UNIVERSIDADE FEDERAL FLUMINENSE ÁREA DE...

0

UNIVERSIDADE FEDERAL FLUMINENSE

PROGRAMA DE PÓS-GRADUAÇÃO EM MEDICINA VETERINÁRIA

ÁREA DE CONCENTRAÇÃO EM HIGIENE VETERINÁRIA

E PROCESSAMENTO TECNOLÓGICO DE PRODUTOS

DE ORIGEM ANIMAL

BEATRIZ DA SILVA FRASÃO

ESTRATÉGIA TECNOLÓGICA APLICADA EM CARNE DE

FRANGO (Gallus gallus domesticus): ADIÇÃO DE ANTIOXIDANTES

NATURAIS DO RESÍDUO DA JUÇARA (Euterpe edulis) E DO

PEQUI (Caryocar brasiliense) E ATIVIDADE ANTIMICROBIANA

DO EXTRATO DO PEQUI

NITERÓI

2017

BEATRIZ DA SILVA FRASÃO

Estratégia tecnológica aplicada em carne de frango (Gallus gallus domesticus): adição de

antioxidantes naturais do resíduo da juçara (Euterpe edulis) e do pequi (Caryocar

brasiliense) e atividade antimicrobiana do extrato do pequi

Tese apresentada ao Programa de Pós-

Graduação em Medicina Veterinária da

Universidade Federal Fluminense,

como requisito parcial para obtenção do

grau de Doutor. Área de concentração:

Higiene Veterinária e Processamento

Tecnológico de Produtos de Origem

Animal.

Orientador: Prof. Dr. Carlos Adam Conte Junior

Co-orientadora: Drª. Renata Torrezan

Co-orientadora: Profª. Dra. Marion Pereira da Costa

Niterói

2017

F841e Frasão, Beatriz da Silva

Estratégia Tecnológica aplicada em carne de

frango (Gallus gallus domesticus): adição de

antioxidantes naturais do resíduo da jaçura

(Euterpe edulis) e do pequi (Caryocar

brasiliense) e atividade antimicrobiana do

extrato de pequi / Beatriz da Silva Frasão;

orientador Carlos Adam Conte Junior – 2017.

220f.

Tese (Doutorado em Higiene Veterinária e

Processamento Tecnológico de Produtos de origem

animal)- Universidade Federal Fluminense, 2017.

Orientador: Carlos Adam Conte Junior

1. Tecnologia de alimentos. 2. Carne de

frango. 3. Radiação ultravioleta. 4. Testes de

sensibilidade microbiana. 5. Oxidação de carne.

I. Título.

CDD 664.07

Aos meus pais que nunca mediram forças e dedicação para que eu

conseguisse alcançar meus objetivos. À minha irmã Isabela que

foi sempre uma companheira incansável. À toda minha família

que entendeu que a distância era necessária.

AGRADECIMENTOS

Primeiramente a Deus, que é o maior responsável por tudo que consegui na vida. A Ele

reconhecimento pelas minhas conquistas, por ser a luz na trilhagem dos meus caminhos

e meu refúgio nos momentos necessários.

Aos meus pais, Izilda Aparecida da Silva Frasão e Antonio Aparecido Ferreira Frasão,

que são meu alicerce e me ensinaram a lutar com simplicidade, dignidade e honestidade

pelos meus objetivos. Seguindo sempre em frente de cabeça erguida vencendo cada

obstáculo.

À minha irmã, Isabela da Silva Frasão, que é uma amiga. Que mesmo longe sempre foi

olhos, ouvido, ombro e a mão, que me apoiou e incentivou a nunca desistir do que eu

realmente quis.

À minha avó materna, Helena, sempre dedicada, atenciosa, e preocupada, nunca mediu

esforços e cuidado. Obrigada por ser responsável por parte da pessoa que sou hoje.

Aos meus avós paternos, Marina e Onivaldo, pelo zelo, carinho e amor que me dedicam

sempre.

A todos os familiares que sempre me incentivaram a continuar na persistência,

independente dos obstáculos que surgissem. Que apesar da distância e das ausências

entenderam que naquele momento era necessário.

A todas as minhas amigas da graduação, em especial, Karina, Maisa, Marcela, Ana Paula,

Aline, Cecília, obrigada por sempre estarem presentes quando precisei, mesmo estando

longe.

Aos meus amigos de apartamento, Raissa e Bruno, pela força e incentivo quando precisei.

À Profª Drª Kênia de Fátima Carrijo, que me incentivou, instruiu e apoiou na escolha da

Universidade e do Programa de Pós-Graduação.

Ao meu orientador Carlos Adam Conte Junior, que além de mestre, não mediu esforços

para que conquistasse o aprendizado.

À minha coorientadora Marion Pereira da Costa pela atenção, dedicação, amizade

incentivo e auxílio, sem medir forças, sempre que necessário.

À Drª Renata Torrezan, minha coorientadora, colaboradora da EMBRAPA-Agroindústria

de Alimentos, contribuindo com seu imenso conhecimento.

A meus amigos e colegas do Programa de Pós-Graduação, aos estagiários e alunos de

iniciação científica que estiveram envolvidos no projeto e aos membros do Laboratório

de Controle Físico-químico da UFF.

Aos professores, secretários e técnicos do Programa de Pós-Graduação em Higiene

Veterinária e Processamento Tecnológico de Produtos de Origem Animal. Em especial

ao secretário Drausio Paiva Ferreira e a secretária Mariana Ferreira sempre atenciosos e

prestativos.

Ao Profº Drº Walter Lilebaum e aos alunos de mestrado do Laboratório de Bacteriologia

Animal, Lucas Correia e Bruno Cabral, colaboradores da UFF, pela dedicação, atenção e

contribuição para que parte desse projeto fosse executado.

Ao Profº Drº Daniel Perrone e ao mestre Fabrício Silva, colaboradores da UFRJ, pela sua

atenção e disponibilidade.

À Coordenação de Aperfeiçoamento de Pessoal de Nível Superior pela bolsa concedida,

a qual viabilizou a execução do referido estudo.

“A ciência nunca resolve um problema sem

criar pelo menos outros dez”.

George Bernard Shaw

RESUMO

Objetivou-se com a presente tese obter pontos ótimos para a extração de compostos

antioxidantes e atividade antioxidante do resíduo da juçara (Euterpe edulis) e verificar a

ação desses compostos provenientes do resíduo da juçara e do pequi (Caryocar

brasiliense) na estabilização do processo oxidativo (lipídico e proteico) em carne de

frango (Gallus gallus domesticus) de criação convencional e livre de antibiótico,

contribuindo para elaboração de produtos mais saudáveis. Ademais, objetivou-se

verificar a atividade antimicrobiana do extrato da casca do pequi. No primeiro

experimento (Artigo I) foi verificada a melhor combinação de extração do resíduo da

juçara (Euterpe edulis) para a concentração dos compostos antioxidantes (fenólicos,

flavonoides, antocianinas e taninos) e para a atividade antioxidante (β-caroteno), por

micro-ondas analítico utilizando a metodologia de superfície de resposta com

componente central. As variáveis estudadas foram: a concentração de etanol no solvente

aquoso (40, 60 e 80%), o tempo de exposição no micro-ondas (30, 60 e 90 segundos) e a

potência (400, 500 ou 600W). Os parâmetros ótimos obtidos foram: fenólicos 668,18W /

110,45sec. / 93,64%, flavonoides e antocianinas 532,28W / 110,45sec. / 93,64%, taninos

668,18W / 9,55sec. / 93,64%, e atividade antioxidante 668,18W / 110,45sec. / 64,41%.

No segundo experimento (Artigo II) foi realizada a aplicação em carne de frango

convencional e livre de antibiótico dos extratos com parâmetros ótimos para extração de

fenólicos totais (extrato P) e atividade antioxidante (extrato A), determinados no

experimento anterior (Artigo I), verificando a eficácia na redução do processo oxidativo

(lipídico e proteico) durante 9 dias de armazenamento a 4ºC. O extrato P apresentou

melhor efeito na estabilidade oxidativa dos lipídios e das proteínas, podendo ser utilizado

como uma fonte de antioxidantes naturais para aplicação em carne de frango,

minimizando o estresse oxidativo e melhorando a qualidade da carne. No terceiro

experimento (Artigo III), o extrato com melhor capacidade de redução dos processos

oxidativos (668,18 W / 110,45 sec. / 93,64%), selecionado no experimento anterior

(Artigo II), foi empregado na extração dos fenólicos totais do resíduo da juçara e da casca

do pequi, aplicando-os em carne de frango livre de antibiótico. Antes da aplicação dos

extratos, a carne de frango foi submetida à radiação UV-C, com o intuito de favorecer o

processo oxidativo para melhor avaliação do efeito dos extratos na redução da oxidação

lipídica e proteica. O extrato do resíduo do pequi foi mais eficiente na estabilidade do

processo oxidativo. Portanto, o uso da casca do pequi como fonte de antioxidante natural

para aplicação em carne de frango apresentou maior eficiência, uando comparado ao

resido da jussara e do antioxidante sintético. O quarto (Artigo IV) foi um artigo de

revisão, no qual apresenta-se diferentes aspectos relacionados à avaliação de

Campylobacter spp. em produtos de origem animal. Esta foi uma das bactérias

patogênicas avaliadas no próximo estudo. No quinto experimento (Artigo V) foi avaliada

a atividade antimicrobiana do extrato do resíduo do pequi através da concentração

inibitória mínima (CIM), concentração bactericida mínima (CBM), inibição da formação

de biofilme e a curva do comportamento bacteriano durante 48 horas. O extrato foi obtido

conforme parâmetros do trabalho anterior (668,18 W / 110,45 sec. / 93,64%). Foram

testados microrganismos patogênicos e deteriorantes relevantes em carne de aves,

incluindo: Salmonella enterica, Campylobacter jejuni, Campylobacter coli, E. coli

O157:H7, E. coli, Staphylococcus aureus e Pseudomonas aeruginosa. As cepas de

Campylobacter foram as mais sensíveis para os valores de CIM e CBM, enquanto que as

cepas de E. coli e S. enterica foram as menos sensíveis para MIC e S. aureus se mostrou

resistente na CBM. O extrato da casca do pequi apresentou inibição na formação do

biofilme em todas as cepas que o formaram, no entanto, foi mais eficiente contra o

biofilme formado por Pseudomonas e menos eficiente para o biofilme formado por E.

coli I. Desta forma, o extrato do resíduo do pequi apresenta potencial aplicação no

controle de biofilme formado pelas bacterias testadas.

Palavras-chave: oxidação lipídica, oxidação proteica, radiação UV-C, concentração

inibitória mínima, concentração bactericida mínima, patógenos veiculados por alimentos

ABSTRACT

The aim of this thesis was to obtain optimal points for the extraction of antioxidant

compounds and antioxidant activity of the juçara (Euterpe edulis) waste and verify the

action of these compounds from the residue of the juçara and pequi (Caryocar

brasiliense) in the stabilization of the oxidative (lipid and protein) in conventional and

antibiotic-free broiler meat (Gallus gallus domesticus), contributing to the development

of healthier products. In addition, aimed to verify the antimicrobial activity of the pequi

peel extract. In the first experiment (Article I), the best combination of extraction of the

juçara waste (Euterpe edulis) for the antioxidant compounds (phenolic, flavonoids,

anthocyanins and tannins) and for antioxidant activity (β-carotene) using surface response

methodology with central component. The variables studied were: ethanol concentration

in the aqueous solvent (40, 60 and 80%), exposure time in the microwave (30, 60 and 90

seconds) and power (400, 500 and 600W). The optimum parameters obtained were:

phenolic and flavonoids 668.18W / 110,45sec. / 93.64%, anthocyanins 532.28W /

110.45sec. / 93.64%, tannins 668.18W / 9.55sec. / 93.64%, total antioxidant content

668.18W / 110,45sec. / 93.64%, and antioxidant activity 668.18W / 110,45sec. / 64.41%.

