surface 332

protein with homology to Theileria species. Mol Biochem Parasitol 1993;62:121-124. 333

46. Knowles DP, Perryman LE, Kappmeyer LS, Hennager SG. Detection of equine antibody 334

to Babesia equi merozoite protein by a monoclonal antibody based competitive inhibition 335

enzyme linked immunosorbent assay. J Clin Microbiol 1991;29:2056- 2058. 336

47. Cooke BM, Lingelbach K, Bannister LH, Tilley L. Protein trafficking in Plasmodium 337

falciparum-infected red blood cells. Trends Parasitol 2004;20:581-589. 338

339

340

26

48. Kumar S, Yokoyama N, Kim JY, Huang X, Inoue N, Xuan X, Igarashi I, Sugimoto C. 341

Expression of Babesia equi EMA-1 and EMA-2 during merozoite developmental stages in 342

erythrocyte and their interaction with erythrocytic membrane skeleton. Mol Biochem 343

Parasitol 2004;133:221-227. 344

49. Retief GB. A comparison of equine piroplasmosis in South Africa and the United States. J 345

Am Vet Med Assoc 1964;145:912-916. 346

50. Holman PJ, Becu T, Bakos E, Polledo G, Cruz D, Wagner GG. Babesia equi field isolates 347

cultured from horse blood using a microcentrifuge method. J Parasitol 1998;84:696-699 348

51. Alhassan A, Govind Y, Tam NT, Thekisoe OM, Yokoyama N, Inoue N, Igarashi I. 349

Comparative evaluation of the sensitivity of LAMP, PCR and in vitro culture methods for 350

the diagnosis of equine piroplasmosis. Parasitol Res 2007;100:1165-1168. 351

52. Huang X, Xuan X, Yokoyama N, Katayama Y, Anzai T, Igarashi I. Evaluation of 352

enzyme-linked immunosorbent assays with recombinant antigens for the serodiagnosis of 353

equine Babesia infections. Vet Parasitol 2006;140:158-161 354

53. Bose R, Jorgensen WK, Dalgliesh RJ, Friedhoff KT, De vos AJ. Current state and future 355

trends in the diagnosis of babesiosis. Vet Parasitol 1995;57:61-74. 356

54. Krause PJ, Speilman TA, Ryan R, Magera J, Rajan TV, Christianson D, Alberghini TV, 357

Bow L, Persing D. Comparison of PCR with blood smear and inoculation of small animals 358

for diagnosis of Babesia microti parasitemia. J Clin Microbiol 1996;34:2791-2794. 359

55. Alhassan A, Pumidonming W, Okamura M, Hirata H, Battsetseg B, Fujisaki K, 360

Yokoyama N, Igarashi I. Development of a single-round and multiplex PCR method for 361

the simultaneous detection of Babesia caballi and Babesia equi in horse blood. Vet 362

Parasitol 2005;129:43-49. 363

364

27

56. Alhassan A, Thekisoe OM, Yokoyama N, Inoue N, Motloang MY, Mbati PA, Yin H, 365

Katayama Y, Anzai T, Sugimoto C, Igarashi I. Development of loop-mediated isothermal 366

amplification (LAMP) method for diagnosis of equine piroplasmosis. Vet Parasitol 367

2007;143:155-160. 368

57. Bruning A. Equine piroplasmosis an update on diagnosis, treatment and prevention. Br 369

Vet J 1996;152:139-151. 370

58. Huang X, Xuan X, Yokoyama N, Katayama Y, Anzai T, Igarashi I. Evaluation of 371

enzyme-linked immunosorbent assays with recombinant antigens for the serodiagnosis of 372

equine Babesia infections. Vet Parasitol 2006;140:158-161. 373

59. Knowles DP, Kappmeyer LS, Stiller D, Hennager SG, Perryman LE. Antibody to a 374

recombinant merozoite protein epitope identifies horses infected with Babesia equi. J Clin 375

Microbiol 1992;30:3122-3126. 376

60. Knowles DP, Kappmeyer LS, Perryman LE. Genetic and biochemical analysis of 377

erythrocyte-stage surface antigens belonging to a family of highly conserved proteins of 378

Babesia equi and Theileria species. Mol Biochem Parasitol 1997;90:69-79. 379

61. Katz J, Dewald R, Nicholson J. Procedurally similar competitive immunoassay systems 380

for the serodiagnosis of Babesia equi, Babesia caballi, Trypanosoma equiperdum, and 381

Burkholderia mallei infection in horses. J Vet Diagn Invest 2000;12:46-50. 382

62. Rhalem A, Sahibi H, Lasri S, Johnson WC, Kappmeyer LS, Hamidouch A, Knowles DP, 383

Goff WL. Validation of a competitive enzyme-linked immunosorbent assay for diagnosing 384

Babesia equi infections of Moroccan origin and its use in determining the seroprevalence 385

of B. equi in Morocco. J Vet Diagn Invest 2001;13: 249-251. 386

387

388

28

63. Xuan X, Chahan B, Huang X, Yokoyama N, Makala LH, Igarashi I, Fujisaki K, 389

Maruyama S, Sakai T, Mikami T. Diagnosis of equine piroplasmosis in Xinjiang province 390

of China by the enzyme-linked immunosorbent assays using recombinant antigens. Vet 391

Parasitol 2002;108:179-182. 392

64. OIE, 2007. Manual of Diagnostic Tests and Vaccines for Terrestrial Animals, equine 393

piroplasmosis. Available at: http://www.oie.int/eng/normes/mmanual/A_00084.htm 394

(accessed January 2009). 395

65. Xuan X, Larsen A, Ikadai H, Tanaka T, Igarashi I, Nagasawa H, Fujisaki K, Toyoda Y, 396

Suzuki N, Mikami T. Expression of Babesia equi merozoite antigen 1 in insect cells by 397

recombinant baculovirus and evaluation of its diagnostic potential in an enzyme-linked 398

immunosorbent assay. J Clin Microbiol 2001;39:705-709. 399

66. Nizoli LQ, Conceição FR, Silva SS, Dummer LA, Santos Jr AG, Leite FPL. 400

Immunogenicity and antigenicity of the recombinant EMA-1 protein of Theileria equi 401

expressed in the yeast Pichia pastoris. Brazil J Vet Parasitol 2009;18:in press. 402

67. Sellon DC. Disorders of the hematopoietic system. In: Equine internal medicine, Reed M, 403

Bayly WM, Sellon DC (eds), Philadelphia, Elsevier, 2004, 735p. 404

68. Kuttler KL, Zaugg JL, Gipson CA. Imidocarb and parvaquone in the treatment of 405

piroplasmosis (Babesia equi) in equids. Am J Vet Res 1987;48:1613-1616. 406

69. Zaugg JL, Lane VM. Efficacy of buparvaquone as a therapeutic and clearing agent of 407

Babesia equi of European origin in horses. Am J Vet Res 1992;53:1396-1399. 408

409

4 ARTIGO 2

CLONING AND EXPRESSION OF MEROZOITE ANTIGEN 1 OF Theileria equi

GENE IN THE METHYLOTROPHIC YEAST Pichia pastoris

Artigo científico formatado de acordo com as normas da revista Protein

Expression and Purification

CLONING AND EXPRESSION OF MEROZOITE ANTIGEN 1 OF Theileria equi

GENE IN THE METHYLOTROPHIC YEAST Pichia pastoris

Leandro Quintana Nizolia, Luana Alves Dummera, Fabricio Rochedo Conceiçãoa, Carlos Gil

Turnesa, Fábio Pereira Leivas Leitea,b

a Centro de Biotecnologia, b Departamento de Microbiologia e Parasitologia, Instituto de

Biologia, c Laboratório de Doenças Parasitárias, Faculdade de Veterinária, Universidade

Federal de Pelotas (UFPel), Pelotas, RS, Brazil;

* Corresponding author: Phone: +55 53 3227-2770; fax: +55 53 3275-7353. E-mail address:

fabio_leite@ufpel.tche.br (F. P. L. Leite). Universidade Federal de Pelotas, CP 354, CEP,

96010-900, Pelotas, RS, Brazil.

31

ABSTRACT

The equine piroplasmosis caused by Theileria equi is a tick-borne protozoal infection of

horses, causing damage to animal health and economic losses. In T. equi, two merozoite

surface proteins, equi merozoite antigen EMA-1 and EMA-2, have been identified as the most

immunodominant antigens, suggesting that they might be used as immunobiological tools.

This study focused on expression and purification of truncated recombinant EMA-1 of T. equi

in P. pastoris. The DNA encoding EMA-1 was cloned by PCR from strain Pelotas of T. equi.

After PCR and construction of expression vector, EMA-1 was expressed in P. pastoris yeast

X-33 and secreted into the culture medium. The secreted EMA-1 was purified using

ammonium sulfate at 80%. The recombinant protein was imunogenic and antigenic. This

study provides a new alternative for expression and utilization of recombinant protein EMA-

1.