In the second experiment (Article II), the extracts with optimum parameters for

extraction of total antioxidant content (extract P) and antioxidant activity (extract A),

determined in the previous experiment (Article I), were applied in conventional and

antibiotic-free broiler meat. Checking the effectiveness in reducing the oxidative (lipid

and protein) process for 9 days of storage at 4° C. The extract P showed a better effect on

the oxidative stability of lipids and proteins. In this way, the juçara waste can be used as

a source of natural antioxidants for application in chicken meat, minimizing oxidative

stress and improving meat quality. In the third experiment (Article III), the extract with

the best reduce oxidative capacity (668.18 W / 110.45 sec. / 93.64%), selected in the

previous experiment (Article II), was used to extract the total antioxidant compounds

from juçara and the pequi waste, applying them in antibiotic-free broiler meat. Before the

application of the extracts, the chicken meat was submitted to UV-C radiation, in order

to favor the oxidative process to better evaluate the effect of the extracts in the reduction

of lipid and protein oxidation. Extract of the pequi residue was more efficient in the

stability of the oxidative process. In addition, the use of pequi peel as a source of natural

antioxidant for application in chicken meat presented higher efficiency than the use of the

synthetic antioxidant. The fourth (Article IV) was a review article, which presents

different aspects related to the evaluation of Campylobacter spp. in products of animal

origin. It was one of the pathogenic bacteria evaluated in the next study. In the fifth

experiment (Article V) the antimicrobial activity of the pequi residue extract was

evaluated through minimum inhibitory concentration (MIC), minimal bactericidal

concentration (MBC), inhibition of biofilm formation and bacterial behavior curve for 48

hours. The extract was obtained according to the parameters of the previous work (668.18

W / 110.45 sec / 93.64%) (Article III). Relevant pathogenic and deteriorating

microorganisms in poultry meat have been tested, including: Salmonella enterica,

Campylobacter jejuni, Campylobacter coli, E. coli O157: H7, E. coli, Staphylococcus

aureus and Pseudomonas aeruginosa. Campylobacter strains were the most sensitive for

MIC and MBC values, whereas strains of E. coli and S. sterica were the least sensitive to

MIC and S. aureus showed resistance in CBM. The extract of pequi peel showed

inhibition in the formation of biofilm in all the strains that formed it, however, it was

more efficient against the biofilm formed by Pseudomonas and less efficient for the

biofilm formed by E. coli I. Since the formation of biofilm is one of the main challenges

in the food industry, extract of the pequi residue presents potential application in the

control of biofilm formed by the bacteria tested.

Key-words: lipid oxidation, protein oxidation, UV-C radiation, minimum inhibitory

concentration, minimum bactericidal concentration, foodborne pathogens

SUMÁRIO

RESUMO, p.8

ABSTRACT, p.10

LISTA DE ILUSTRAÇÕES, p.13

LISTA DE TABELAS, p. 14

1 INTRODUÇÃO, p.16

2 REVISÃO DE LITERATURA, p.18

2.1 AVICULTURA, p.18

2.1.1 Produção de carne de frango, p.18

2.1.2 Criação de frango livre de antibiótico, p.18

2.2 PROCESSO OXIDATIVO EM CARNE DE AVES, p.19

2.3 ANTIOXIDANTES, p. 21

2.4 ANTIMICROBIANOS, p.23

2.5 FRUTAS NATIVAS E COMPOSTOS NATURAIS, p.23

2.5.1 Euterpe edulis (juçara), p.24

2.5.2 Caryocar brasiliense (pequi), p.25

2.6 ANÁLISE POR SUPERFÍCIE DE RESPOSTA, p.26

2.7 EXTRAÇÃO POR MICRO-ONDAS, p.26

3 DESENVOLVIMENTO, p.28

3.1 ARTIGO I, p.28

3.2 ARTIGO II, p.45

3.3 ARTIGO III, p.74

3.4 ARTIGO IV, p.106

3.5 ARTIGO V, p.161

4 CONSIDERAÇÕES FINAIS, p.181

5 REFERÊNCIAS BIBLIOGRÁFICAS, p.182

6 ANEXOS, p.190

6.1 COMPROVANTE DE PUBLICAÇÃO DO ARTIGO I, p.190

6.2 COMPROVANTE DE SUBMISSÃO DO ARTIGO II, p.205

6.3 COMPROVANTE DE SUBMISSÃO DO ARTIGO III, p.206

6.4 COMPROVANTE DE PUBLICAÇÃO DO ARTIGO IV, p.207

LISTA DE ILUSTRAÇÕES

ARTIGO I

Figura 1A: Gráficos da superfície de resposta com os parâmetros da interação bidirecional

dos fenólicos totais (TPC), descrevendo o efeito das três variáveis independentes nas

variáveis resposta, p. 35

Figura 1B. Gráficos da superfície de resposta com os parâmetros da interação bidirecional

dos fenólicos totais (TFC), descrevendo o efeito das três variáveis independentes nas


Figura 2A. Gráficos da superfície de resposta com os parâmetros da interação bidirecional

dos fenólicos totais (TAC), descrevendo o efeito das três variáveis independentes nas


Figura 2B. Gráficos da superfície de resposta com os parâmetros da interação bidirecional

dos fenólicos totais (TTC), descrevendo o efeito das três variáveis independentes nas


Figura 3A. Gráficos da superfície de resposta com os parâmetros da interação bidirecional

da atividade antioxidante, descrevendo o efeito das três variáveis independentes nas

variáveis resposta (A), p. 38

Figura 3B. Atividade antioxidante dos extratos etanólicos de E. edulis, determinada pelo

branqueamento do β-caroteno por 120 min (B), p. 39

ARTIGO II

Figura 1: Oxidação da carne de frango durante a estocagem a 4ºC por 10 dias, (A)

Oxidação lipídica, (B) Oxidação Proteica, p. 70

Figura 2: Caracterização da cor dos tratamentos de carne de frango durante 10 dias de

estocagem a 4ºC. (A) Luminosidade (L*), (B) Vermelho (a*), (C) Amarelo (b*), (D)

Croma (C*), (E) Ângulo Hue (hº), (F) Alteração total de cor (ΔE*), p. 71

ARTIGO III

Figura 1: Oxidação lipídica em carne de frango submetida a diferentes tempos de

exposição a radiação UV-c (A), e oxidação da carne de frango nos tratamentos estocados

a 4ºC por 10 dias, (B) Oxidação Lipídica, (C) Oxidação Proteica, p. 102

Figura 2: Valores de pH da carne de frango durante estocagem a 4ºC por 10 dias, p. 103

Figura 3: Caracterização da coloração dos tratamentos de carne de frango durante

estocagem a 4ºC por 10 dias, p. 104

ARTIGO V

Figura 1: Curva de crescimento de E. coli I (A), E. coli II (B), and E. coli III (C) frente à

adição ou não do extrato do resíduo do pequi, e incubação a 37ºC por 48 horas, p. 176

Figura 2: Curva de crescimento de S. aureus (A), P. aeruginosa (B), and S. enterica (C)

frente à adição ou não do extrato do resíduo do pequi, e incubação a 37ºC por 48 horas,

p. 177

Figura 3: Curva de crescimento de C. jejuni I (A), C. jejuni II (B), C. coli I (C), and C.

coli II (D) frente à adição ou não do extrato do resíduo do pequi, e incubação a 37ºC por

48 horas, p. 180

Figura 4: Formação de biofilme por bactérias deteriorantes e patogênicas em diferentes

concentrações do extrato da casca do pequi, p. 181

LISTA DE TABELAS

ARTIGO I

Tabela 1: Condição da extração do desenho experimental e valores dos compostos

fenólicos totais (TPC), flavonoides totais (TFC), antocianinas totais (TAC), taninos totais

(TTC) e atividade antioxidante (AA%), p. 30

Table 2. Análise de variância (ANOVA) e coeficiente de regressão do modelo de

quadrado polinomial para os resultados de compostos fenólicos totais (TPC), flavonoides

totais (TFC), antocianinas totais (TAC), taninos totais (TTC) e atividade antioxidante

(AA%), do resíduo do extrato da Euterpe edulis, p. 33

ARTIGO II

Tabela 1: Compostos antioxidantes e atividade antioxidante do extrato do resíduo da

juçara (Euterpe edulis), p. 66

Tabela 2: Composição centesimal dos tratamentos de carne de frango, p. 67

Tabela 3: Perfil de ácidos graxos da carne de frango, p. 68

Tabela 4: Compostos antioxidantes presentes na carne de frango convencional e livre de

antibiótico nos dias 0 e 9 de estocagem a 4ºC, p. 69

ARTIGO III

Tabela 1: Compostos antioxidantes e atividade antioxidante do extrato do resíduo do

pequi (Caryocar brasiliense) e da juçara (Euterpe edulis), p. 99

Tabela 2: Composição centesimal dos tratamentos de carne de frango, p. 100

Tabela 3: Compostos antioxidantes presentes na carne de frango nos dias 0 e 10 de

estocagem a 4ºC, p. 101

ARTIGO IV

Tabela 1: Iniciadores utilizados em estudos anteriores para a detecção (PCR ou multiplex

PCR) e quantificação (qRT-PCR ou multiplex qRT-PCR) de Campylobacter spp. em

produtos de origem animal e a respectiva sequencia amplificada, p. 152

ARTIGO V

Tabela 1: Bactérias usadas no estudo, p. 174

Tabela 2: Concentração inibitória mínima (CIM) e concentração bactericida mínima

(CBM) do extrato do resíduo do pequi, p. 175

16

1 INTRODUÇÃO

A juçara (Euterpe edulis Martius) e o pequi (Caryocar brasiliense Camb. -

Caryocaraceae) são frutas nativas brasileiras, originárias da Mata Atlântica e do Cerrado,

respectivamente (SILVA et al., 2013; RATTER et al., 2003). Ambos apresentam elevada

concentração de compostos antioxidantes, tais como ácidos fenólicos, flavonoides e

carotenoides, apresentando alto potencial antioxidante. Estas frutas são normalmente

comercializadas na forma de polpa, na qual durante o processamento há a produção de resíduos,

os quais são descartados. Visando o aproveitamento dos compostos antioxidantes presentes em

resíduos, novas tecnologias têm sido utilizadas, como o micro-ondas. A extração por micro-

ondas é uma tecnologia verde que vem se destacando e se apresenta como uma metodologia

promissora para a extração de compostos antioxidantes (DAHMOUNE et al., 2015).

Não somente a ação antioxidante, mas também alguns trabalhos relatam que extratos do

pequi apresentam atividade antimicrobiana (AMARAL et al., 2014), atuando não somente na

qualidade sensorial do produto como também na qualidade microbiológica do mesmo,

possibilitando maior segurança alimentar, uma vez que tem a ação em inibir ou retardar o

crescimento de microrganismos, principalmente bactérias deteriorantes e patogênicas, tais

como Staphylococcus aureus, Pseudomonas aeruginosa, E. coli, e Salmonella spp. (PAULA-

JUNIOR et al., 2006). Os compostos responsáveis por essa ação antimicrobiana devem ser

melhor estudados, porém há trabalhos que associam essa atividade aos compostos

antioxidantes, principalmente os ácidos fenólicos (AMARAL et al., 2014). Para se obter

elevada concentração desses compostos é importante ter uma combinação ótima da potência,

tempo e concentração dos solventes. A condição ótima de extração para compostos

antioxidantes pode ser obtida através da metodologia de superfície de resposta (MSR)

(MONTGOMERY, 2004).

Ademais, a aplicação destes extratos em carne de aves é de alto interesse para a indústria

avícola, uma vez que esta carne apresenta alta concentração de ácidos graxos polinsaturados

(PUFAs) e proteínas (CONTINI et al., 2014; NKUKWANA et al., 2014), os quais a caracteriza

como um alimento saudável, no entanto, predispõe os processos oxidativos, promovendo

possíveis alterações no sabor, cor, textura e valor nutritivo dos produtos (CONTINI et al.,

2012). Além de manter as características sensoriais do produto, os extratos também podem

aumentar a validade comercial do mesmo, tendo em vista sua ação antimicrobiana. Desta forma,

a aplicação do resíduo da juçara e do pequi em produtos derivados do frango, é de interesse

17

afim de evitar a oxidação precoce desses produtos, estendendo a validade sensorial e

nutricional, além de proporcionar melhor qualidade de vida aos consumidores pela utilização

de ingredientes naturais.

O objetivo geral do presente estudo foi avaliar a utilização de resíduos provenientes do

processamento da juçara (Euterpe edulis) e do pequi (Caryocar brasiliense) na estabilidade do

processo oxidativo (lipídico e proteico) em carne de frango (Gallus gallus domesticus) de

criação convencional e livre de antibiótico, contribuindo para elaboração de produtos mais

saudáveis e com maior validade comercial. E verificar a atividade antimicrobiana do extrato da

casca do pequi.

18

2 REVISÃO DE LITERATURA

2.1 AVICULTURA

2.1.1 Produção de carne de frango

O Brasil é o segundo maior produtor mundial de frango com produção média de 16%

quando avaliada a produção mundial, ficando apenas atrás dos Estados Unidos da América

(EUA) com média de 21% (AVISITE, 2016). Com qualidade nutritiva e facilidade de preparo

além do preço acessível, o frango é uma das principais opções dos consumidores brasileiros.

Além do consumo nacional, essa proteína é consumida em mais 150 países (CORREIO

BRAZILIENSE, 2017).

O relatório anual de 2016 da Associação Brasiliera de Proteína Animal (ABPA) mostra

que em 2015 a produção brasileira de carne de frango foi de 13,146 milhões de toneladas, sendo

observado um crescimento significativo desde 2006. O destino dessa produção é o mercado

interno em sua maioria (67,3%) e 32,7% para exportação. Sendo o consumo per capita de frango

em 2015 de 43,25kg por habitante e 4304 mil toneladas exportadas em 2015, colocando o Brasil

como o maior exportador dessa matriz (ABPA, 2017). Conforme levantamento realizado pelo

IBGE, referente ao quarto trimestre de 2016, os abates de frango em estabelecimentos sob

inspeção aumentaram em 1,11%, resultando num aumento de 0,77% da produção dessa carne

quando comparado à 2015 (AVISITE, 2017).