Key Words: Theileria equi; Recombinant vaccine; Pichia pastoris; EMA-1

Running headline: Truncated EMA-1 expressed in yeast Pichia pastoris

32

INTRODUCTION

The equine piroplasmosis caused by Theileria equi is a tick-borne protozoal infection

of horses, it causes great damage to animal health and important economical losses. The

disease is a haemoparasitosis caused by Theileria equi and Babesia caballi, is a tick-borne

hemoprotozoan disease affecting horses worldwide [1]. Through infecting and destroying

erythrocytes, it can compromise the equine function, leading to loss of vitality and decrease in

the performance of infected animals. Equine piroplasmosis caused by T. equi is more

pathogenic and widespread in horses than that by B. caballi [2], it causes a persistent infection

for which drug therapy or vaccination are not available [1,3]. The T. equi infection is

characterized by fever, anemia, icterus, and hepato and splenomegaly [4].

Merozoite surface proteins are important in the pathogenesis of hemoprotozoan

diseases because of their role in parasite recognition, attachment to and penetration of host

erythrocytes [5,6]. In T. equi, two kinds of merozoite surface proteins, equi merozoite antigen

EMA-1 and EMA-2, have been identified as the most immunodominant antigens [7,8,9].

EMA-1 is geographically conserved among all T. equi isolates [8,10] and shares significantly

high identity in amino acid sequence with the counterpart proteins of many Theileria parasites

[7,11]. Additionally, EMA-1 has glycosyl-phosphatidylinositol (GPI) anchor-specific motifs

in their sequence, suggesting that these proteins might be expressed on the outer surface of

merozoite with a GPI anchor [11]. The T. equi merozoite express surface protein of molecular

mass 34 kDa, which are strongly recognized by antibodies produced in infected animals

[11,12]. Further, EMA-1/2 are members of the major piroplasm surface protein (MPSP)

family that is conserved among the genus Theileria, but the biological role of MPSP has not

yet been clarified. Therefore, functional studies on EMA family proteins may also provide

33

insight into the biological significance of MPSP expression in the intra-erythrocytic

development of Theileria parasites.

The methylotrophic yeast Pichia pastoris is one of the dominant expression systems in

molecular biology due to its stable and high-level expression of heterologous proteins [13,14].

Over 400 proteins from prokaryotes, eukaryotes, and viruses have now been successfully

expressed in this yeast [15]. The P. pastoris expression system offers many advantages,

including its ease of usage relative to other eukaryotic expression systems, the possibility of

high-level expression of foreign proteins. The yeast is also able to introduce eukaryotic post-

translational modifications such as glycosylation and proteolytic processing [16].

In this study, we report the successful cloning of the truncated DNA sequence of T.

equi gene. Its expression in P. pastoris and characterization of the recombinant protein were

also investigated. This is the first report of the cloning and expression of EMA-1 of T. equi in

P. pastoris system.

MATERIALS AND METHODS

Strains, plasmids and yeast culture media

Escherichia coli TOP10 cells were used as a host for plasmid propagation. For yeast

transformation, the P. pastoris transfer plasmid pPICZαB containing the 5’ alcohol oxidase 1

(AOX1) promoter and the 3’ AOX1 transcription termination sequences was used. pPICZαB

also contains the dominant selectable marker antibiotic zeocin, which is bifunctional in both

Pichia and E. coli. Pichia pastoris host strain X-33 was used for protein expression

experiments. These products were purchased from Invitrogen (Carlsbad, CA).

Pichia pastoris cells were cultured in YPD medium (1% yeast extract, 2% peptone,

and 2% D-glucose) or BMGY medium (1% yeast extract, 2% peptone, 1.34% yeast nitrogen

34

base, 4x10-5% biotin, 1% glycerol and 100 mM potassium phosphate [pH 6.0]). YPDS plates

(YPD medium plus 1 M sorbitol and 2% agar (w/v)) containing 100 µg/ml zeocin (Invitrogen,

San Diego, CA) were used for selection of Pichia transformants. BMMY medium (1% yeast

extract, 2% peptone, 1.34% yeast nitrogen base, 4x10-5% biotin, 0.5% methanol, and 100 mM

potassium phosphate [pH 6.0]) was used for protein induction.

DNA extraction and PCR amplification

The EMA-1 gene (GenBank accession no AF261824) without the native signal

peptide sequence was amplified by PCR using DNA obtained as previously described [17].

Amplification reaction was performed in a thermocycler (Mastercycle Eppendorf). The PCR

was subjected to amplification in a 25 µl mixture containing ~20 ng of genomic DNA, 0.2 µl

Taq DNA polymerase (5U/µL), 2.5 µl 10x PCR buffer, 1.0 µL 50 mM MgCl2, 0.5 µl 10 mM

dNTP, 1.0 µl 10 pmol/µL primer 1 and primer 2 (Table 1) and ddH2O, under the following

conditions: 94 °C for 5 min (1 cycle); 94 °C for 60 sec, 54 °C for 60 sec, 72 °C for 1 min (40

cycles); and 72 °C for 7 min (1 cycle). All primers used in this study were synthesized in

MWG-Biotech AG (USA).

Construction of expression plasmid pPICZalpbaB-EMA1

The amplified PCR products after purification and cleavage with EcoRI and KpnI were

cloned into expression vector pPICZαB digested by the same restriction enzymes and the

resultant plasmid was transformed to TOP10F competent cells. The transformants were

cultured in LB plate (1% tryptone, 0.5% yeast extract, 0.5% NaCl, and 2% agar) with zeocin

(25 µg/ml), for screening the positive clones. The recombinant plasmids with EMA-1

truncated gene were identified with ultra-rapid microprep plasmid extraction [18], proper

insert orientation was tested by restriction endonuclease cleavage, and confirmed by

35

sequencing with the DYEnamic ET terminators sequencing kit (GE Healthcare, Giles, United

Kingdom) following the manufacturer’s protocol. Sequence determination was performed in a

MegaBACE 500 automatic sequencer (GE Healthcare). Sequencing reactions were performed

using primers 5’AOX1 and 3’AOX1 vector-specific and primers used for PCR amplification

(Table 1). Sequence analyses were assembled using Vector NTI 10, AlignX and

ContigExpress (Invitrogen). Homologies analyses were performed with the NCBI database

and BLAST [19].

Transformation and screening of P. pastoris expression strains

The plasmid pPICZαB-EMA1 was linearized by digestion with restriction enzyme

PmeI for integration into the chromosomal DNA of Pichia pastoris X-33. Transformation of

the linearized plasmid was carried out as described in the Invitrogen Pichia Expression kit

manual. Approximately 250 colonies were obtained on the YPDS plates containing 100 µg/ml

Zeocin after growing for 3 days.

For confirm integration of the EMA-1 gene into the yeast genome, the colonies were

subsequently screened by colony blotting. The colony blotting assay was performed as

previously described [20], with some modifications. Briefly, a hundred Zeocin recombinant

colonies were plated onto BMMY agar medium (1% yeast extract, 2 % peptone, 1.34% yeast

nitrogen base, 4x10-5% biotin, 0,5% methanol, 100 mM potassium phosphate [pH 6.0] and

1% agar) and incubated at 28°C for 3 days. Every 24 h, 1% of total medium volume of

absolute methanol was added on the top of plates. Pre-cut nitrocellulose membrane (Hybond

C, Amersham Biosciences) was then left standing for 3 h at 28°C on the surface colonies.

Membrane was then washed with PBS (pH 7.4) plus 0.05% Tween-20 (PBS-T) prior to

remove adhering colonies fragments. Membrane was blocked for 1 hour at room temperature

with gentle agitation in PBS-T buffer containing 5% of non-fat milk. After, the membrane

36

was incubated for 1 hour with monoclonal antibody (MAb) anti-His peroxidase conjugate.

The reaction was developed with diaminobenzidine (Sigma).

Expression of rEMA-1 on shaker and bioreactor cultures

The selected positive clones were used to inoculate 5 ml BMGY medium and

incubated overnight at 30° C with shaking at 250 rpm. A 0.3 ml aliquot of the culture was

used to determine cell density and viability. The remainder was harvested by centrifugation at

5,000 x g for 5 min. To induce protein expression, the cells were resuspended in BMMY. A

total of 10 ml cell suspension in BMMY was incubated at 30 °C with shaking at 250 rpm for

7 days. The cultures were supplemented with 100% methanol to a final concentration of 1%,

and this step was repeated every 24h. After methanol induction for various periods of time,

aliquots were withdrawn for cell viability assay and expression analysis. Recombinant EMA-

1 was detected by Dot-Blotting procedure using MAb Anti-6xHIS HRP conjugated. One

transformant with high expression level in the culture supernatant was used for large-scale

expression. The transformed strain with the highest activity screened in the shake flask

expression was cultivated in bioreactor (Biostat B, B. Braun Biotech). For large-scale

expression, recombinant X-33 was pre-inoculated in YPD medium for 24h at 28°C in

agitation of 250 rpm and then cells were placed in reactor containing BMGY medium.

Temperature was controlled at 30ºC and agitation was set at 300 rpm and aeration rate of 1

vvm. After complete consumption of glycerol in the medium, 1.0% of methanol was added

every 24 h to induce expression during 4 days. Recombinant EMA-1 expression was detected

by Dot-Blotting as mentioned before. After that, cells were harvested in 5,000 x g at 4ºC for

10 min and supernatant stored at 4°C until purification.