A cadeia produtiva de carne de frango apresenta significativa transformação desde a

década de 1980, apresentando ganhos de produtividade e abertura de novos mercados. Vem

sendo obrigada a modernização das indústrias processadoras e dos elos dessa cadeia produtiva

devido às mudanças na economia nacional e internacional (SILVA; SAES, 2005; VOGADO et

al., 2016). É importante e de interesse para a indústria a implementação de novas tecnologias.

2.1.2 Criação de frango livre de antibiótico

Nesse tipo de criação, nenhum antimicrobiano é fornecido aos animais, nem mesmo

como terapêuticos, ou como melhoradores de desempenho; além dessa classe também não são

administrados quimioterápicos ou anticoccidianos. As aves são criadas em galpões fechados

com densidade de 12 frangos por metro quadrado, com ambiente controlado. As matérias-

19

primas da ração são adquiridas diretamente com os produtores, como por exemplo milho e soja,

e nenhuma proteína de origem animal é utilizada na elaboração. Para manter e promover a saúde

dos animais são utilizados meios naturais, como por exemplo, extratos vegetais, probióticos,

óleos essenciais e ácidos orgânicos. A certificação desses animais é realizada de acordo com as

Normas para Produção, Abate e Controle Laboratorial de Frango Certificado Alternativo,

emitidas pela Associação da Avicultura Alternativa – AVAL (KORIN, 2017).

Na criação convencional de frango as aves são criadas em galpões e densidade média

de 12 frangos por metro quadrado, similar à criação livre de antibiótico, porém, esses animais

são tratados terapeuticamente com antimicrobianos quando há a necessidade (EMBRAPA,

2008). Desta forma, não são utilizados prioritariamente extratos vegetais, óleos essenciais, entre

outros meios naturais. Os meios mencionados podem ser fontes de antioxidantes e interferir no

processo oxidativo post mortem (AHMED et al., 2015; FENG et al., 2016; FERREIRA et al.,

2017; FRASAO et al., 2017; NKUKWANA et al., 2014). Assim, a carne de aves criadas da

forma convencional pode apresentar maior oxidação do que aquelas criadas livre de antibiótico.

2.2 PROCESSO OXIDATIVO EM CARNE DE AVES

A carne de aves apresenta elevado teor de ácidos graxos poli-insaturados (PUFAs),

atribuindo a elas um elevado valor nutricional (RIBEIRO et al., 2014), uma vez que o consumo

de produtos com elevado teor deste composto reduz o risco de doenças cardiovasculares, inibe

o crescimento de tumores da glândula mamária e da próstata, retarda a perda das funções

imunológicas, e é exigido para o desenvolvimento do cérebro fetal (AZCONA et al., 2008). Em

contrapartida, o alto teor de PUFAs predispõe à oxidação lipídica, sendo este tipo de carne e

seus produtos mais susceptível a oxidação do que carne bovina e suína (CASTRO; MARIUTTI;

BRAGAGNOLO, 2011; CONTINI et al., 2014; PENKO et al., 2015), pois os PUFAs

depositados nos lipídios polares são responsáveis pela oxidação lipídica (ERICKSON, 2008).

A rancificação oxidativa é uma das maiores causas de deterioração de carne de aves

(SEBRANEK et al., 2005).

As oxidações lipídica e proteica são uma das causas de deterioração e redução da

validade em produtos cárneos. Na oxidação lipídica são observadas alterações nos parâmetros

de qualidade da carne como cor, sabor, aroma, textura e também valor nutricional (CONTINI

et al., 2012). Esse processo inicia na fração dos ácidos graxos insaturados e forma

hidroperóxidos, os quais são susceptíveis à oxidação (RADHA KRISHNAN et al., 2014). As

20

proteínas são compostos complexos, dos quais uma grande quantidade de produtos de reações

podem ser formados por diversos mecanismos (SMET et al., 2008). A oxidação proteica, que é

o componente em maior quantidade no sistema cárneo, tem recebido pouca atenção. Nesse

processo ocorre a modificação covalente da proteína induzida diretamente por reações

específicas, ou indiretamente, por reações com produtos secundários do estresse oxidativo

(SOLADOYE et al., 2015). O desequilíbrio redox e a oxidação precoce das proteínas estão

relacionados à segurança e qualidade da carne (CARVALHO et al., 2017). Trabalhos mostram

que a oxidação em carne e produtos cárneos pode ser controlada ou minimizada através da

utilização de antioxidantes sintéticos ou aditivos naturais (MIELNIK et al., 2006; CASTRO;

MARIUTTI; BRAGAGNOLO, 2011; GALLO; FERRACANE; NAVIGLIO, 2012;

JAYAWARDANA et al., 2015).

As oxidações são consideradas responsáveis por reduzir a qualidade da carne durante o

processamento, cozimento e estocagem; levando a formação de um sabor não apreciado e ranço

(GALLO; FERRACANE; NAVIGLIO, 2012). O desenvolvimento de odores e sabores

desagradáveis, alteração negativa da cor, aparência e aceitabilidade de produtos cárneos são

consequências da oxidação lipídica (JAYASENA; JO, 2013). A oxidação lipídica e os

pigmentos do músculo são os principais parâmetros de qualidade da carne com relação a

deterioração. Lipídios e proteínas são alvos de espécies reativas de oxigênio (ROS) (GALLO;

FERRACANE; NAVIGLIO, 2012). Quando os lipídios insaturados oxidam, eles formam

hidroperóxidos, que são suscetíveis à oxidação e à decomposição de produtos de reações

secundárias, tais como cetonas, álcoois, aldeídos e ácidos (MARSILI; LASKONIS, 2014). A

qualidade, o valor nutricional, o aroma e o sabor desses alimentos podem ser afetados por esses

compostos (JAYASENA; JO, 2013). A interação das ROS com as proteínas na carne promove

a formação de carbonila e diminui o teor de sufidril das proteínas, que também alteram a

qualidade do produto (LUND et al., 2011).

Na indústria de alimentos, a radiação UV-C é aplicada para aumentar a segurança e

estender a validade dos produtos (CICHOSKI et al., 2015). Porém, dependendo do tempo de

exposição e da dose de irradiação essa tecnologia pode aumentar a oxidação, a qual afeta a

qualidade sensorial e nutricional da carne de aves (CHEN et al., 2011). Dependendo da dose de

irradiação, maior é o aumento da oxidação (CHUN et al., 2010; JONGBERG et al., 2013).

Todavia, o processo oxidativo, dos lipídios e das proteínas, aumenta durante a estocagem, e

pode ser reduzida aplicando antioxidantes nos produtos cárneos, permitindo o retardo da

deterioração, aumento da validade e manutenção da qualidade e segurança deste alimento

21

(DEVATKAL; NAVEENA, 2010). Portanto a aplicação de antioxidantes é considerada uma

alternativa tecnológica para manter as propriedades nutricionais e a qualidade durante o

processamento e estocagem (MARIUTTI et al., 2008). Extratos de plantas apresentam elevado

teor de fenólicos e proporcionam uma excelente alternativa aos antioxidantes sintéticos (SHAH;

BOSCO; MIR, 2014).

2.3 ANTIOXIDANTES

Antioxidantes são substâncias que inibem a oxidação no corpo humano e em produtos

alimentares, que em concentrações baixas retardam a oxidação de moléculas facilmente

oxidáveis, como lipídios e proteínas em produtos cárneos, aumentando a validade comercial

devido a proteção da deterioração causada pela oxidação (KARRE; LOPEZ; GETTY, 2013).

Os antioxidantes podem agir através da supressão da formação de espécies reativas de oxigênio

(ROS) através da inibição de enzimas, ou elementos traços de quelantes envolvidos na formação

de radicais livres, eliminação de ROS e ainda pela proteção das defesas antioxidantes (XIAO

et al., 2011). Compostos considerados antioxidantes típicos incluem a classe de fenóis, ácidos

fenólicos e seus derivados, flavonoides, tocoferóis, fosfolipídios, aminoácidos, ácido fítico,

ácido ascórbico, pigmentos e esteróis (ROESLER et al., 2007; RUFINO et al., 2010). Os

fenólicos apresentam-se como componentes com alta atividade antioxidante e de grande

importância e interesse na aplicação tecnológica e funcional (PAREDES-LÓPEZ et al., 2010).

Esses compostos apresentam um ou mais anéis aromáticos ligados a um grupo hidroxila e

podem ser classificados, devido às características estruturais, em ácidos fenólicos, flavonoides,

taninos, estilbenos e lignanas (HAN; SHEN; LOU, 2007; SEERAM, 2008).

A atividade antioxidante dos compostos fenólicos é atribuída primeiramente à sua

capacidade redox, a qual permite que ele neutralize ou absorva os radicais livres, elimine o

oxigênio livre, ou decomponha peróxidos; promovendo assim a inibição da degradação de

formas oxidantes ativas (HWANG et al., 2015). No grupo dos taninos estão os polifenóis

solúveis em água, com peso molecular variando entre 500 a 3.000 unidades de massa atômica

e são subdivididos em taninos condensados e hidrolisados. São encontrados, normalmente,

complexados com alcaloides, polissacarídeos e proteínas. Estruturalmente os taninos

hidrolisados são divididos em dois grupos, os galotaninos e os elagitaninos (HAN; SHEN;

LOU, 2007). Metabolito secundário dos vegetais, presente em quase todas as partes em

crescimento, os flavonoides são classificados como os mais abundantes pigmentos, juntamente

22

com a clorofila e os carotenoides (STALIKAS, 2007). A composição básica dos flavonoides

consiste em dois anéis aromáticos ligados a uma estrutura com três carbonos, e é denominado

1,3-difenilpropano. Routray; Orsat (2012) citam em sua revisão trabalhos que determinam

como sendo as classes de flavonoides mais abundantes em alimentos as flavonas, isoflavonas,

flavononas, flavanodiols, antocianinas, proantocianidinas e catequinas. Este grupo é derivado

da combinação dos produtos da via chiquimato e da reação da acetilCoA carboxilase. O ácido

chiquimico é formado pelos carbohidratos no ciclo de Calvin e então são convertidos nas

fenilalaninas que, pela via fenilpropanóide, são convertidas em comarilCoA. Na reação da

acetilCoA carboxilase há a conversão de acetilCoA em malonilCoA. As chalconas são

formadas pela combinação do malonilCoA e comarilCoA, e então são formadas as diferentes

classes de flavonoides (CHEN et al., 2011; WANG; CHEN; YU, 2014; YANG et al., 2015).

Em geral a fonte alimentar de flavonoides são os vegetais. Routray; Orsat (2012) apontam em

sua revisão artigos que determinam folhas, cascas de frutos, caules e o revestimento das

sementes como sendo as partes da planta com maior teor de flavonoides, já que a síntese destes

sofre influência da luz solar.

Os extratos vegetais estão entre as mais importantes fontes de polifenóis na dieta. Ervas,

legumes, frutas, cerveja e vinho são fontes de compostos fenólicos (HILGEMANN et al., 2013).

No Brasil são encontradas várias espécies de frutas nativas e exóticas de potencial interesse

para a agroindústria, porém com sub aproveitamento, principalmente de seus resíduos, podendo

ser consideradas boas fontes de compostos bioativos (RUFINO et al., 2010).

Profissionais da saúde humana e consumidores contestam a segurança de aditivos

sintéticos, como os antioxidantes sintéticos amplamente empregados na indústria da carne,

levando a buscar alternativas naturais, como os antioxidantes naturais (JAYAWARDANA et

al., 2015). Ainda, maior eficácia para a inibição da oxidação lipídica tem sido observada nos

antioxidantes naturais comparado aos aditivos artificiais (SEOL et al., 2011; HWANG et al.,

2015). A utilização de extratos de vegetais com a finalidade de aumentar a validade de produtos

cárneos é uma alternativa promissora para a prevenção da oxidação (GALLO; FERRACANE;

NAVIGLIO, 2012). As frutas juçara e pequi apresentam-se como potenciais fontes de

antioxidantes naturais tanto para cuidados com a saúde e também como aditivos naturais para

alimentos para o desenvolvimento de novos produtos funcionais (ROESLER et al., 2008;

BORGES et al., 2013; BICUDO; RIBANI; BETA, 2014; RIBEIRO et al., 2014).

23

2.4 ANTIMICROBIANOS

Antimicrobianos são substâncias que inibem o crescimento ou desenvolvimento de

microrganismos ou causam a sua morte, podendo ser administrados como terapia, porém

algumas substâncias com essas características são utilizadas como conservantes em alimentos

(PAULA-JUNIOR et al., 2006). A ação antimicrobiana pode ser observada em compostos

naturais. Essa atividade contra os microrganismos foi atribuída por Amaral et al. (2014) aos

compostos polifenóis, tais como flavonoides, presentes em elevada concentração no pequi.

Conforme descrito por Cushine e Lamb (2006), os flavonoides podem interagir com a

membrana citoplasmática dos microrganismos, comprometendo a integridade celular, além

disso, podem inibir a síntese de ácidos nucléicos, interferindo no desenvolvimento bacteriano.

Mazumder; Kumria; Pathak (2014) observaram eficiente ação tanto em bactérias quanto em

fungos quando utilizados antimicrobianos naturais.

A substituição dos antimicrobianos sintéticos por naturais é de grande interesse da

indústria alimentícia (PAULA-JUNIOR et al., 2006) devido ao aumento da resistência

microbiana contra agentes convencionais. Agentes antimicrobianos sintéticos tem se mostrado

ineficientes na terapêutica, para desinfecção de superfícies e como conservantes em alimentos,

principalmente devido a presença de bactérias muito resistentes, dificultando o tratamento de

enfermidade, a higienização de superfícies e equipamentos na indústria de alimentos, bem como

a conservação de alguns alimentos (TIWARI et al., 2009). A estrutura química dos agentes

antimicrobianos derivados de plantas difere dos sintéticos, portanto os antimicrobianos naturais

podem conseguir regular o metabolismo intermediário do patógeno, por alteração na estrutura

da membrana, e ainda por ativação ou inibição de reações enzimáticas (MICHELIN et al.,

2005).

Considerando o aumento de patógenos multirresistentes, é de suma importância

verificar potenciais fontes de antimicrobianos naturais, determinando a sua atividade e ação

sobre esses microrganismos, principalmente aqueles contaminantes em alimentos. A utilização

de substâncias antimicrobianas naturais extraídas de plantas pode ser considerada uma

alternativa contra bactérias multirresistentes (PAULA-JUNIOR et al., 2006; AMARAL et al.,

2014).

2.5 FRUTAS NATIVAS E COMPOSTOS NATURAIS

24

Profissionais da saúde humana e consumidores contestam a segurança de aditivos

sintéticos, como os antioxidantes sintéticos amplamente empregados na indústria da carne,

levando a buscar alternativas naturais (JAYAWARDANA et al., 2015). Ainda, maior eficácia

para a inibição da oxidação lipídica tem sido observada nos antioxidantes naturais comparado

aos aditivos artificiais (SEOL et al., 2011; HWANG et al., 2015). A utilização de extratos de

vegetais com a finalidade de aumentar a validade de produtos cárneos é uma alternativa

promissora para a prevenção da oxidação (GALLO; FERRACANE; NAVIGLIO, 2012). Os

frutos pequi e juçara apresentam-se como uma potencial fonte de antioxidantes e

antimicrobianos naturais tanto para cuidados com a saúde e também como um aditivo natural

para alimentos para o desenvolvimento de novos produtos funcionais (RUFINO et al., 2010;

BORGES et al., 2013; BICUDO; RIBANI; BETA, 2014; FRASAO et al., 2017).

2.5.1 Euterpe edulis (juçara)

O palmito de juçara (Euterpe edulis M.) é uma planta nativa brasileira, originária da

Mata Atlântica, e sua fruta é considerada uma rica fonte de antioxidantes. As frutas da juçara

são globosas e crescem em cachos, sua semente é dura e coberta por pericarpo; variam entre 1

a 1,5cm de diâmetro. Quando não estão maduras elas apresentam um epicarpo verde, e quando

maduras apresenta-se na cor violácea escura ou até preta. Essa pigmentação é devido ao alto

teor de antocianinas (BICUDO; RIBANI; BETA, 2014).

A polpa da juçara possui elevada capacidade antioxidante e essa capacidade é atribuída

principalmente às antocianinas. Bicudo; Ribani; Beta (2014) encontraram atividade

antioxidante na fruta de juçara pela técnica de captura de radical livre (DPPH) variando de

745,32 μmolTE.gDM-1 a 655,89 μmolTE.gDM-1; e pela técnica de capacidade de absorção do

radical oxigênio (ORAC) variando de 1088,10 μmolTE.gDM-1 a 2,071,55 μmolTE.gDM-1. Com

relação ao teor de compostos fenólicos totais os valores encontrados na fruta variam entre 49.09

mgGAE.gDM-1 e 81,69 mgGAE.gDM-1 (BICUDO; RIBANI; BETA, 2014), 7,97 mgGA.gFM-

1 a 52,25 mgGA.gFM-1 (BORGES et al., 2011), 38,45 mgGAE.gDM-1 a 55,71 mgGAE.gDM-1

(VIEIRA et al., 2013); e na polpa variam entre 2,2 µg.mL-1 a 110 µg.mL-1 (FELZENSZWALB

et al., 2013), e 7,72 mgGAE.100g-1 (SILVA et al., 2013). Os teores de flavonoides encontrados

na fruta variam de 17,59 mgQE.100gFM-1 a 36,34 mgQE.100gFM- (BORGES et al., 2011). As

antocianinas estão presentes em concentrações variando de 91,52 mgC-3-GE.100gDM-1 a

236,19 mgC-3-GE.100gDM-1 em frutas (BICUDO; RIBANI; BETA, 2014), e 14,84 mgC-3-

25

GE.100gFM-1 a 409,85 mgC-3-GE.100gFM-1 (BORGES et al., 2011); na polpa variam entre

3,89 mgC-3-GE.100gDM-1 a 13,35 mgC-3-GE.100gDM-1 (VIEIRA et al., 2013), e 667,05

mgC-3-QE.L-1 (SILVA et al., 2013). Os ácidos fenólicos já identificados na juçara são ácido

gálico, protocatecoico, p-hidroxibenzoico, vanílico, siringico, ferrúlico, benzoico, caféico,

clorogênico, p-comarico (BORGES et al., 2011; BORGES et al., 2013; BICUDO; RIBANI;

BETA, 2014). Os flavonoides já identificados na fruta da juçara são as catequinas,

epicatequinas, rutin e quercetin (BORGES et al., 2011; BORGES et al., 2013). As principais

antocianinas já detectadas em maior concentração são cianidina-3-glicosideo (C-3-G) e

cinidina-3-rutinosideo (C-3-R), em menores níveis também foram identificaas cianidina, 3,5-

diglicosideo (C-3,5-dG), pelargonidina-3-glicosideo (Pl-3-G), pelargonidina-3-rutinosideo (Pl-

3-R), peonidina-3-glicosideo (Po-3-G), cianidina-3-sambubiosideo (C-3-S), cianidina-3-

raminosideo (C-3-R) (de BRITO et al., 2007; BICUDO; RIBANI; BETA, 2014).

2.5.2 Caryocar brasiliense (pequi)

O pequi (Caryocar brasiliense) é uma fruta nativa brasileira do Cerrado, apresenta-se

na forma de uma fruta verde esférica, composta por um epicarpo muito fino, um mesocarpo

externo e um mesocarpo interno, que envolve um fino e rígido endocarpo com espinhos e um

caroço com uma amêndoa (DAMIANI et al., 2009; ASCARI et al., 2010). Normalmente é

utilizada com propósito gastronômico e nutricional, elaboração de cosméticos e medicina

tradicional para tratamento de resfriados, edema, bronquites, queimaduras e tosse (FARIA-

MACHADO et al., 2015). Além disso, esse fruto tem ação anti-inflamatória, antimicrobiana e

protetora no genoma e danos oxidativos nas células (FARIA; DAMASCENO; FERRARI,

2014). Estudos apontam o efeito cicatrizante do óleo de pequi para o tratamento de feridas e

úlceras gástricas, o efeito anti-inflamatório, hipocolesterolêmico e hipotensor do óleo da polpa

(MIRANDA-VILELA et al., 2009), o efeito hipotensor do fruto (OLIVEIRA et al., 2012), o

efeito antioxidante do óleo e do extrato da polpa (AGUILAR et al., 2012; MACHADO;

MELLO; HUBINGER, 2013). Além dos efeitos na saúde, o extrato do pequi apresenta

atividade antioxidante que foi correlacionada à presença de compostos fenólicos, flavonoides e

carotenoides (ROESLER et al., 2007, 2008). Portanto a casca do pequi pode ser considerada uma

fonte de antioxidante natural, uma vez que ela é considerada resíduo no processamento da fruta.

Atualmente, além da preocupação com a promoção da saúde, a preocupação com a

sustentabilidade tem sido fonte de muitos estudos, principalmente relacionados a processos

26

industriais que geram resíduos. A casca e o mesocarpo externo do pequi somam 70% do fruto

(ASCARI et al., 2010) e são descartados como resíduo ou subaproveitados para elaboração de

sabão ou adubo.

2.6 ANÁLISE POR SUPERFÍCIE DE RESPOSTA

As análises por superfície de resposta são um conjunto de análises estáticas e técnicas

matemáticas baseadas no ajuste de uma equação polinomial para os dados experimentais

(BEZERRA et al., 2008), que permitem o aperfeiçoamento e otimização de processos, nos quais

a resposta de interesse é influenciada por independentes variáveis, também denominadas fatores

(MONTGOMERY, 2004). Em sua revisão, Bezerra et al. (2008) informa que são empregadas

funções lineares e quadráticas para descrever o sistema estudado para explorar as condições

experimentais até obter a otimização. Para a aplicação da técnica é necessário discriminar as

variáveis, escolher o desenho experimental, aplicar o tratamento matemático, avaliar os

modelos gerados, verificar a necessidade de tendência para a região ótima e obtenção do valor

ótimo de cada variável (BEZERRA et al., 2008). Estudos anteriores documentam que o tipo de

solvente, a temperatura de extração, o tempo de extração, a razão sólido e líquido e a potência

do micro-ondas influenciam na extração por micro-ondas de moléculas antioxidantes de frutas

(BORGES et al., 2011; VIEIRA et al., 2013; DAIRI et al., 2015).

2.7 EXTRAÇÃO POR MICRO-ONDAS

As micro-ondas estão localizadas entre a menor frequência da faixa de rádio e maior

frequência no infravermelho, no espectro eletromagnético; são consideradas ondas

eletromagnéticas não ionizantes. Possuem alta penetração a 915MHz, tendo grande aplicação

para a indústria as faixas de 300MHz a 300GHz (ROUTRAY; ORSAT, 2012). A equação de

Maxwell rege a distribuição de energia das ondas eletromagnéticas não ionizantes, que é

definida pelas configurações do sistema e a interface entre o material a ser tratado e o espaço

restante. Os principais parâmetros nessa equação são as propriedades dielétricas das amostras

(CHANDRASEKARAN; RAMANATHAN; BASAK, 2013). As propriedades dielétricas de

um material são descritas pela seguinte equação:

𝜀 = 𝜀′ − 𝑗𝜀", onde 𝑗 = √(−1)

27

O 𝜀′ é a constante dielétrica que reflete a capacidade do material de armazenar energia

elétrica em campo de energia eletromagnética; 𝜀" é o fator dielétrico de perda, que influencia a

conversão da energia eletromagnética em energia térmica. Um outro parâmetro importante é a

tangente do ângulo de perda (tan 𝜎𝑒 = 𝜀′ 𝜀" ⁄ ), que junto com a constante dielétrica, determina

a atenuação da potência de micro-ondas na matriz biológica. Em campo de energia magnética,

o valor de perda do fator 𝜀" é proporcional à quantidade de energia convertida em calor na

matriz biológica (CHANDRASEKARAN; RAMANATHAN; BASAK, 2013).

O método de extração por micro-ondas opera utilizando a energia de micro-ondas para

aquecer eficazmente os solventes polares que estão em contato com as amostras sólidas, e com

isso, compartilhar compostos de interesse entre amostra e solvente (BALLARD et al., 2010;

PÉREZ-SERRADILLA; LUQUE DE CASTRO, 2011). Essa tecnologia verde vem se

destacando como uma tecnologia promissora para a extração de fenólicos totais, flavonoides,

antocianinas e taninos de frutas como Myrtus communis, Pistacia lentiscus, Curcuma longa,

Solanum lycopersicum e uva Tintilla de Rota (LIAZID et al., 2011; LI et al., 2012;

DAHMOUNE et al., 2014, 2015; LI; NGADI; MA, 2014; DAIRI et al., 2015). A metodologia

de extração por micro-ondas apresenta alta eficiência de extração, baixo consumo de energia e

solvente, redução no tempo de extração (LI; NGADI; MA, 2014; DAHMOUNE et al., 2015).

Em métodos convencionais necessita-se de muito solvente, longo tempo de extração e o risco

de degradação dos constituintes termolábeis é maior, enquanto que na extração por micro-

ondas, devido à utilização de recipientes fechados com pressão controlada, permite-se a

utilização de temperaturas acima do ponto de ebulição do solvente, encurtando o tempo de

extração e aumentando a eficiência (BALLARD et al., 2010). Uma alternativa é a utilização de

novas técnicas para extração de substâncias naturais, com utilização de menos solvente e menos

energia. O efeito da extração por micro-ondas sobre a composição e quantidade das moléculas

bioativas de interesse dependente de vários fatores (LI et al., 2012). A melhor combinação de

potência, tempo e concentração de solvente utilizados a fim de obter a melhor extração desses

compostos é de extrema importância visando a eficiência de utilização de energia, e

minimizando o uso de solventes e amostras (DAHMOUNE et al., 2015).