37

Precipitation of protein

For precipitation, the culture (1 L) was first centrifuged at 5,000 x g for 30 min at 4°C,

and the resultant supernatant containing the secreted EMA-1 was pooled and mixed with

ammonium sulfate to a saturation of 80% and incubation at 4°C for 16 hours. The mixture

was centrifuged at 12,000 x g for 30 min, and the resultant pellet was resuspended in PBS (pH

7.0), followed by overnight dialysis against the same buffer at 4° C using a membrane of 30

kDa cut-off. After dialysis, the samples were centrifuged to remove any insoluble materials;

the resultant supernatant was pooled and stored at -20°C. The protein quantitation was

determined using the BCATM Protein Assay Kit (Pierce Chemical Company) with bovine

serum albumin (BSA) as a standard.

SDS-PAGE and Dot-Blotting

Purified proteins were boiled for 10 min in SDS-PAGE loading buffer and separated

on 10% separating gel and then submitted to electrophoresis in Bio-Rad Mini-PROTEAN

Tetra Electrophoresis System. Gel was stained with Coomassie Brilliant Blue R250. For Dot-

Blotting analysis was performed as described elsewhere [21], with some modifications.

Supernatant of yeast X-33/pPICZαB was used as negative control. Proteins adsorption was

carried out by spotting 5 µl in nitrocellulose membrane pieces (2.0 x 1.0 cm). After blocking

and washed, membranes were probed also as described and detected with DAB solution.

Reactions were stopped with distilled water washes. Membrane was blocked with 5% non-fat

dry milk in PBS-T pH 7.4 for 1h and after several washes with PBS-T, antigenic proteins

spots were detected by incubating membrane with the following sera: MAb Anti-6xHIS HRP

conjugated (SIGMA); anti-EMA-1 monoclonal antibody (Babesia equi Antibody. Test Kit,

cELISA, VMRD. Inc, Pullman); sera of horse naturally infected with T. equi or sera of

negative horse, also for 1 h and then washed with PBS-T. Membranes were incubated for 1 h

38

with anti-mouse (1:2.000) and anti-horse (1:10.000) immunoglobulins HRP conjugated. After

that, membranes were washed again and then placed in DAB solution (0,6 mg

Diaminobenzidine, 0,03% nickel sulfate, 50 mM Tris-HCl [pH 8.0], and hydrogen peroxide

[30 vol]) until colored reaction began to appear, and then stopped with distilled water washes.

RESULTS AND DISCUSSION

Construction of expression vector and P. pastoris transformation

The P. pastoris gene expression system is an attractive method with which to produce

a variety of intercellular and extracellular proteins [13]. Since, we previously isolated a DNA

encoding this protein, we decided to clone the DNA sequence encoding EMA-1 without its

native signal peptide in the pPICZαB plasmid, in frame with the yeast a-factor signal

sequence, for secretion of protein containing a 6His-Tag at its C-terminus. PCR amplification

of the EMA-1 gene yielded a 755 bp DNA (Fig. 2A) fragment with the expected sequence.

The amplified EMA-1 gene was inserted into the vector pPICZαB. The positive insert in the

recombinant plasmids was screened by restriction endonuclease cleavage with XhoI and three

expected fragments were showed (Fig. 2B). Then, constructed expression vector

pPICZαB/EMA-1 (Fig. 1) was used for E. coli strain TOP10F transformation, which result in

several colonies Zeocin resistant. About 50 colonies were picked for an ultra-rapid procedure

screening [18] which shown 11 recombinants. One of these was replicated and then

sequenced. Sequencing analysis showed that the EMA-1 gene from T. equi was sequenced.

The lengths of the sequenced regions varied from nucleotide 121 to 735. A consistent

alignment provided by 615 nucleotides in EMA-1 gene revealed high degrees of identity with

others sequences EMA-1. The sequence was submitted at GenBank (accession no FJ628171)

(data not show).

39

After the recombinant vector was constructed and verified experimentally to be

correct, it was transformed into P. pastoris strain X-33 competent cells by electroporation,

and approximately 250 colonies were obtained on the YPDS plates after growing for 3 days.

These colonies were picked up and spotted on 100 µg/ml Zeocin YPD plates.

Expression of EMA-1 on shaker and bioreactor cultures

The screening was performed by colony blotting assay which cells growing on

BMMY plates are induced with methanol and the secreted proteins can be detected with MAb

Anti-6xHIS HRP conjugated (Fig. 3). No transformed X-33 was used with a negative control

and recombinant B subunit of heat labile enterotoxin from E. coli (LTB) with HIS-tag was

used as positive control added on nitrocellulose membrane after induction. From one hundred

colonies chosen for Colony blotting assay, three shown positive recombinant protein

expression in different levels and one of these positive colony with apparently higher

expression level was chosen for shaker flasks and bioreactor growth.

Recombinant P. pastoris that expressed EMA-1 of T. equi on higher level chose by

Colony blotting assay was used for small scale expression on shaker in order to verify the best

expression time after induction. Secreted protein was detected by Dot-Blotting assay and best

results were obtained with 96 h of induction (Fig. 4). As negative control, no transformed P.

pastoris X-33 was also growth in BMGY and induced with 1% of methanol on BMMY

medium. In bioreactor, fed-batch process continued for a period of 4 days was performed.

After 24 h of glycerol growth, when this was exhausted, cells were induced with 1%

methanol. Protein secretion was detected with Dot-blotting, as described above.

40

Precipitation and characterization of protein rEMA-1

In the precipitation of recombinant EMA-1 expressed in P. pastoris X-33 cells,

ammonium sulfate precipitation was carried out to concentrate the protein, while the best

EMA-1 precipitation yield was reached at 80% ammonium sulfate saturation level. SDS-

PAGE analysis the culture supernatant of recombinant strain revealed that the EMA-1

secreted into supernatant compared to no-transformant and indicated a major protein band at a

molecular mass of ~45 kD, which is consistent with the molecular mass of EMA-1 (Fig. 5).

The final yield of the purified protein was quantified by BCA Proteins Assay and resulted in a

yield of ~389 mg of rEMA-1 per liter of cell culture supernatant.

Dot blot is a technique for detecting and identifying proteins, similar to the Western

blot technique but differing in that protein samples are not separated electrophoretically but

are spotted through circular templates directly onto the membrane [21]. Antigens may be

applied directly to nitrocellulose membrane as a discrete spot (dot) to give a simple and

reliable assay [22]. Purified EMA-1 was utilized to evaluate antigenic responses. Dot blot

analysis showed a positive reaction of the supernatant of recombinant strain using anti-

histidine monoclonal antibody, monoclonal antibody anti-EMA-1, and serum of equine

positive carrier of T. equi, and did not show reactivity with serum of negative animal. No

reactivity was observed with control negative protein. The immunogenicity of rEMA-1

protein was demonstrated by IFAT using sera from recombinant protein immunized mice

using aluminum hydroxide as adjuvant. All animals vaccinated with rEMA-1 developed a

high specific antibody response (data no showed) [23].

The P. pastoris expression system has been used for the production of a wide variety

of proteins [16]. However, to the best of our knowledge this is the first report on the cloning

and expression of EMA-1 protein in P. pastoris.

41

CONCLUSION

In conclusion, the production and purification of rEMA-1 in the methylotrophic yeast

P. pastoris was effective, permitting a high-yield production of this protein. Thus, in this

work we were able to clone in a secretory expression plasmid and purified EMA-1 protein in

P. pastoris. Further studies will focus in apply these recombinant antigen for use in

immunodiagnosis assays, and possible as a candidate as vaccine antigen for theleiriosis.

ACKNOWLEDGES

The author Leandro Nizoli was supported by the CAPES Foundation through the

Brazilian government.

REFERENCES

[1] E. Schein, Equine babesiosis, in M. Ristic (ed.) Babesiosis of Domestic Animals and Man,

CRC Press, Boca Raton, FL, 1988, pp. 197-208.

[2] D.T. De Waal, Equine piroplasmosis: a review, Br. Vet. J. 148 (1992) 6-14.

[3] K.T. Friedhoff, Interaction between parasite and tick vector, Int. J. Parasitol. 20 (1990)

525-535.

[4] Office International Des Epizooties, Manual of recommended diagnostic techniques and

requirements for biological products for lists A and B diseases, I, 1989, pp. 1-6.

[5] R.M. Jack, P.A. Ward, Mechanisms of entry of Plasmodium and Babesia into red cells, in:

M. Ristic, J.P. Kreier (eds.) Babesiosis, Academic Press, Inc. New York, 1981, pp. 445-458.

42

[6] S. Kumar, N. Yokoyama, J.Y. Kim, X. Huang, N. Inoue, X. Xuan, I. Igarashi, C.

Sugimoto, Expression of Babesia equi EMA-1 and EMA-2 during merozoite developmental

stages in erythrocyte and their interaction with erythrocytic membrane skeleton, Mol.

Biochem. Parasitol. 133 (2004) 221-227.

[7] L.S. Kappmeyer, L.E. Perryman, D.P. Knowles, A Babesia equi gene encodes a surface

protein with homology to Theileria species, Mol. Biochem. Parasitol. 62 (1993) 121-124.