28

3 DESENVOLVIMENTO

3.1 ARTIGO I

O artigo intitulado “Natural Antioxidant Activity and Compounds Content from Wastes

of Euterpe edulis Berries” está publicado na revista Journal of Agricultural Science.

Journal of Agricultural Science; Vol. 9, No. 3; 2017

ISSN 1916-9752 E-ISSN 1916-9760

Published by Canadian Center of Science and Education

Natural Antioxidant Activity and Compounds Content from Wastes of Euterpe

edulis Berries

Beatriz da Silva Frasao1,2, Marion Pereira da Costa1,3, Bruna Leal Rodrigues1, Bruno Reis Costa Lima1

& Carlos Adam Conte-Junior1,3

1 Department of Food Technology, Faculdade de Veterinária, Universidade Federal Fluminense, Rio de

Janeiro, Brazil

2 Department of Epidemiology and Public Health, Instituto de Veterinária, Universidade Federal Rural do

Rio de Janeiro, Rio de Janeiro, Brazil

3 Food Science Program, Instituto de Química, Universidade Federal do Rio de Janeiro, Rio de Janeiro,

Brazil

Correspondence: Marion Pereira da Costa, Department of Food Technology, Faculdade de Veterinária,

Universidade Federal Fluminense, Rua Vital Brazil Filho, n. 64. Santa Rosa, 24230-340, Rio de Janeiro,

Brazil. Tel: 55-21-2629-9545. E-mail: [email protected]

Received: December 31, 2016 Accepted: January 20, 2017 Online Published: February 15, 2017

doi:10.5539/jas.v9n3pxx URL: http://dx.doi.org/10.5539/jas.v9n3pxx

The research is financed by Juçaí Industry (Juçaí®, Rio de Janeiro, Brazil); Fundação de Amparo à

Pesquisa do Estado do Rio de Janeiro (processes E-26/201.185/2014 and E-26/010.001.911/2015,

FAPERJ, Brazil); Conselho Nacional de Dessenvolvimento Científico e Tecnológico (process

311361/2013-7 and 400136/2014-7, CNPq, Brazil); Coordenação de Aperfeiçoamento de Pessoal de

Nível Superior (process 125, CAPES/Embrapa 2014, CAPES, Brazil).

Abstract

The Euterpe edulis (Juçara) is native to Brazil, which berries and wastes present high antioxidant content.

Therefore, in this study, microwave-assisted extraction (MAE) was investigated for antioxidant compounds

extraction from E. edulis waste and maximized antioxidant activities using response surface methodology

coupled with a central composite design. Three factors were observed: microwave power (400/500/600 W),

exposition time (30/60/90 sec) and ethanol concentration solvent (40/60/80%). The extracts were

characterized by determination of total phenolic (TPC), flavonoids (TFC), monomeric anthocyanins (TAC),

tannins content (TTC), and in vitro antioxidant assay (AA%). The yield of TPC, TFC, TAC, and TTC

varied at 595.43-2171.34 mg GAE∙100 g DM-1, 137.36-251.24 mg QE∙100 g DM-1, 179.32-354.38 mg C-

3-GE∙100 g DM-1 and 0.23-1.00 µg TAE∙100 g DM-1, respectively. The optimal MAE parameters for TPC

was microwave power 668.18 W, exposition time 110.45 s and aqueous ethanol concentration 93.64%, for

TFC same parameters observed; though for TAC the different parameters were 532.28 W, and for TTC

9.55 s. However, for antioxidant activity, the parameters were 668.18 W, 110.45 s time and 64.41% of

29

aqueous ethanol solvent. Therefore, this methodology was successfully applied for optimal extraction of

total phenolics, flavonoids, monomeric anthocyanins and tannins from juçara waste and obtain optimal

antioxidant activity.

Keywords: anthocyanin, β-carotene bleaching, flavonoid, microwave-assistant extraction, phenolic, RSM

optimization, tannin

1. Introduction

The Juçara palm (Euterpe edulis Martius; Arecaceae), a native plant of Brazilian Atlantic Forest, is widely

distributed in Brazil. Mature berries from this plant exhibit a violaceous and globose shape, which are

accepted by consumers (Silva et al., 2013). Juçara fruit is commercialized in the form of pulp or juice.

During the processing of E. edulis pulp, the seeds with endocarp and epicarp are discarded as waste (Bicudo,

Ribani, & Beta, 2014). The violaceous color of E. edulis pulp can be related to the presence of anthocyanins,

which belong to the group of flavonoids (Cavalcanti, Santos, & Meireles, 2011). In addition, other bioactive

molecules including phenolic acids, flavonoids, and tannins were also identified in juçara berries (Bicudo

et al., 2014; Borges et al., 2013; Borges et al., 2011; Rufino, Alves, Fernandes, & Brito, 2011), which is

associated with high antioxidant capacity (Rufino et al., 2011). In addition, Garcia-Mendoza et al (2017)

demonstrate that industrial residue of juçara presented high concentration of phenolic acids and

anthocyanins. In recent years, the use of plant extracts, mainly extract of their waste processing, have gained

notable interest in the food industry (Ertas et al., 2015). This fact is related to the search for new therapeutic

and preventive agents, as natural antioxidants, for amendments and illness, Alzheimer's disease, and cancer

(Zengin, Sarikurkcu, Aktumsek, & Ceylan, 2014).

Natural antioxidants agents present high attention in recent years for their bioactivity and safety (Lu, Qin,

Han, Wang, & Li, 2015). The ingestion of this compounds is stimulated by potential neutralization effect

on the toxicity of oxidative processes or prevention of prooxidant formation during digestion (Manganaris,

Goulas, Vicente, & Terry, 2014; Rahal et al., 2014), which can contribute to reducing or prevent the

aforementioned illness. Furthermore, fruits with high antioxidant capacity, such as juçara (Borges et al.,

2013) are potential source of bioactive molecules that can be a technological alternative for food industry

to prevent the oxidation, providing an increased in food shelf life (Manganaris et al., 2014; Ortega-Ramirez

et al., 2014; Tadapaneni, Daryaei, Krishnamurthy, Edirisinghe, & Burton-Freeman, 2014). Therefore, the

use of natural antioxidants capable of hindering oxidative processes responsible for losses in the

organoleptic characteristics and the nutritional value of food is highly relevant for the food industry (Contini

et al., 2014). However, the extraction of natural antioxidants compounds is still critical (Santos, Veggi, &

Meireles, 2010), where the evaluation of efficacy and efficiency of each extraction method is extremely

important.

Several studies evaluated the influence of the extraction method on different matrices for the isolation of

antioxidant compounds (Da Silva Campelo Borges et al., 2011; Dairi et al., 2015; Espinosa-Pardo,

Martinez, & Martinez-Correa, 2014; Kukula-Koch et al., 2013; Li, Ngadi, & Ma, 2014). Nonetheless,

different approaches and applications do not always provide the same results. Hence, the optimization

processing is required (Santos et al., 2010). The optimum combination of power, exposition time, and

concentration of extracting solvent to obtain the highest concentration of these compounds is extremely

important to ensure efficient utilization of energy, solvents, and food matrix. In this way, microwave-

assisted extraction (MAE), an emerging green technology, have demonstrated to be a promising method

for the recovery of bioactive compounds such as total phenolics, flavonoids, anthocyanins, and tannins

from plants. (Dahmoune et al., 2014; Dahmoune, Nayak, Moussi, Remini, & Madani, 2015; Dairi et al.,

2015; Kim et al., 2012; Li et al., 2012, 2014; Zeković, Vladić, Vidović, Adamović, & Pavlić, 2016).

Although, to the best of our knowledge the MAE has not been used for extraction of natural antioxidant

compounds from E. edulis.

Moreover, response surface methodology (RSM) can be used to optimize the extraction of natural

antioxidant. The RSM is the combination of statistical and mathematical techniques which allow the

improvement and optimization of processes. In this methodology, the response of interest is influenced by

the independent variables or factors (Montgomery, 2004). Previous studies documented that the type of

solvent, the temperature of extraction, exposition time, solid to liquid ratio, and microwave power influence

the extraction of antioxidant molecules from fruits by MAE (Borges et al., 2011; Dairi et al., 2015). In this

context, the aim of the present study was to utilize the antioxidants (total phenolic, flavonoids,

30

anthocyanins, and tannins) present in the waste of pulp juçara processing. Besides, optimize the extraction

of these compounds by MAE on the solid waste obtained during juçara berry processing applying RSM.

Thereunto, three independent variables, microwave power (W), time exposition (s), and concentration of

ethanol (%), were evaluated.

2. Materials and Methods

2.1 Chemicals and Reagents

Ethyl alcohol 200 Proof (C3H3C2H2OH; cat. ER0515-002) was purchased from Tedia Brasil (Rio de

Janeiro, RJ, Brazil); gallic acid (cat. 398225), tannic acid (cat. 403040), quercetin (cat. 4951), Folin-

Ciocalteu’s phenol reagent (F9252), aluminum chloride (AlCl3; cat. 06220), poly(vinylpolypyrrolidone)

(PVPP; cat. 77627), potassium chloride (KCl; cat. 60130), sodium acetate (CH3COONa∙3H2O; cat. 32318),

and potassium acetate (CH3COOK; cat. 236497) were purchased from Sigma Chemical Co. (St. Louis, MO,

USA). Whereas, sodium carbonate (Na2CO3) was purchased from Reagen (Rio de Janeiro, RJ, Brazil).

2.2 Plant Material

Juçara (Euterpe edulis) berries wastes (epicarp and endocarp) were supplied by Juçaí Industry (Juçaí®, Rio

de Janeiro, Brazil; 22°24′44″ S, 42°57′56″ W) in May 2015. Wates were air dried at 24 °C until constant

weight (48 h), and then ground utilizing a manual burr grinder MSS-1B (Hario, Tokyo, Japan). Ground

samples were sieved through a 250 Mesh screen as particle size affects the extractability of bioactive

molecules (Shao et al., 2014). All samples were stored at -20 °C until further analysis.

2.3 Experimental Design

The optimal extractions conditions can be obtained by the ratio of responses based on variables in the

process through the Response surface methodology (RSM) (Karacabey & Mazza, 2010). A central

composite design was utilized to determine the optimized condition in MAE extraction of total phenolic

content (TPC), total flavonoids content (TFC), total monomeric anthocyanin content (TAC), total tannins

content (TTC) and antioxidant activity from the juçara waste; non-coded and coded factors (microwave

power, exposition time, and solvent concentration) are exhibited in Table 1. Although several factors such

as microwave power, microwave temperature, exposure time, composition of solvent, solids to solid ratio

and extraction cycles, can affect the extraction efficiency in MAE, studies show as the main independent

variables microwave power, exposure time and solvent concentration (Li et al., 2012, 2013; Zeković et al.,

2016). To predict the optimal conditions of the extraction process experimental design software (Minitab®

17.1.0, USA) package was used for the regression analysis of the data to fit a second-order polynomial

equation (Equation 1) for the regression analysis of the data.

(1)

Where, TPC, TFC, TAC, and TTC values denote Y1, Y2, Y3, and Y4, respectively; whereas the three

independent variables (or factors) were microwave power (X1), exposition time (X2), and ethanol

concentration (X3). β0 is the model constant, βi is the linear coefficient, βii is the quadratic coefficient, βij is

the two factors interaction coefficient, and Xi and Xj are independent variables (factors) level. According to

the analysis of variance (ANOVA), the regression coefficients of individual linear, quadratic and interaction

terms were determined.

2.4 Microwave-Assisted Extraction (MAE)

MAE present advantages compared with conventional extraction, which is considered a green technology

(Zeković et al., 2016). Powder of Juçara waste was subjected to MAE utilizing a DGT 100 Plus system

(Provecto Analytics Ltd., Jundiaí, SP, Brazil) for antioxidant extraction. Briefly, 500 mg of waste were

added to 25 mL of aqueous ethanol solution, sealed into the extraction vessels, and subjected to extraction

protocol following the experimental design (Table 1). After each extraction, the vessels were centrifuged

at 1,400 × g for 10 min at 4 ºC and cooled to 25 ºC. The precipitate was re-extracted with an additional 25

mL of the same ethanol solution and at the same MAE conditions; the supernatants were pooled and stored

in amber vials at 4 ºC.

2.5 Determination of Total Phenolic Content (TPC)

TPC of the extracts of E. edulis waste was estimated based on Folin-Ciocalteu method described by

Ainsworth & Gillespie (2007). The absorbance value at 765 nm was recorded using a Spectrophotometer

3 3 2 2 3

0 1 1 1 1i i i i ii i i j i ij i jY

31

UV-1800 (Shimadzu Corporation, Kyoto, Japan) and the results were calculated based on a calibration

curve of gallic acid (0.00-1.25 mg L-1). The results were expressed as mg gallic acid equivalent (GAE) per

100 g of dry matter (DM).

2.6 Determination of Total Flavonoids Content (TFC)

The TFC extracts of E. edulis waste were estimated by a colorimetric method developed by Chang, Yang,

Wen, and Chern (2002) utilizing aluminum chloride. The absorbance was read at 415 and 700 nm using

Spectrophotometer UV-1800 (Shimadzu Corporation, Kyoto, Japan); the latter wavelength was utilized to

correct the influence of haze. A calibration curve utilizing quercetin as standard (0-50 mg L-1) was used

and the data was expressed as mg of quercetin equivalents (QE) per g of dry matter (DM).

2.7 Determination of Total Monomeric Anthocyanin Content (TAC)

TAC of extracts of the juçara waste was estimated by the pH differential method. In solution, at pH 1.0

anthocyanins exhibit predominantly the colored oxonium form whereas, at pH 4.5 there is a shift towards

the colorless hemiketal form; therefore, it is possible to estimate TAC by the difference between absorbance

values at 520 nm (Lee, Durst, & Wrolstad, 2005). Absorbance values at 520 and 700 nm were evaluated

using Spectrophotometer UV-1800 (Shimadzu Corporation, Kyoto, Japan). The wavelength of 700 nm was

utilized to correct the influence of haze on sample absorbance. The TAC value was calculated as follows

(Equation 2):

310

1

A MW DFTAC

(2)

Where, A equals the difference between (Abs 520 nm (pH 1.0)-Abs 700 nm (pH 1.0)) and (Abs 520 nm

(pH 4.5)-Abs 700 nm pH (4.5)); MW is the molecular weight 449.2 g mol-1 of cyanidin-3-glucoside (cyd-

3-glu); DF is dilution factor of each sample; 103 is the unit conversion from g to mg; ε is 26,900 molar

extinction coefficient, in L mol-1 cm-1, for cyd-3-glu; and l is light path length in cm. The results were

expressed as mg cyanidin-3-glucoside equivalents per 100 g of dry matter (DM).

Table 1. Extraction conditions of the experimental design and results of total phenolic content (TPC), total

flavonoids content (TFC), total monomeric anthocyanin content (TAC), total tannins content (TTC) and

antioxidant activity (AA%)

Run

Orde

r

Extraction conditions TPC

(mg GAE∙

100 g DM-1)

TFC

(mg QE∙

g DM-1)

TAC

(mg C3QE∙

100 g DM-1)

TTC

(% mg TAE∙

100 g DM-1)

AA%120 min Microwav

e

Powder

(W) X1

Expositio

n

Time

(s) X2

Ethanol

Concentratio

n

(%) X3 Exp. Pred.

Exp. Pred.

Exp. Pred.

Exp. Pred

.

Exp Pred

#1 668.18

(1.68)

60 (0) 60 (0) 1893.9

8

±33.11a

1905.6

0a

156.99

±1.26a

159.19a

249.0

6

±0.67a

235.32a

0.98

±0.06

ª

0.82ª 61.56

±3.02a

64.14

ª

#2 331.82

(-1.68)

60 (0) 60 (0) 1948.5

3

±67.50a

1930.7

9a

163.23

±5.04a

162.29a

207.3

5

±0.94a

217.95a

0.50

±0.04

ª

0.44ª 56.75

±3.83a

53.22

ª

#3 500 (0) 60 (0) 60 (0) 1281.7

4

±50.15a

1279.5

4a

148.07

±8.83a

160.74a

244.1

6

±1.98a

249.94a

0.63

±0.06

ª

0.63ª 61.94

±1.57a

58.68

ª

#4 500 (0) 60 (0) 60 (0) 1298.4

3

±35.50a

1279.5

4a

160.96

±2.72a

160.74a

245.2

6

±3.35a

249.94a

0.66

±0.05

ª

0.63ª 60.71

±3.58a

58.68

ª

#5 600 (1) 90 (1) 80 (1) 2171.3

4

±33.11b

2223.7

9a

230.13

±3.78a

228.22a

350.5

8

±6.04a

355.10a

0.63

±0.05

ª

0.63ª 65.85

±4.47a

67.07

ª

#6 400 (-1) 90 (1) 40 (-1) 2045.8

7

±52.09a

1859.7

9a

163.23

±0.00a

162.16a

187.6

7

±2.90a

182.27a

0.68

±0.03

ª

0.64ª 63.27

±4.88a

60.57

ª

#7 400 (-1) 30 (-1) 80 (1) 968.84

±42.25a

948.78a 198.31

±1.03a

198.24a

259.0

2

±4.02a

258.61a

0.80

±0.01

ª

0.78ª 51.65

±3.34a

50.30

ª

#8 600 (1) 30 (-1) 40 (-1) 939.43

±2.55a

988.99a 130.04

±3.56a

128.49a

230.5

6

±4.02a

239.11a

0.59

±0.06

ª

0.46ª 57.49

±3.87a

56.79

ª

#9 500 (0) 60 (0) 60 (0) 1185.5

7

±6.82a

1279.5

4a

157.88

±4.72a

160.74a

250.4

8

±5.70a

249.94a

0.62

±0.05

ª

0.62ª 54.93

±2.84a

58.68

ª

32

Note. All results are the means ± SD (n = 3).a-b Same letters prescribe that there was no difference

between the experimental and predicted results within the analysis; different letters determine the

difference. Exp.: Experimental results; Pred.: Predicted results; W: watts; s: seconds.

2.8 Determination of Total Tannin Content (TTC)

TAC of the E. edulis waste extract was estimated according to the methodology of Makkar (2003). This

method is based on the precipitation of condensed tannins using PVPP. In the first step was measured the

content of total phenolics at the absorbance value at 725 nm using Spectrophotometer UV-1800 (Shimadzu

Corporation, Kyoto, Japan). Whereas for the second step, were precipitated tannins and the absorbance

value of the decantate was evaluated at 725 nm using Spectrophotometer UV-1800 (Shimadzu Corporation,

Kyoto, Japan). The difference between the absorbance values between the first and the second steps was

utilized to estimate the TTC value through a calibration curve of tannic acid as standard (0-14 µg mL-1) and

expressed per 100 g of dry matter (DM).

2.9 Antioxidant Activity

β-carotene bleaching assay was used to determine the antioxidant activity of extracts by the β-carotene-

linoleic acid model system (Siraichi et al., 2013) with modifications. Briefly, 1 mL of β-carotene (0.2

mg/mL) was pipetted into a glass tube with 20 mL of linoleic acid, 200 mg of Tween 40. The chloroform

was completely evaporated by using a rotary evaporator (QUIMIS, Brazil). After, 50 mL of distilled water

were added to the flask with vigorous stirring. Another emulsion was made without β-carotene. Aliquots

(4.8 mL) of the prepared emulsions were transferred to a series of tubes containing 0.2 mL of extracts. The

tubes were placed in a water bath at 50 ºC for 2 h.

The absorbance of each sample was measured using a Spectrophotometer UV-1800 (Shimadzu

Corporation, Kyoto, Japan) set at 470 and 700 nm immediately after sample preparation (t = 0 min) and at

30-min intervals until the end (t = 120 min) of the experiment; the latter wavelength was utilized to correct

the influence of haze. Emulsion without β-carotene using like blank. Water and BHT (3 mg/mL) were used

#10 500 (0) 60 (0) 60 (0) 1209.5

8

±39.83a

1279.5

4a

153.12

±2,06a

160.74a

248.5

9

±3.29a

249.94a

0.62

±0.03

ª

0.62ª 59.90

±3.34a

58.68

ª

#11 500 (0) 60 (0) 93.64

(1.68)

1486.9

4

±68.77a

1415.6

8a

251.24

±10.45a

245.19a

351.0

6

±3.29a

349.49a

0.76

±0.04

ª

0.75ª 60.06

±0.52a

58.68

ª

#12 500 (0) 60 (0) 26.37

(-1.68)

920.21

±14.56a

1143.0

0a

174.53

±1.03a

181.12a

182.3

2

±4.03a

187.76a

0.47

±0.03

ª

0.50ª 56.32

±2.21a

58.68

ª

#13 400 (-1) 90 (1) 80 (1) 1411.3

0

±12.61a

1622.9

2a

197.12

±3.09a

200.25a

354.3

8

±2.01a

344.77a

0.45

±0.05

ª

0.41ª 61.40

±3.68a

60.57

ª

#14 500 (0) 60 (0) 60 (0) 1195.1

7

±8.25a

1079.1

9a

151.93

±2,72a

160.74a

253.3

3

±4.03a

249.94a

0.57

±0.05

ª

0.62ª 65.69

±3.71a

58.68

ª

#15 500 (0) 110.45

(1.68)

60 (0) 1589.6

0

±17.83a

1529.5

9a

193.56

±3.57a

187.50a

287.4

9

±4.03a

296.21a

0.68

±0.15

ª

0.65ª 70.72

±2.98a

67.32

ª

#16 600 (1) 90 (1) 40 (-1) 1456.9

3

±41.44a

1522.6

7a

188.80

±1.03a

190.12a

190.7

1

±4.02a

192.60a

0.88

±0.06

ª

0.87ª 62.21

±0.82a

67.07

ª

#17 500 (0) 60 (0) 60 (0) 1315.2

4

±53.74a

1079.1

9a

173.34

±2.72a

160.74a

259.0

2

±4.02a

249.94a

0.55

±0.10

ª

0.62ª 64.11

±0.34a

58.68

ª

#18 400 (-1) 30 (-1) 40 (-1) 932.82

±20.87a

1050.8

9a

160.26

±2.72a

160.14a

241.9

4

±4.02a

228.78a

0.17

±0.04

ª

0.23ª 51.66

±3.35a

50.30

ª

#19 600 (1) 30 (-1) 80 (1) 1184.3

7

±48.39a

1023.4

9a

157.88

±1.78a

166.59a

264.7

2

±4.02a

268.93a

0.40

±0.07b

1.00a 58.67

±2.61a

56.79

ª

#20 500 (0) 9.55

(-1.68)

60 (0) 595.43

±22.57a

628.80a 137.36

±1.26a

133.98a

264.7

2

±4.03a

262.86a

0.57

±0.12a

0.61a 48.77

±2.38a

50.04

ª

33

as negative and positive controls, respectively. The antioxidant activity of extracts was expressed as

(Equation 3):

0 0

0 0 0 0

1 ( ) ( )100

( ) ( ) ( ) ( )

c t ct

w wc wt wct BHT BHTc BHTt BHTct

A A A A

A A A A A A A A

(3)

2.10 Statistical Analysis

All analyses are carried out in triplicate and results reported as mean values with standard deviation.

ANOVA with Tukey test was performed using XLSTAT version 2013.2.03 (Addinsoft, Paris, France).

RSM was performed using the Minitab® software (version 17.1.0, USA). The regression coefficients of

linear, square and two-way interaction terms were evaluated by analysis of variance, and the relevant (p <

0.05) terms were utilized to generate the surface and contour plots. The fitted polynomial equation indicated

the optimal conditions for the TPC, TFC, TAC and TTC response variables. Differences in phenolic,

flavonoids, monomeric anthocyanin and tannins compounds were considered significant at p < 0.05., you

may refer the reader to that source and simply give a brief synopsis of the method in this section.

3. Results and Discussion

3.1 Antioxidant Compounds Extraction

For antioxidant compounds extraction, ethanol aqueous solution is a preferred solvent system (Karacabey

& Mazza, 2010; Sharma et al., 2014), since polyphenols have a varied range of solubility (Ilaiyaraja,

Likhith, Sharath Babu, & Khanum, 2015), and use of solvents with different polarity potentials high yield

of total antioxidants (Szydłowska-Czerniak, Tułodziecka, Karlovits, & Szłyk, 2015). Ethanol, a green safe

solvent, (Kukula-Koch et al., 2013; Li et al., 2012) was utilized due to efficiency on solubilizing bioactive

molecules from vegetable matrixes (Espinosa-Pardo et al., 2014; Fang, Wang, Hao, Li, & Guo, 2015;

Sharma et al., 2014). In addition, previous studies using MAE to the extraction of antioxidant compounds

from fruits determined that the concentration of the solvent, microwave power and exposition time were

independents variables (Dahmoune et al., 2014, 2015; Fang et al., 2015; Kim et al., 2012; Li et al., 2012,

2014; Zeković et al., 2016).

In the present study, the response data of TPC, TFC, TAC, TTC and AA% were listed in Table 1. The

highest TPC was represented for experiment #5 (2171.34 mg GAE∙100 g DM-1) that correspond to

microwave power 600 (W), ethanol concentration 80% and time 90 seconds provided. For TFC, the

experiment #11 (500 W, 93.46% and 60 seconds) showed the highest concentration (251.24 mg QE∙g DM-

1), while in TAC was the experiment #13 (400 W, ethanol concentration 80% and 90 seconds) (354.38 mg

C3QE∙100 g DM-1). As for TTC the experiment #1 (668.18 W, ethanol concentration 60% and 60 seconds)

exhibited the highest tannins concentration (0.98 mg TAE∙100 g DM-1). Regarding AA%, the experiment

#15 (500 W, ethanol concentration 60% and 110.45 sec) obtained the highest antioxidant activity (70.72%).