[8] D.P. Knowles, L.E. Perryman, W.L. Goff, C.D. Miller, R.D. Harrington, J.R. Gorham, A

monoclonal antibody defines a geographically conserved surface protein epitope of Babesia

equi merozoites, Infect. Immun. 59 (1991) 2412-2417.

[9] D.P. Knowles, L. S. Kappmeyer, D. Stiller, S.G. Hennager, L.E. Perryman, Antibody to a

recombinant merozoite protein epitope identifies horses infected with Babesia equi, J. Clin.

Microbiol. 30 (1992) 3122-3126.

[10] C.W. Cunha, L.S. Kappmeyer, T.C. McGuire, O.A. Dellagostin, D.P. Knowles,

Conformational dependence and conservation of an immunodominant epitope within the

Babesia equi erythrocyte-stage surface protein equi merozoite antigen 1, Clin. Diagn. Lab.

Immunol. 9 (2002) 1301-1306.

[11] D.P. Knowles, L.S. Kappmeyer, L.E. Perryman, Genetic and biochemical analysis of

erythrocyte-stage surface antigens belonging to a family of highly conserved proteins of

Babesia equi and Theileria species, Mol. Biochem. Parasitol. 90 (1997) 69-79.

[12] C.W. Cunha, T.C. McGuire, L.S. Kappmeyer, S.A. Hines, A.M. Lopez, O.A.

Dellagostin, D.P. Knowles, Development of specific immunoglobulin Ga (IgGa) and IgGb

antibodies correlates with control of parasitemia in Babesia equi infection, Clin. Vaccine

Immunol. 13 (2006) 297-300.

[13] J.M. Cregg, T.S. Vedvick, V. Raschke, Recent advances in the expression of foreign

genes in Pichia pastoris, Biotech. 11 (1993) 905-910.

43

[14] M. Romanos, C. Scorner, K. Sreekrshna, J. Clare, The generation of microscopy

recombinant strains, Meth. Mol. Biol. 103 (1998) 55-72.

[15] G.P.L. Cereghino, J.L. Cereghino, C. Ilgen, J.M. Cregg, Production of recombinant

proteins in fermenter cultures of the yeast Pichia pastoris, Current Op. Biotech. 13 (2002)

329-332.

[16] J.L. Cereghino, J.M. Cregg, Heterologous protein expression in the methylotrophic yeast

Pichia pastoris, FEMS Microbiol. Rev. 24 (2000) 45-66.

[17] T.B. Nicolaiewsky, M.F. Richter, V.R. Lunge, C.W. Cunha, O. Delagostin, N. Ikuta,

A.S. Fonseca, S.S. Silva, L.S. Ozaki, Detection of Babesia equi (Laveran, 1901) by nested

polymerase chain reaction, Vet. Parasitol. 101 (2001) 9-21.

[18] S.D. Jouglard, M.A. Medeiros, E.K. Vaz, R.G. Bastos, C.W. Cunha, G.R.G. Armoa,

O.A. Dellagostin, An ultra-rapid and inexpensive plasmid preparation method for screening

recombinant colonies, Abstr. Gen. Meet. Am. Soc. Microbiol. H71 (2006) 234.

[19] S.F. Altschul, T.L. Madden, A.A. Schaffer, J. Zhang, Z. Zhang, W. Miller, D.J. Lipman,

Gapped BLAST and PSI-BLAST: a new generation of protein database search programs,

Nucleic Acids Res. 25 (1997) 3389-3402.

[20] M.C. Goodnough, B. Hammer, H. Sugiyama, E.A. Johnson, Colony immunoblot assay of

botulinal toxin, Appl. Environ. Microbiol. 59 (1993) 2339-2342.

[21] D.I. Stott, Immunoblotting and dot blotting, J. Imun. Met. 119 (1989) 153-187.

[22] R.R. Pinheiro, C.D.C. Olortegui, A.M.G. Gouveia, S.C. Araujo, A. Andrioli, The

development of dot-blot for the detection of antibodies to Caprine Arthritis Encephalitis virus

in goat, RPCV 101 (2006) 51-56.

[23] L.Q. Nizoli, F.R. Conceição, L.A. Dummer, A.G. Santos Jr, FPL Leite. Immunogenicity

and antigenicity of the recombinant EMA-1 protein of Theileria equi expressed in the yeast

Pichia pastoris. Brazil. J. Vet. Parasitol. 18 (2009) in press.

44

FIGURES

Tabela 1. PCR primers used in this study.

Primer DNA sequence (5′ to 3′) restriction enzyme

Primer 1

Primer 2

CGGAATTCACAAAATGGAGGAGGAGAAACCCAAG

GGGGTACCAATAGAGTAGAAAATGCAATG

EcoRI

KpnI

5’ AOX1

3’AOX1

GACTGGTTCCAATTGACAAGC

GGATGTCAGAATGCCATTTGC

Figure 1. Map of the pPICZαB/EMA-1 expression vector.

45

Figure 2. Analysis of amplified EMA-1 gene and recombinant of pPICZαB/EMA-1. (A) PCR

amplification of EMA-1 gene. Lane-M: DNA marker, (1) control (2) EMA-1 gene. (B)

Restriction analysis of recombinants pPICZαB/EMA-1. Lane-M: DNA marker, (1) pPICZαB

(2) restriction recombinants.

Figure 3. Colony blotting analysis of transformed P. pastoris strain X-33 with MAb Anti-

6xHIS HRP conjugated. Membranes A and B: Arrows indicate positive colonies expressing

EMA-1; selected recombinant colony for scale up expression test are indicated with an

asterisk; C+ positive control.

46

Figure 4. Time-course of rEMA-1 secretion in shake-flask cultures of Pichia pastoris positive

clone. Dot Blotting of supernatant collected after each 24 h of induction with 1% methanol.

Figura 5. The 10% SDS-PAGE. Lane-M: marker; Lane 1-2: supernatant of non transformed

yeast cells before and after methanol induction used as negative control; Lane 3-4:

supernatant of transformed yeast cells before and after methanol induction.

47

Figure 6. rEMA-1 Dot blot. Reactivity against different antibodies (A) anti-histidine

monoclonal antibody; (B) anti-EMA-1 monoclonal antibody; (C) sera from positive equine;

(D) sera from negative equine. In left of membranes was spotted a negative control and right

the rEMA-1 protein precipitated with ammonium sulfate.

5 ARTIGO 3

IMMUNOGENICITY AND ANTIGENICITY OF THE RECOMBINANT EMA-1

PROTEIN OF Theileria equi EXPRESSED IN THE YEAST Pichia pastoris

Artigo aceito para publicação: Revista Brasileira de Parasitologia Veterinária

Volume 18 (1-2) 2009.

Imunogenicidade e antigenicidade da proteína recombinante EMA-1 de

Theileria equi expressa em Pichia pastoris

NIZOLI, Leandro Quintana1*; CONCEIÇÃO, Fabrício Rochedo2; SILVA, Sergio Silva3;

DUMMER, Luana Alves1; SANTOS Jr, Alceu Gonçalves1; LEITE, Fábio Pereira Leivas1,4

ABSTRACT

The equine piroplasmosis caused by Theileria equi is one of the most important parasitic

diseases of the equine, causing damage to animal health and economic losses. In T. equi, two

merozoite surface proteins, equi merozoite antigen EMA-1 and EMA-2, have been identified

as the most immunodominant antigens. Thus, suggesting that these antigens might be used as

immunobiological tools. The EMA-1 of Theileria equi was cloned and expressed in the yeast

Pichia pastoris. The transformed yeast was grown at high cell density expressing up to 389

mg.L-1 of recombinant protein. The protein was concentrate, purified and detected in Dot blot.

The recombinant product was antigenically similar to the native protein as determined using

monoclonal antibodies, and polyclonal antibodies obtained from naturally infected equine

with T. equi. The immunogenicity of rEMA-1 protein was demonstrated by IFAT using sera

from recombinant protein immunized mice using aluminum hydroxide as adjuvant. All

animals vaccinated with rEMA-1 developed a high specific antibody response. This results

suggest that rEMA-1expressed in P. pastoris might be used as an antigen for immune

diagnostic as well as vaccine antigen.

Keywords: Theileria equi; recombinant vaccine; Pichia pastoris; EMA-1.