The RSM indicated the empirical relationship between TPC (Equation 4), TFC (Equation 5), TAC

(Equation 6), TTC (Equation 7) and AA% (Equation 8) value with the extraction conditions were generated

as follows:

Y = 6298 – 22.65X1 + 7.03X2 – 6.81X3 + 0.02258X12 + 0.1809X2X3 (4)

Y = 392.2 – 0.3073X1 – 1.953X2 – 4.607X3 + 0.04633X32 + 0.004968X1X2 (5)

Y = 154.3 + 0.876X1 – 4.381X2 – 2.894X3 – 0.000824X12 + 0.01162X2

2 + 0.01651X32 + 0.05528X2X3 (6)

Y = -1.355 + 0.001142X1 + 0.01972X2 + 0.02323X3 – 0.000323X2X3 (7)

Y = 32.57 + 0.0325X1 + 0.1712X2 (8)

Moreover, ANOVA for experimental results show the quadratic polynomial model for TPC, TFC, TAC,

TTC and AA% was significant highly (F = 30.78, F = 46.03, F = 50.81, F = 9.01, F = 8.89, respectively),

with p < 0.001 for TPC, TFC and TAC; p = 0.001 for TTC; p = 0.002 for AA%, (Table 2). There is only a

0.01 to 0.002% chance that a ‘‘Model F-Value’’ this large could occur due to noise, recommended the

significant of the model. R2 and R2 adjusted (Table 2) values for the model did not differ considerably, this

34

confirms an adequate statistical model. However, a large value of R2 not necessarily designates that the

regression model is a sound one. Therefore, it is better to use the R2 adjusted to evaluate the model

adequacy, as that the addition of a variable to the model R2 increase with the significant or non-significant

variable (Karazhiyan, Razavi, & Phillips, 2011). The absence of lack of fit and the value of pure error

indicated good reproducibility of the experimental data (Table 2). The model could work well for the

prediction of TPC, TFC, TAC, TTC and AA% extract from E. edulis waste powder.

Table 2. Analysis of variance (ANOVA) and regression coefficients for the quadratic polynomial model

for the experimental results of total phenolic (TPC), total flavonoids (TFC), total monomeric anthocyanin

(TAC), total tannins content (TTC) and antioxidant activity (AA%) from Euterpe edulis waste extract

Analysis Model Intercept

Linear

Square

2-Way

Interaction Lack of

fit

Pure

error Residual

Corr.

Total B0 X1 X2 X3 X1

1 X22 X3

3 X1X2 X2X3

TPCb

R2=0.9166

R2A=0.8869

R2P=0.8581

Standard

error

50 50 38.6 44 5.09 37 6.91

DFa 5 1 1 1 1 1 10 4 14 19

Sum of

squares

3026928 2050435 4016 1639587 406831 245352 259124 16194 275318 3302247

F-value 30.78 16.80 0.04 37.04 12.79 37.18 12.48 6.90

P-value <0.001 <0.001 0.849 <0.001 0.003 <0.001 0.003 0.154

TFCc

R2=0.9427

R2A=0.9222

R2P=0.8859

Standard

error

12.90 12.90 2.20 2.20 2.42 0.108 2.88

DFa 5 1 1 1 1 1 9 5 14 19

Sum of

squares

15240.2 8423.9 11.6 3457.6 4954.8 5039.4 1776.9 373.4 553.7 927.1 320972

F-value 46.03 32.72 0.18 52.21 45.77 76.10 26.83 0.37

P-value <0.001 <0.001 0.682 <0.001 <0.001 <0.001 <0.001 0.905

TACd

R2=0.9674

R2A=0.9483

R2P=0.8507

Standard

error

18.00 18.00 3.06 10.40 3.39 2.98 2.98 0.15 0.90

DFa 7 1 1 1 1 1 1 1 7 5 12 19

Sum of

squares

45511.4 33278.2 364.1 1342.2 31571.0 1404.0 1399.5 628.5 8801.2 1384.2 151.2 1535.4 47046.7

F-value 50.81 17.47 2.85 48.53 1.04 8.94 7.65 12.33 4.91 68.79

P-value <0.001 <0.001 0.017 <0.001 0.327 0.017 0.004 0.047 <0.001 0.007

TTCe

R2=0.7510

R2A=0.6621

R2P=0.5482

Standard

error

0.0881 0.0881 0.0337 0.0114 0.00759 0.0092

DFa 4 1 1 1 1 10 5 15 19

Sum of

squares

0.56068 0.17820 0.00131 0.08039 0.30077 0.11979 0.11349 0.79397

F-value 9.01 11.67 11.46 18.38 5.17 19.34 0.53

P-value 0.001 <0.001 0.004 0.001 0.038 0.001 0.818

AA%

R2=0.5113

R2A=0.6538

R2P=0.5860

Standard

error

1.19 1.19 1.14 1.14

DFa 2 2 1 1 12 5 19

Sum of

squares

504.4 504.4 144.0 360.4 286.1 196.0 986.5

F-value 8.89 8.89 5.08 12.71 0.61

P-value 0.002 0.002 0.038 0.002 0.778

Note. aDegree of freedom; b(mg GAE∙100 g DM-1); c(mg QE∙g DM-1); d(mg C3QE∙100 g DM-1); e(mg

TAE∙100 g DM-1); R2A = R2 Adjusted; R2

P = R2 Predicted; X1 = Power (W); X2 = Time (s); X3 = Ethanol

Concentration (%).

The experimentally optimized conditions described by the model to selected for maximum TPC and TFC

extraction is microwave power 668.18 W, exposition time of 110.45 seconds and aqueous ethanol

concentration 93.64%. For maximum TAC extraction is microwave power 532.28 W, exposition time of

110.45 seconds and aqueous ethanol concentration 93.64%. For TTC extraction is microwave power 668.18

W, exposition time of 9.55 seconds and aqueous ethanol concentration 93.64%. To obtain the optimum

maximum extraction of antioxidants molecules studied, the parameter was determined: 668.18 W, 110.45

35

seconds and 93.64% by the model. And for antioxidant activity is microwave power 668.18 W, exposition

time of 110.45 seconds and aqueous ethanol 64.41%.

3.2 Interactions of the Studied Factors

The interaction between microwave power, exposition time and ethanol aqueous solution between TPC are

shown in three-dimensional surface and contour plots (Figure 1A). The contour plots indicate the nature

and extent of interactions of different components (Prakash, Talat, Hasan, & Pandey, 2008). The maximum

point of each three-dimension plot subjected is the optimum point for the two factors presented in the chart.

The effect between the exposition time (X2) and ethanol concentration (X3) are presented in Figure 1-A1,

this can be observed the time and ethanol concentration is directly proportional to TPC yield, same behavior

was observed in juçara pulp MAE (Cavalcanti et al., 2011), in coriander seed extracts (Zekovi et al., 2016),

in Cammelia oleifera fruit (Zhang et al., 2011) and in Vitis coignetiae (Kim et al., 2012). Thus, the highest

ethanol concentration increased extraction of compounds (Kim et al., 2012), this may be attributed the

difference in dielectric properties of solvent towards microwave heating (Dahmoune et al., 2014).

The effect between the ratio of microwave power (X1) and ethanol concentration (X3) are represented in

Figure 1-A2. First, the extraction combination decreased efficiency by raise power but after 550 W

increased. Probably because increased diffusion rate and solubility of the target compounds in the solvent

were affected by temperature (Fernández-Ponce, Casas, Mantell, & Martínez de la Ossa, 2015) and higher

power must be excited phenolic molecules (Zeković et al., 2016). Also, an increase of ethanol concentration

increase TPC yield, probably for the fact of solvent polarity declined and solubility of molecules increased.

The same behavior has observed in Pistacia lentiscus and Vitis coignetiae (Dahmoune et al., 2014; Kim et

al., 2012). This behavior was observed for phenolic compounds from Euterpe edulis peels and pulp near

the seeds by Garcia-Mendonza et al. (Garcia-Mendoza et al., 2017). According to Fernández-Ponce et al.

(2015) and Santos et al. (2012), others fruits extracts presented the same behaviors for temperature action.

The interaction of ratio of microwave power (X1) and exposition time (X2) are presented in Figure 1-A3.

The yield of TPC decreases with the increase of power, probably due to thermal degradation of phenolic

compounds (Dahmoune et al., 2015; Dairi et al., 2015).

36

Figure 1A. Response surface plots showing the operating parameter 2-Way Interaction on total phenolic

(TPC). The surface and contour plots describing the effect of three independent variables on response

variables; TPC interaction between variables X1 to X3 (A1-A3). TPC: mg GAE∙100 g DM-1, Microwave

power (W), exposition time (seconds) and ethanol concentration in aqueous solution as solvent (%)

Referring to the interaction between studied factors with TFC (Figure 1B). Interaction of concentration and

time (Figure 1-B1) present decrease yield in about 50% of ethanol. The same behavior was observed in the

interaction of power and ethanol concentration (Figure 1-B2), this can be explained by the fact of flavonoids

represent a wide range of polarity and ethanol presents a molecule with apolar and polar activity (Fattahi

& Rahimi, 2016). In Figure 1-B3 increase power about 500 W and exposition time of 40 seconds can be

attributed the highest yield of TFC, it can be explained by the fact of after 500 W the temperature can be

high them 55 ºC and flavonoids molecules are degraded in temperatures higher than 55 ºC (Fattahi &

Rahimi, 2016).

37

Figure 1B. Response surface plots showing the operating parameter 2-Way Interaction flavonoids (TFC).

The surface and contour plots describing the effect of three independent variables on response variables

TFC interaction between variables X1 to X3 (B1-B3); TFC: mg QE∙g DM-1, Microwave power (W),

exposition time (seconds) and ethanol concentration in aqueous solution as solvent (%)

The interaction between studied factors on TAC extraction is represented in three-dimensional surface and

contour plots (Figure 2A). The interaction of concentration and exposition time show monomeric

anthocyanins decrease (Figure 2-A1), possible, for the fact of the increase in temperature and molecules

degradation (Dahmoune et al., 2015; Dairi et al., 2015). Ethanol concentration and microwave power

interaction presented in Figure 2-A2 demonstrated that initially with to increase of power, the yield of TAC

increased, however about 500 to 560 W its began to decrease. This fact can be explaining the fact of a

possibility of high temperature and degradation of monomeric anthocyanins (Jiménez et al., 2010). When

the waste of E. edulis exposed more time, and increase an ethanol concentration the yield of TAC increased,

this can be explained by the fact of anthocyanins represent a wide range of polarity, and ethanol presents a

molecule with apolar and polar activity (Fattahi & Rahimi, 2016). Similarly interaction behavior was

observed in antioxidant compounds by Kim et al. (2012) between microwave power and exposition time in

Figure 2-A3 show the TFC yield decrease with time and power increase, this can be explained by high

temperature and degradation of monomeric anthocyanins (Jiménez et al., 2010).

38

Figure 2A. Response surface plots showing the operating parameter 2-Way Interaction anthocyanins

(TAC). The surface and contour plots describing the effect of three independent variables on response

variables; TAC interaction between variables X1 to X3 (A1-A3). TAC: mg C3QE∙100 g DM-1, Microwave


Three-dimensional surface plots and contour plots for TTC based interaction between studied factors are

shown in Figure 2B. In the interaction of exposition time and ethanol aqueous concentration (Figure 2-B1),

the highest yield obtained with low time, about 6 to 10 seconds, and up 45% of ethanol has also an increase,

but after 45 to 50% had decreased, can be explained by the fact of ethanol be less polar than water

(Szydłowska-Czerniak et al., 2015). In Figure 2-B2, TTC increased with the interaction of concentration

and microwave power. When observed power and exposition time interaction (Figure 2-B3), the yield

increased with time at about 550 W. Parada, Rodríguez-Blanco, Fernández de Ana Magán, and Domínguez

(2015) observed the highest extraction of antioxidant compounds about 450 to 550 W, similar to found in

this study.

39

Figure 2B. Response surface plots showing the operating parameter 2-Way Interaction tannins (TTC)

content. The surface and contour plots describing the effect of three independent variables on response

variables; TTC interaction between variables X1 to X3 (B1-B3). TTC: mg TAE∙100 g DM-1, Microwave


The interaction of variables and extraction of potential antioxidant activity extract were present in three-

dimensional and contour plots (Figure 3A). Only microwave power and exposition time can be affected

obtain of extraction with high antioxidant activity. This can be explained by the fact that compounds extract

with different ethanol concentrations balanced this function since antioxidant activity depends on the type

of antioxidants in the extract and not the quantity (Fattahi & Rahimi, 2016). The power increased can

promote an increase of temperature during extraction, so increase the phenolic extraction, this occurs

because the higher rate of mass transfer at high temperature, which would have dissolved the phenolic

compounds more easily (Li et al., 2012). The same behavior can be observed in other fruits as tomatoes (Li

et al., 2012).