1 Centro de Biotecnologia, Universidade Federal de Pelotas (UFPel). 2 Departamento de Patologia, Universidade Federal do Rio Grande (FURG). 3 Departamento de Veterinária Preventiva, Faculdade de Veterinária, UFPel. 4 Departamento de Microbiologia e Parasitologia, Instituto de Biologia, UFPel. * Corresponding author at: Centro de Biotecnologia, Universidade Federal de Pelotas, CP 354, 96010-900 Pelotas, Brasil. Tel.: +55 53 32757350; fax: +55 53 32757555 E-mail adddress: lqn@pop.com.br

50

RESUMO

A piroplasmose eqüina causada por Theileria equi é uma das mais importantes doenças

parasitárias de eqüídeos, causando danos a saúde animal e perdas econômicas. Em T. equi,

duas proteínas de superfície de merozoítos, equi merozoite antigen EMA-1 e EMA-2, têm

sido identificados como antígenos imunodominantes. Sugerindo que estes antígenos possam

ser usados como produtos imunobiológicos. O gene EMA-1 de T. equi foi clonado e

expressado na levedura Pichia pastoris. As leveduras transformadas foram cultivadas a alta

densidades celulares expressando 389 mg.L-1 de proteína recombinante. A proteína foi

concentrada, purificada e detectada em Dot blot. O produto recombinante foi antigenicamente

similar a proteína nativa quando determinado usando anticorpo monoclonal e anticorpos

policlonais obtidos de eqüinos naturalmente infectados com T. equi. A imunogenicidade da

proteína rEMA-1 foi demonstrada por RIFI usando soro de camundongos imunizados com

proteína recombinante usando hidróxido de alumínio como adjuvante. Todos animais

vacinados com rEMA-1 desenvolveram uma alta resposta específica de anticorpos. Esses

resultados sugerem que rEMA-1 expressa em P. pastoris possa ser usado como antígeno para

diagnóstico imunológico bem como antígeno para vacinas.

Palavras chaves: Theileria equi, vacina recombinante, Pichia pastoris, EMA-1

INTRODUCTION

The equine piroplasmosis is one of the most important parasitic diseases of the

equines, it causes great damage to animal health. The disease is a haemoparasitosis caused by

Theileria equi and Babesia caballi, is a tick-borne hemoprotozoan disease affecting horses

worldwide (SCHEIN, 1988). Through infecting and destroying red blood cells, it can

compromise the equine function, leading to loss of vitality and decrease in the performance of

infected animals. Equine piroplasmosis caused by T. equi is more pathogenic and widespread

in horses than that by B. caballi (DE WAAL, 1992), causes a persistent infection for which

drug therapy or vaccination is not available (SCHEIN, 1988; FRIEDHOFF, 1990). The T.

equi infection is characterized by fever, anemia, icterus, and hepato and splenomegaly (OIE,

1989).

Merozoite surface proteins are important in the pathogenesis of hemoprotozoan

diseases because of their role in parasite recognition of, attachment to, and penetration of host

51

erythrocytes (JACK & WARD, 1981; KUMAR et al., 2004). In T. equi, two kinds of

merozoite surface proteins, equi merozoite antigen EMA-1 and EMA-2, have been identified

as the most immunodominant antigens (KAPPMEYER et al., 1993; KNOWLES et al., 1991;

KNOWLES et al., 1992). EMA-1 is geographically conserved among all T. equi isolates

(KNOWLES et al., 1991; CUNHA et al., 2002) and shares significantly high homologies in

amino acid sequence with the counterpart proteins of many Theileria parasites

(KAPPMEYER et al., 1993; KNOWLES et al., 1997). Additionally, EMA-1 has glycosyl-

phosphatidylinositol (GPI) anchor-specific motifs in their sequence, suggesting that these

proteins might be expressed on the outer surface of merozoite with a GPI anchor (KNOWLES

et al., 1997). The T. equi merozoite express surface protein of molecular mass 34 kDa, which

are strongly recognized by antibodies produced in infected animals (KNOWLES et al., 1997;

CUNHA et al., 2006). Further, EMA-1/2 are members of the major piroplasm surface protein

(MPSP) family that is conserved among the genus Theileria, but the biological role of MPSP

has not yet been clarified. Therefore, functional studies on EMA-1/2 family proteins may also

provide insight into the biological significance of MPSP expression in the intra-erythrocytic

development of Theileria parasites.

The methylotrophic yeast Pichia pastoris, which is one of the dominant expression

systems in molecular biology due to its stable and high-level expression of heterologous

proteins (CREGG et al., 1993, ROMANOS et al., 1998). Over 400 proteins from prokaryotes,

eukaryotes, and viruses have now been successfully expressed in this yeast (CEREGHINO et

al., 2002). The P. pastoris expression system offers many advantages, including its ease of

usage relative to other eukaryotic expression systems, the possibility of high-level expression

of foreign proteins. The yeast is also able to introduce eukaryotic post-translational

modifications such as glycosylation and proteolytic processing (CEREGHINO & CREGG,

2000).

The present study aims to express truncated EMA-1 gene by Pichia pastoris system

and subsequently determine the immunologic and antigenic properties of recombinant EMA-1

protein.

MATERIALS AND METHODS

Transformation of P. pastoris and expression in shaken flasks

The transformation of P. pastoris and cultivation in shaken flasks were performed

according to the EasySelectTM Pichia Expression Kit (Invitrogen, Catalog No. K1740-01). A

52

DNA encoding the EMA-1 from T. equi was obtained as previously described Nicolaiewsky

et al. (2001). The EMA-1 gene (GenBank accession number AF261824) was amplified by

PCR with the following primers: forward (5′-CGGAATTCACAAAATGGAGGAGGAGAA

ACCCAAG-3′) and reverse (5′-GGGGTACCAATAGAGTAGAAAATGCAATG- 3′),

containing a EcoRI (forward) and an XbaI site (reverse), respectively. After purification and

digestion, the amplified DNA fragment was cloned into the vector. The Escherichia coli

TOP10F were used as a host for plasmid propagation. The P. pastoris wild type strain X-33

and pPICZαB vector were used as a host for expression of EMA-1 in P. pastoris. The P.

pastoris transformants were selected in YPD containing 100 mg/mL zeocin.

Precipitation of protein

Proteins in the media were precipitated by addition of solid ammonium sulfate to 80%

and incubation at 4°C for 16 hours. Precipitated protein was pelleted by centrifugation at

12.000 g for 15 min and the pellet was resuspended in buffer PBS. The solution was desalted

by overnight dialysis against buffer PBS at 4°C. Protein quantitation was determined using

the BCATM Protein Assay Kit (Pierce Chemical Company) with bovine serum albumin as a

standard.

Dot blot

Dot blot assays were performed using 7,5 µg of recombinant protein. As a negative

control, 20 µL of a membrane preparation from a P. pastoris clone transformed with the

empty expression vector. The proteins were spotted onto a nitrocellulose membrane (Hybond

C, Amersham Biosciences). The nitrocellulose membranes were blocked for 1 hour at room

temperature in PBST buffer containing 5% of non-fat milk. One membrane was incubated

with monoclonal antibody anti-His peroxidase conjugate and other membrane with

monoclonal antibody anti-EMA-1. Two membranes were incubated with serum of equines

negative and positive for infection of T. equi, respectively. Membranes were incubated with

secondary antibodies for 1 hour with goat anti-horse or anti-mouse IgG peroxidase conjugate.

The reaction was developed with diaminobenzidine (Sigma).

Immunization of mice

The recombinant purified protein was prepared for immunization of mice (Mus

muscullus), female BALB/c mice (six weeks old) were randomly divided into three groups

53

(four mice per group) and subcutaneously immunized twice at 10 days intervals. One group

(GI) was injected with EMA-1 protein (50 µg) without adjuvant. The other group (GII) was

injected with 50 µg of EMA-1 protein formulated with the adjuvant aluminum hydroxide. The

final group (GIII) was used as a negative control and injected with 100 µl of sterile PBS.

Serum samples were collected from the retro-orbital plexus immediately before immunization

and about 10 days after each of the immunizations and used in serological tests. The

experiment was approved by the UFPel Committee of Ethics in Animal Experimentation.

Immunofluorescence assay

Antibody titers of the serum samples against the recombinant protein were measured

with IFAT. The slides were prepared with infected horses erythrocytes in which are visible as

compact inclusion by IFAT staining. IFAT was performed according to the Cunha (1993).

Then polled serum from the different groups were added incubated, and applied FITC-

conjugated goat anti-mouse IgG (Invitrogen), per well diluted at 1:400 in PBS buffer. The

visualization slides were in epifluorescent microscopy (Olympus, BX-FLA).

RESULTS AND DISCUSSION

Expression and purification of rEMA-1 in P. pastoris

The P. pastoris gene expression system is an attractive method with which to produce

a variety of intercellular and extracellular proteins (CREGG et al., 1993). Since, we

previously isolated a DNA encoding this protein, we decided to clone the DNA sequence

encoding EMA-1 without its native signal peptide in the P. pastoris pPICZαB plasmid, in

frame with the yeast a-factor signal sequence, for secretion of protein containing a 6His-Tag

at its C-terminus. The pPICZαB-EMA-1 plasmid was then transformed and targeted to the P.

pastoris genome by means of homologous recombination. The presence of the EMA-1 coding

sequence in the genomic DNA isolated from Pichia transformants was confirmed by PCR. In

the P. pastoris expression system, recombinant protein expression is strictly controlled by the

AOX1 promoter. Expression was induced by addition of methanol to a final methanol

concentration of 0.5%. A protein that was not present before methanol induction was detected

by SDS-PAGE (data not shown).

One of the main advantages in producing heterologous proteins as secreted products in

P. pastoris is the easy isolation of the recombinant product from the medium in which it is

produced. Indeed, the initial purity of recombinant molecule in culture medium is high

54

because the level of endogenous secreted proteins is very low. Thus, after removal of the

yeast cells by centrifugation, proteins in the culture supernatant were precipitated with 80%

ammonium sulfate fractionation. The final yield of the purified protein was 389 mg of rEMA-

1 per liter of cell culture supernatant.

Detection of reactivity to recombinant EMA-1

Dot blot is a technique for detecting and identifying proteins, similar to the Western

blot technique but differing in that protein samples are not separated electrophoretically but

are spotted through circular templates directly onto the membrane. Antigens may be applied

directly to nitrocellulose membrane as a discrete spot (dot) to give a simple and reliable assay.

In order to evaluate the reactivity of recombinant EMA-1 with sera from T. equi

positive and negative equine, we tested by Dot blot. Positive samples were considered all of

those that developed a reaction color. Negative controls samples did not develop any color.

In Dot blots, we are able to observe that the rEMA-1 protein reacted with the serum

from naturally infected horse by T. equi, but did not with the serum of the negative horse.

The figure 1 show the reactivity of the rEMA-1 protein using anti-histidine

monoclonal antibody, monoclonal antibody anti-EMA-1, and serum of equine positive carrier

of T. equi, and did not show reactivity with serum of negative animal. No reactivity was

observed with control negative protein.

Immunogenicity of the rEMA-1 protein in mice

Mice immunized with the recombinant protein showed high antibody response, were

able to react with native EMA-1 of T. equi as observed by IFAT. Sera from the negative

control group did not react with native EMA-1, showing the specificity of the response

(Figure 2). These results indicate that immune response was generated in all the vaccinated

groups, showing that recombinant protein has capability to generated antibodies that react

with the native protein. We also observed that the antibody titers have significant difference

between the groups with without adjuvant. This worth noting that rEMA-1 expressed in P.

pastoris maintain the same three-dimensional structure as the native protein since it was

recognized by antibodies generated by naturally infected horses.

The P. pastoris expression system has been used for the production of a wide variety

of proteins (CEREGHINO & CREGG, 2000). However, to the best of our knowledge this is

the first report on the cloning and expression of EMA-1 protein in P. pastoris.

55

In conclusion, the production and purification of rEMA-1 in the methylotrophic yeast

P. pastoris was effective, permitting a high-yield production of this protein. Thus, rEMA-

1expressed in P. pastoris might be a strong candidate to be used as an antigen for immune

diagnostic as well as vaccine antigen.

ACKNOWLEDGEMENTS

This author was supported by the CAPES Foundation through the Brazilian

government.

REFERENCES

CEREGHINO, G. P. L.; CEREGHINO, J. L.; ILGEN, C.; CREGG, J. M. Production of

recombinant proteins in fermenter cultures of the yeast Pichia pastoris. Current Opinion in

Biotechnology, v. 13, n. 4, p. 329-332, 2002.

CEREGHINO, J. L.; CREGG, J. M. Heterologous protein expression in the methylotrophic

yeast Pichia pastoris. FEMS Microbiology Reviews, v. 24, n. 1, p. 45-66, 2000.

CREGG, J. M.; VEDVICK, T. S.; RASCHKE, V. Recent advances in the expression of

foreign genes in Pichia pastoris. Biotechnology, v. 11, n. 8, p. 905-910, 1993.

CUNHA, C. W. Babesiose Eqüina: Padronização da Reação de Imunofluorescência Indireta

para sorodiagnóstico em eqüinos Puro Sangue Inglês. – Brasil. 1993. 56 p. Dissertação

(Mestrado) – Universidade Federal de Pelotas, Pelotas, 1993.

CUNHA, C. W.; KAPPMEYER, L. S.; McGUIRE, T. C.; DELLAGOSTIN, O. A.;

KNOWLES, D. P. Conformational dependence and conservation of an immunodominant

epitope within the Babesia equi erythrocyte-stage surface protein equi merozoite antigen 1.

Clinical and Diagnostic Laboratory Immunology, v. 9, n. 6, p. 1301-1306, 2002.

CUNHA, C. W.; McGUIRE, T. C.; KAPPMEYER, L. S.; HINES, S. A.; LOPEZ, A. M.;

DELLAGOSTIN, O. A.; KNOWLES, D. P. Development of specific immunoglobulin Ga

(IgGa) and IgGb antibodies correlates with control of parasitemia in Babesia equi infection.

Clinical and Vaccine Immunology, v. 13, n. 2, p. 297-300, 2006.

DE WAAL, D. T. Equine piroplasmosis: a review. British Veterinary Journal, v. 148, n. 1, p.

6-14, 1992. .

FRIEDHOFF, K. T. Interaction between parasite and tick vector. International Journal for

Parasitology, v. 20, n. 4, p. 525-535, 1990.

56

JACK, R. M. & WARD, P. A. Mechanisms of entry of Plasmodium and Babesia into red

cells. In Ristic, M. and Kreier, J. P. (ed.), Babesiosis. Academic Press, Inc., New York.

1981, p. 445-458.

KAPPMEYER, L. S.; PERRYMAN, L. E.; KNOWLES, D. P. Jr. A Babesia equi gene

encodes a surface protein with homology to Theileria species. Molecular and Biochemical

Parasitology, v. 62, n. 1, p. 121-124, 1993.

KNOWLES, D. P. Jr.; PERRYMAN, L. E.; GOFF, W.L.; MILLER, C.D.; HARRINGTON,

R.D.; GORHAM, J.R.. A monoclonal antibody defines a geographically conserved surface

protein epitope of Babesia equi merozoites. Infection and Immunity, v. 59, n. 7, p. 2412-

2417, 1991.

KNOWLES, D. P. Jr., KAPPMEYER, L. S.; STILLER, D., HENNAGER, S. G.;

PERRYMAN, L. E. Antibody to a recombinant merozoite protein epitope identifies horses

infected with Babesia equi. Journal of Clinical Microbiology, v. 30, n. 12, p. 3122-3126,

1992.

KNOWLES, D. P.; KAPPMEYER, L. S.; PERRYMAN, L. E. Genetic and biochemical

analysis of erythrocyte-stage surface antigens belonging to a family of highly conserved

proteins of Babesia equi and Theileria species. Molecular and Biochemical Parasitology, v.

90, n. 1, p. 69-79, 1997.

KUMAR, S.; YOKOYAMA, N.; KIM, J. Y.; HUANG, X.; INOUE, N.; XUAN, X.;

IGARASHI, I.; SUGIMOTO, C. Expression of Babesia equi EMA-1 and EMA-2 during

merozoite developmental stages in erythrocyte and their interaction with erythrocytic

membrane skeleton. Molecular and Biochemical Parasitology, v. 133, n. 2, p. 221-227,

2004.

NICOLAIEWSKY, T. B.; RICHTER, M. F.; LUNGE, V. R.; CUNHA, C. W.;

DELAGOSTIN, O.; IKUTA, N.; FONSECA, A. S.; SILVA, S. S.; OZAKI, L. S. Detection

of Babesia equi (Laveran, 1901) by nested polymerase chain reaction. Veterinary

Parasitology, v. 101, n. 1, p. 9-21, 2001.

Office International Des Epizooties (OIE). Manual of recommended diagnostic techniques

and requirements for biological products for lists A and B diseases, v. 1, p. 1-6, 1989.

ROMANOS, M.; SCORNER, C.; SREEKRSHNA, K.; CLARE, J. The generation of

microscopy recombinant strains. Methods Molecular Biology, v. 103, p. 55-72, 1998.

SCHEIN, E. Equine babesiosis. In Ristic, M., Babesiosis of Domestic Animals and Man. CRC

Press, Boca Raton, 1988. p. 197-208.

57

FIGURES

Figure 1. rEMA-1 Dot blot. Reactivity against different antibodies (A) anti-histidine

monoclonal antibody; (B) anti-EMA-1 monoclonal antibody; (C) sera from positive equine;

(D) sera from negative equine. In left of membranes was spotted a negative control and right

the rEMA-1 protein.

Figure 2. IFAT of sera from immunized mice with rEMA-1. (A) Pool of sera from immunized

mice twice in the presence of adjuvant; (B) Mice immunized with sterile PBS; (C) IFAT

positive control (equine sera with FITC anti-equine).

6 CONSIDERAÇÕES FINAIS

Durante a interação parasito-hospedeiro, as proteínas de superfície do

parasito são as principais responsáveis pela resposta imune do hospedeiro, sendo

que, os antígenos de superfície são promissores para uso como vacinas de

subunidade e reagentes para diagnóstico.

As tentativas para controlar a epidemia da doença causada pelo protozoário

T. equi tem sido focalizadas em estudos biológicos, bioquímicos, estruturais do

parasito e no desenvolvimento de novas drogas. As proteínas de superfície do

merozoito desempenham um papel chave no estabelecimento da infecção, a

interação da EMA-1 com as células do hospedeiro é crucial para a sua infectividade

(KUMAR, et al., 2004). Sabendo-se que P. pastoris é um sistema de expressão de

proteína de grande eficiência e reproduz as melhores condições de expressão de

proteína de eucariotos superiores, neste estudo, este organismo foi selecionado

como o ideal para a produção de EMA-1 com a finalidade de utilizá-la como antígeno

vacinal recombinante.

A escolha do sistema utilizado para a expressão da EMA-1 recombinante,

assim como, a definição dos objetivos foi extremamente importante. O entendimento

de que EMA-1 seria utilizada não só para a produção de vacinas, mas também para

a padronização de um teste imunológico para diagnóstico e para teste de protocolos

terapêuticos, nos remeteu à necessidade de uma molécula extremamente

semelhante à nativa.

No entanto, a capacidade de tradução de uma seqüência de DNA seria igual

em qualquer vetor de expressão. Porém, as diferenças se baseiam principalmente

na capacidade de produzir glicosilação da proteína, e na quantidade de proteína que

o vetor é capaz de produzir. A glicosilação em proteínas pode influenciar na

bioatividade, farmacocinética, biodistribuição e imunogenicidade da molécula.

Células procariontes não conseguem adicionar carboidratos (glicosilar); leveduras

bem como outros sistemas eucarióticos são capazes de glicosilações mais simples

normalmente sem a capacidade de sialização e com baixa capacidade de

59

glicosilação ligada ao O. A escolha do modelo de expressão da EMA-1 foi baseada

nos dados citados acima.

Várias proteínas já foram expressas em P. pastoris, entretanto, até o

momento não há relato de expressão de EMA-1 de T. equi nesta levedura para ser

utilizado como um antígeno recombinante. Desta forma, este trabalho é pioneiro

quanto à utilização de P. pastoris como vetor de expressão de proteína EMA-1 de T.

equi na tentativa de ser utilizada como antígeno em produtos imunobiológicos.

Com os resultados deste estudo desenvolvemos ferramentas que poderá ser

utilizadas para melhor entender a patogenicidade deste importante parasito bem

como sua utilização em estudos de vacinas e de diagnóstico.

60

7 CONCLUSÕES GERAIS

- A levedura P. pastoris é capaz de expressar a proteína recombinante

EMA-1 de Theileria equi;

- A proteína EMA-1 expressa por P. pastoris mostrou ser antigênica e

imunogênica;

- A proteína EMA-1 é um promissor alvo á ser utilizado como imunobiológico

no desenvolvimento de testes diagnósticos e na formulação de vacinas

recombinantes.

- Primeira citação da clonagem e expressão do gene EMA-1 de T. equi em

sistema de expressão heterólogo P. pastoris;

8 REFERÊNCIAS

ALLSOPP, M. T., CAVALIER-SMITH, T., DE WAAL, D. T., ALLSOPP, B. A.

Phylogeny and evolution of the piroplasms. Parasitology , v. 108, p. 147-152, 1994.

AMBAWAT, H. K.; MALHOTRA, D. V.; KUMAR, S.; DHAR, S. Erythrocyte associated

haemato-biochemical changes in Babesia equi infection experimentally produced in

donkeys. Veterinary Parasitology , v.85, p.319-324, 1999.

AUCAN, C., TRAORE, Y., TALL, F., NACRO, B., TRAORE-LEROUX, T., FUMOUX,

F., RIHET, P. High immunoglobulin G2 (IgG2) and low IgG4 levels are associated

with human resistance to Plasmodium falciparum malaria. Infection and Immunity ,

v. 68, p. 1252-1258, 2000.

BATTSETSEG, B.; LUCERO, S.; XUAN, X.; CLAVERIA, F. G.; INOUE, N.;

ALHASSAN, A.; KANNO, T.; IGARASHI, I.; NAGASAWA, H.; MIKAMI, T.; FUJISAKI,

K. Detection of natural infection of Boophilus microplus with Babesia equi and

Babesia caballi in Brazilian horses using nested polymerase chain reaction.

Veterinary Parasitology , v.107, p.351-357, 2002.

BROWN, W. C. Molecular approaches to elucidating innate and acquired immune

responses to Babesia bovis, a protozoan parasite that causes persistent infection.

Veterinary Parasitology , v. 101, p. 233-248, 2001.

BROWN, W. C., PALMER, G. H. Designing Blood-stage Vaccines against Babesia

bovis and B. bigemina. Parasitology Today , v. 15, p. 275-281, 1999.

CAVINATO, R. A., BASTOS, K. R., SARDINHA, L. R., ELIAS, R. M., ALVAREZ, J.

M., D'IMPERIO LIMA, M. R. Susceptibility of the different developmental stages of

the asexual (schizogonic) erythrocyte cycle of Plasmodium chabaudi chabaudi to

hyperimmune serum, immunoglobulin (Ig)G1, IgG2a and F(ab')2 fragments. Parasite

Immunology , v. 23, p. 587-597, 2001.

62

CEREGHINO, L. G. P.; CREGG, J. M. Applications of yeast in biotechnology: protein

production and genetic analysis. Current Opinion in Biotechnology , v. 10, p. 422-

427, 1999.

CEREGHINO, L. J.; CREGG, J. M. Heterologous protein expression in the

methylotrophic yeast Pichia pastoris. FEMS Microbiology Reviews, v. 24, p. 45-66,

2000.

CHEN, D., COPEMAN, D. B., BURNELL, J., HUTCHINSON, G. W. Helper T cell and

antibody responses to infection of CBA mice with Babesia microti. Parasite

Immunology , v. 22, p. 81-88, 2000a.

CHEN, D., COPEMAN, D. B., HUTCHINSON, G. W., BURNELL, J. Inhibition of

growth of cultured Babesia microti by serum and macrophages in the presence or

absence of T cells. Parasitology International , v. 48, p. 223-231, 2000b.

CRIADO-FORNELIO, A., MARTINEZ-MARCOS, A., BULING-SARAÑA, A., BARBA-

CARRETERO, J. C. Molecular studies on Babesia, Theileria and Hepatozoon in

southern Europe. Part I. Epizootiological aspects. Veterinary Parasitology , v. 113,

p. 189-201, 2003a.

CRIADO-FORNELIO, A., MARTINEZ-MARCOS, A., BULING-SARAÑA, A., BARBA-

CARRETERO, J. C. Molecular studies on Babesia, Theileria and Hepatozoon in

southern Europe. Part II. Phylogenetic analysis and evolutionary history. Veterinary

Parasitology , v. 114, p. 173-194, 2003b.

CUNHA, C. W., SILVA, S. S., PIMENTEL, C. A., DAPPER, E. Avaliação da

freqüência de equinos soropositivos a Babesia equi no Joquei Clube de Pelotas e

em dois haras da zona sul do Rio Grande do Sul. Revista Brasileira de

Parasitologia Veterinária , v. 5, p. 119-122, 1996.

CUNHA, C. W., SILVA, S. S., RODRIGUES, A. L., GUERREIRO, G. Avaliação do

efeito da esplenectomia em eqüinos portadores e livres de Babesia spp. Revista

Brasileira de Parasitologia Veterinária , v. 6, p. 157-160, 1997.

CUNHA, C. W.; McGUIRE, T. C.; KAPPMEYER, L. S.; HINES, S. A.; LOPEZ, A. M.;

DELLAGOSTIN, O. A.; KNOWLES, D. P. Development of specific immunoglobulin

Ga (IgGa) and IgGb antibodies correlates with control of parasitemia in Babesia equi

infection. Clinical and Vaccine Immunology , v. 13, p. 297-300, 2006.

63

CUNHA, C. W.; SILVA, S. S.; OSÓRIO, B. L.; DUTRA, C. L. Alterações

hematológicas e sorológicas em eqüinos experimentalmente infectados com Babesia

equi. Ciência Rural, v.28, p.283-286, 1998.

DUMMER, L. A., NIZOLI, L. Q., ROCHA, A. S. R., CONCEIÇÃO, F. R., TURNES, C.

G., VIDOR, T., LEITE, F. P L. Production and characterization of recombinant Bovine

Herpesvirus type 5 Glycoprotein D expressed in Pichia pastoris. In: 8th International

Veterinary Immunology Symposium, 2007, Anais do 8th International Veterinary

Immunology Symposium , 2007.

FRIEDHOFF, K. T. Interaction between parasite and tick vector. International

Journal for Parasitology , v.20, n.4, p.525-535, 1990.

FRIEDHOFF, K. T.; TENTER, A. M.; MULLER, I. Haemoparasites of equines: impact

on international trade of horses. Revue Scientifique et Technique , v.9, p.1187-

1194, 1990.

GUIMARÃES, A. M.; LIMA, J. D.; RIBEIRO, M. F. B. Sporogony and experimental

transmission of Babesia equi by Boophilus microplus ticks. Parasitology Research ,

v.84, p.323-327, 1998b.

GUIMARÃES, A. M.; LIMA, J. D.; RIBEIRO, M. F. B.; CAMARGOS, E. R. S.; BOZZI,

I. A. Ultrastructure of sporogony in Babesia equi in salivary glands of adult female

Boophilus microplus ticks. Parasitology Research , v.84, p.69-74, 1998a.

HELMBY, H., TROYE-BLOMBERG, M. Differential immunoglobulin E and cytokine

responses in BALB/c and C57Bl/6 mice during repeated infections with blood-stage

Plasmodium chabaudi malaria. Parasite Immunology , v. 22, p. 185-190, 2000.

HEUCHERT, C. M., DE, G. V., JR., DE ATHAIDE, D. F., BOSE, R., FRIEDHOFF, K.

T. Seroepidemiologic studies on Babesia equi and Babesia caballi infections in

Brazil. Veterinary Parasitology , v. 85, p. 1-11, 1999.

IGARASHI, I., SUZUKI, R., WAKI, S., TAGAWA, Y., SENG, S., TUM, S., OMATA, Y.,

SAITO, A., NAGASAWA, H., IWAKURA, Y., SUZUKI, N., MIKAMI, T., TOYODA, Y.

Roles of CD4(+) T cells and gamma interferon in protective immunity against Babesia

microti infection in mice. Infection and Immunity , v. 67, p. 4143-4148, 1999.

JENKINS, M. C. Advances and prospects for subunit vaccines against protozoa of

veterinary importance. Veterinary Parasitology , v. 101, p. 291-310, 2001.

64

KATZER, F., MCKELLAR, S., KIRVAR, E., SHIELS, B. Phylogenetic analysis of

Theileria and Babesia equi in relation to the establishment of parasite populations

within novel host species and the development of diagnostic tests. Molecular and

Biochemical Parasitology , v. 95, p. 33-44, 1998.

KERBER, C. E., FERREIRA, F., PEREIRA, M. C. Control of equine piroplasmosis in

Brazil. Onderstepoort Journal of Veterinary Research , v.66, p.123-127, 1999.

KNOWLES, D. P., KAPPMEYER, L. S., PERRYMAN, L. E. Specific immune

responses are required to control parasitemia in Babesia equi infection. Infection

and Immunity , v. 62, p. 1909-1913, 1994.

KNOWLES, D. P., KAPPMEYER, L. S., PERRYMAN, L. E. Genetic and biochemical

analysis of erythrocyte-stage surface antigens belonging to a family of highly

conserved proteins of Babesia equi and Theileria species. Molecular and

Biochemical Parasitology , v. 90, p. 69-79, 1997.

KNOWLES, D. P., JR. Equine babesiosis (Piroplasmosis): A problem in the

international movement of horses, British Veterinary Journal , v. 152, p. 123-126,

1996

KUMAR, S.; YOKOYAMA, N.; KIM, J. Y.; HUANG, X.; INOUE, N.; XUAN, X.;

IGARASHI, I.; SUGIMOTO, C. Expression of Babesia equi EMA-1 and EMA-2 during

merozoite developmental stages in erythrocyte and their interaction with erythrocytic

membrane skeleton. Molecular and Biochemical Parasitology , v. 133, p. 221-227,

2004.

LORDING, P. M. Erythrocytes. Veterinary Clinical Equine, v. 24, p. 225-237, 2008.

MARTIN, R. Equine piroplasmosis: the temporary importation of soropositive horses

into Australia. Australian Veterinary Journal , v. 77, p. 308-309, 1999.

MEHLHORN, H., SCHEIN, E. Redescription of Babesia equi Laveran, 1901 as

Theileria equi Mehlhorn, Schein 1998. Parasitology Research , v. 84, p. 467-475,

1998.

NICOLAIEWSKY, T. B., RICHTER, M. F., LUNGE, V. R., CUNHA, C. W.,

DELAGOSTIN, O., IKUTA, N., FONSECA, A. S., DA SILVA, S. S., OZAKI, L. S.

Detection of Babesia equi (Laveran, 1901) by nested polymerase chain reaction.

Veterinary Parasitology , v. 101, p. 9-21, 2001.

65

NIZOLI, L. Q., DUMMER, L. A., CONCEIÇÃO, F. R., SILVA, S. S., SANTOS Jr, A.

G., LEITE, F. P L. Construção de vacina recombinante contra babesiose equina In:

XX Congresso Brasileiro de Parasitologia, 2007, Revista de Patologia Tropical ,

v.36, 2007.

NOGUEIRA, C. E. W.; SILVA, S. S.; NIZOLI, L. Q.; RIBAS, L. M.; ALBUQUERQUE, L. P. A. N. Efeito quimioprofilático do dipropionato imidocarb na prevenção da agudização de babesiose eqüina em cavalos portadores da infecção. A Hora Veterinária, Porto Alegre-RS, v.146, p.17-20, 2005.

OLADASU, L. A.; OLUFEMI, B. E. Hematology of experimental babesiosis and

ehrlichiosis in steroid immunosuppressed horses. Journal Veterinary Medicine B ,

v.39, p.345-352, 1992.

OLADOSU, L. A. Effects of intravenous corticosteroid on the pathogenicity of

Babesia equi infection of donkeys (Equus asinus). Journal Veterinary Medicine B ,

v.35, p.509-514, 1988.

PALMER, G. H., RURANGIRWA, F. R., KOCAN, K. M., BROWN, W. C. Molecular

basis for vaccine development against the ehrlichial pathogen Anaplasma marginale.

Parasitology Today , v. 15, p. 281-286, 1999.

PFEIFER, B. I., BOSE, R., PEYMANN, B., FRIEDHOFF, K. T. Epidemiological

aspects of equine babesioses in a herd of horses in Brazil. Veterinary Parasitology ,

v. 58, p. 1-8, 1995.

RIBEIRO, M. F., COSTA, J. O., GUIMARAES, A. M. Epidemiological aspects of

Babesia equi in horses in Minas Gerais, Brazil. Veterinary Research

Communications , v. 23, p. 385-390, 1999.

SCHEIN, E. Equine babesiosis In Ristic, M., Babesiosis of Domestic Animals and

Man CRC Press, Boca Raton, FL. 1988, p. 197-208.

SCHEIN, E., REHBEIN, G., VOIGT, W. P., ZWEYGARTH, E. Babesia equi (Laveran

1901) Development in horses and in lymphocyte culture. Tropenmed Parasitology ,

v. 32, p. 223-227, 1981.

66

SHODA, L. K., PALMER, G. H., FLORIN-CHRISTENSEN, J., FLORIN-

CHRISTENSEN, M., GODSON, D. L., BROWN, W. C. Babesia bovis-stimulated

macrophages express interleukin-1beta, interleukin-12, tumor necrosis factor alpha,

and nitric oxide and inhibit parasite replication in vitro. Infection and Immunity , v.

68, p. 5139-5145, 2000.

STILLER, D., GOFF, W. L., JOHNSON, L. W., KNOWLES, D. P. Dermacentor

variabilis and Boophilus microplus (Acari: Ixodidae): Experimental vectors of Babesia

equi to equids. Journal of Medical Entomology , v.39, p.667-670, 2002.

SU, Z., STEVENSON, M. M. Central role of endogenous gamma interferon in

protective immunity against blood-stage Plasmodium chabaudi AS infection.

Infection and Immunity , v. 68, p. 4399-4406, 2000.

TAYLOR, P. R., SEIXAS, E., WALPORT, M. J., LANGHORNE, J., BOTTO, M.

Complement contributes to protective immunity against reinfection by Plasmodium

chabaudi chabaudi parasites. Infection and Immunity , v. 69, p. 3853-3859, 2001.

TENTER, A. M., FRIEDHOFF, K. T. Serodiagnosis of experimental and natural

Babesia equi and B. caballi infections. Veterinary Parasitology , v. 20, p. 49-61,

1986.

UETI, M. W., PALMER, G. H., KAPPMEYER, L. S., STATFIELD, M., SCOLES, G. A.,

KNOWLES, D. P. Ability of the vector tick Boophilus microplus to acquire and

transmit Babesia equi following feeding on chronically infected horses with low-level

parasitemia. Journal Clinical Microbiology , v. 43, p. 3755-3759, 2005.

UETI, M. W., PALMER, G. H., SCOLES, G. A., KAPPMEYER, L. S., KNOWLES, D.

P. Persistently infected horses are reservoirs for intrastadial tick-borne transmission

of the apicomplexan parasite Babesia equi. Infection and Immunity , v. 76, p. 3525-

3529, 2008.

World Organization for Animal Health (OIE). World animal health information

database (WAHID) [database online]. Equine piroplasmosis: January 2005 –August

2008. Paris: OIE;2008. Available at: http://www.oie.int/wahid-

prod/public.php?page=disease_status_lists. Accessed 28 Aug 2008.

67

XUAN, X., LARSEN, A., IKADAI, H., TANAKA, T., IGARASHI, I., NAGASAWA, H.,

FUJISAKI, K., TOYODA, Y., SUZUKI, N., MIKAMI, T. Expression of Babesia equi

merozoite antigen 1 in insect cells by recombinant baculovirus and evaluation of its

diagnostic potential in an enzyme-linked immunosorbent assay. Journal of Clinical

Microbiology , v. 39, p. 705-709, 2001.

ZAHLER, M., RINDER, H., GOTHE, R. Genotypic status of Babesia microti within the

piroplasms. Parasitology Research , v. 86, p. 642-646, 2000a.

ZAHLER, M., RINDER, H., SCHEIN, E., GOTHE, R. Detection of a new pathogenic

Babesia microti-like species in dogs. Veterinary Parasitology , v. 89, p. 241-248,

2000b.

ZOBBA, R., ARDU, M., NICCOLINI, S., CHESSA, B., MANNA, L., COCCO, R.,

PARPAGLIAE, M. L. P. Clinical and Laboratory Findings in Equine Piroplasmosis.

Journal of Equine Veterinary Science , v. 28, 2008.