Figure 3A. Response surface plots showing the operating parameter 2-way interaction antioxidant

activity, the surface and contour plots describing the effect of three independent variables on response

variables (A).

40

The antioxidant extracts were similar behavior, as shown in Figure 3B, and grouped within in close

absorbance. For determining antioxidant activity, water was used as a negative control, when to compare

obtained extracts to water activity and BHT (positive control), E. edulis waste extracts presented close

behavior of BHT (Figure 3B). For this fact, these extracts can be compared to BHT antioxidant activity, so

E. edulis waste is a potential source of natural antioxidants.

Figure 3B. Antioxidant activity of ethanolic extracts from E. edulis, as assessed by the coupled oxidation

of β-carotene and linoleic acid over 120 min (B)

3.3 Validation and Verification of Predictive Models

To validate the predicted data (from the equations generated by the models obtained) must be compared to

the experimental results (Table 1) by ANOVA and Turkey test. In addition, it was observed that there was

no difference between the results obtained in the experiment and predicted by the model. Hence, we can

confirm as an optimal condition to obtain the compounds contents and the antioxidant capacity of the extract

by microwave extraction using power, exposition time and ethanol concentration in the solvent as variables.

However, future studies should be performed to evaluate the effect of these extracts in the food matrix,

which would indicate if it is appropriate to use them industrially. Nevertheless, the parameters evaluated in

this study can be used to predict the concentration of total phenolic, flavonoids, anthocyanins and tannins

present in the extracts of E. edulis waste, with high antioxidant activity, including study characteristics and

individual effect sizes used in a meta-analysis, can be made available on supplemental online archives.

4. Conclusion

The extraction performance was influenced by microwave power, exposition time and ethanol aqueous

solution concentration. In addition, the experimental design was successfully applied for optimization of

high antioxidant activity extracts. Thus, MAE conditions were well optimized for the extraction of

antioxidant compounds from E. edulis wastes. The optimal conditions that maximized the extraction yields

of antioxidant compounds in Euterpe edulis wastes were microwave power at 668.17 W, ethanol

concentration at 93.65% and 65.60 seconds, and of antioxidant activity were microwave power at 668.17

W, ethanol concentration at 64.41% and 110.45 seconds.

References

41

Ainsworth, E. A., & Gillespie, K. M. (2007). Estimation of total phenolic content and other oxidation

substrates in plant tissues using Folin-Ciocalteu reagent. Nature Protocols, 2(4), 875-877.

https://doi.org/10.1038/ nprot.2007.102

Bicudo, M. O. P., Ribani, R. H., & Beta, T. (2014). Anthocyanins, Phenolic Acids and Antioxidant

Properties of Juçara Fruits (Euterpe edulis M.) Along the On-tree Ripening Process. Plant Foods for

Human Nutrition, 69(2), 142–147. https://doi.org/10.1007/s11130-014-0406-0

Borges, G. D. S. C., Gonzaga, L. V., Jardini, F. A., Mancini Filho, J., Heller, M., Micke, G., … Fett, R.

(2013). Protective effect of Euterpe edulis M. on Vero cell culture and antioxidant evaluation based

on phenolic composition using HPLC-ESI-MS/MS. Food Research International, 51(1), 363-369.

https://doi.org/ 10.1016/j.foodres.2012.12.035

Borges, G., Gracieli Kunradi Vieira, F., Copetti, C., Valdemiro Gonzaga, L., Zambiazi, R. C., Mancini

Filho, J., & Fett, R. (2011). Chemical characterization, bioactive compounds, and antioxidant

capacity of jussara (Euterpe edulis) fruit from the Atlantic Forest in southern Brazil. Food Research

International, 44(7), 2128-2133. https://doi.org/10.1016/j.foodres.2010.12.006

Cavalcanti, R. N., Santos, D. T., & Meireles, M. A. A. (2011). Non-thermal stabilization mechanisms of

anthocyanins in model and food systems—An overview. Food Research International, 44(2), 499-

509. https://doi.org/10.1016/j.foodres.2010.12.007

Chang, C.-C., Yang, M.-H., Wen, H.-M., & Chern, J.-C. (2002). Estimation of total flavonoid content in

propolis by two complementary colorimetric methods. Journal of Food and Drug Analysis, 10(3).

Retrieved from http://search.proquest.com/openview/8ed5f78aa3317908039c7a8ca3740050/1?pq-

origsite=gscholar

Contini, C., Álvarez, R., O’Sullivan, M., Dowling, D. P., Gargan, S. Ó., & Monahan, F. J. (2014). Effect

of an active packaging with citrus extract on lipid oxidation and sensory quality of cooked turkey

meat. Meat Science, 96(3), 1171-1176. https://doi.org/10.1016/j.meatsci.2013.11.007

Dahmoune, F., Nayak, B., Moussi, K., Remini, H., & Madani, K. (2015). Optimization of microwave-

assisted extraction of polyphenols from Myrtus communis L. leaves. Food Chemistry, 166, 585-595.

https://doi.org/10.1016/j.foodchem.2014.06.066

Dahmoune, F., Spigno, G., Moussi, K., Remini, H., Cherbal, A., & Madani, K. (2014). Pistacia lentiscus

leaves as a source of phenolic compounds: Microwave-assisted extraction optimized and compared

with ultrasound-assisted and conventional solvent extraction. Industrial Crops and Products, 61, 31-

40. https://doi.org/10.1016/j.indcrop.2014.06.035

Dairi, S., Galeano-Díaz, T., Acedo-Valenzuela, M. I., Godoy-Caballero, M. P., Dahmoune, F., Remini,

H., & Madani, K. (2015). Monitoring oxidative stability and phenolic compounds composition of

myrtle-enriched extra virgin olive during heating treatment by flame, oven and microwave using

reversed phase dispersive liquid-liquid microextraction (RP-DLLME)-HPLC-DAD-FLD method.

Industrial Crops and Products, 65, 303-314. https://doi.org/10.1016/j.indcrop.2014.11.035

Ertas, A., Boga, M., Yilmaz, M. A., Yesil, Y., Tel, G., Temel, H., Ugurlu, P. (2015). A detailed study on

the chemical and biological profiles of essential oil and methanol extract of Thymus nummularius

(Anzer tea): Rosmarinic acid. Industrial Crops and Products, 67, 336-345.

https://doi.org/10.1016/j.indcrop.2015.01.064

Espinosa-Pardo, F. A., Martinez, J., & Martinez-Correa, H. A. (2014). Extraction of bioactive compounds

from peach palm pulp (Bactris gasipaes) using supercritical CO2. The Journal of Supercritical

Fluids, 93, 2-6. https://doi.org/10.1016/j.supflu.2014.05.010

Fang, X., Wang, J., Hao, J., Li, X., & Guo, N. (2015). Simultaneous extraction, identification and

quantification of phenolic compounds in Eclipta prostrata using microwave-assisted extraction

combined with HPLC-DAD-ESI-MS/MS. Food Chemistry, 188, 527-536.


42

Fattahi, M., & Rahimi, R. (2016). Optimization of Extraction Parameters of Phenolic Antioxidants from

Leaves of Capparis spinosa Using Response Surface Methodology. Food Analytical Methods, 9(8),

2321-2334. https://doi.org/10.1007/s12161-016-0414-9

Fernández-Ponce, M. T., Casas, L., Mantell, C., & Martínez de la Ossa, E. (2015). Use of high pressure

techniques to produce Mangifera indica L. leaf extracts enriched in potent antioxidant phenolic

compounds. Innovative Food Science & Emerging Technologies, 29, 94-106.

https://doi.org/10.1016/j.ifset.2015.04.006

Garcia-Mendoza, M. del P., Espinosa-Pardo, F. A., Baseggio, A. M., Barbero, G. F., Maróstica Junior, M.

R., Rostagno, M. A., & Martínez, J. (2017). Extraction of phenolic compounds and anthocyanins

from juçara (Euterpe edulis Mart.) residues using pressurized liquids and supercritical fluids. The

Journal of Supercritical Fluids, 119, 9-16. https://doi.org/10.1016/j.supflu.2016.08.014

Ilaiyaraja, N., Likhith, K. R., Sharath Babu, G. R., & Khanum, F. (2015). Optimisation of extraction of

bioactive compounds from Feronia limonia (wood apple) fruit using response surface methodology

(RSM). Food Chemistry, 173, 348-354. https://doi.org/10.1016/j.foodchem.2014.10.035

Jiménez, N., Bohuon, P., Lima, J., Dornier, M., Vaillant, F., & Pérez, A. M. (2010). Kinetics of

Anthocyanin Degradation and Browning in Reconstituted Blackberry Juice Treated at High

Temperatures (100-180 °C). Journal of Agricultural and Food Chemistry, 58(4), 2314-2322.

https://doi.org/10.1021/jf902381e

Karacabey, E., & Mazza, G. (2010). Optimisation of antioxidant activity of grape cane extracts using

response surface methodology. Food Chemistry, 119(1), 343-348.


Karazhiyan, H., Razavi, S. M. A., & Phillips, G. O. (2011). Extraction optimization of a hydrocolloid

extract from cress seed (Lepidium sativum) using response surface methodology. Food

Hydrocolloids, 25(5), 915-920. https://doi.org/10.1016/j.foodhyd.2010.08.022

Kim, H.-K., Do, J.-R., Lim, T.-S., Akram, K., Yoon, S.-R., & Kwon, J.-H. (2012). Optimisation of

microwave-assisted extraction for functional properties of Vitis coignetiae extract by response

surface methodology. Journal of the Science of Food and Agriculture, 92(8), 1780-1785.

https://doi.org/10.1002/ jsfa.5546

Kukula-Koch, W., Aligiannis, N., Halabalaki, M., Skaltsounis, A.-L., Glowniak, K., & Kalpoutzakis, E.

(2013). Influence of extraction procedures on phenolic content and antioxidant activity of Cretan

barberry herb. Food Chemistry, 138(1), 406-413. https://doi.org/10.1016/j.foodchem.2012.10.045

Lee, J., Durst, R. W., & Wrolstad, R. E. (2005). Determination of total monomeric anthocyanin pigment

content of fruit juices, beverages, natural colorants, and wines by the pH differential method:

Collaborative study. Journal of AOAC International, 88(5), 1269-1278.

Li, H., Deng, Z., Wu, T., Liu, R., Loewen, S., & Tsao, R. (2012). Microwave-assisted extraction of

phenolics with maximal antioxidant activities in tomatoes. Food Chemistry, 130(4), 928-936.

https://doi.org/10.1016/ j.foodchem.2011.08.019

Li, M., Ngadi, M. O., & Ma, Y. (2014). Optimisation of pulsed ultrasonic and microwave-assisted

extraction for curcuminoids by response surface methodology and kinetic study. Food Chemistry,

165, 29-34. https://doi.org/10.1016/j.foodchem.2014.03.115

Li, Y., Fabiano-Tixier, A.-S., Abert-Vian, M., & Chemat, F. (2013). Microwave-assisted Extraction for

Bioactive Compounds: Theory and practice. In F. Chemat & G. Cravotoo (Eds.), Microwave-

Assisted Extraction of Antioxidants and Food Colors (Chapter 5). Food Engineering Series. New

York Heidelberg Dordrecht London: Springer.

43

Lu, J., Qin, P., Han, X., Wang, Y., & Li, Z. (2015). Evaluation of antioxidant and antibacterial properties

of extracts from Trollius chinensis Bunge. European Food Research and Technology, 240(2), 301-

310. https://doi.org/10.1007/s00217-014-2329-2

Makkar, H. P. (2003). Quantification of tannins in tree and shrub foliage: A laboratory manual. Springer

Science & Business Media. Kluwer Academic Publishers, 20p.

Manganaris, G. A., Goulas, V., Vicente, A. R., & Terry, L. A. (2014). Berry antioxidants: Small fruits

providing large benefits. Journal of the Science of Food and Agriculture, 94(5), 825-833.

https://doi.org/10.1002/ jsfa.6432

Montgomery, D. C. (2004). Design and analysis of experiments. John Wiley. http://bcs.wiley.com/he-bcs/

Books?action=index&itemId=047148735X&itemTypeId=BKS&bcsId=2172

Ortega-Ramirez, L. A., Rodriguez-Garcia, I., Leyva, J. M., Cruz-Valenzuela, M. R., Silva-Espinoza, B.

A., Gonzalez-Aguilar, G. A., Ayala-Zavala, J. F. (2014). Potential of Medicinal Plants as

Antimicrobial and Antioxidant Agents in Food Industry: A Hypothesis: Medicinal plants as food

additives. Journal of Food Science, 79(2), R129-R137. https://doi.org/10.1111/1750-3841.12341

Parada, M., Rodríguez-Blanco, A., Fernández de Ana Magán, F., & Domínguez, H. (2015). Sequential

extraction of Hericium erinaceus using green solvents. LWT - Food Science and Technology, 64(1),

397-404. https://doi.org/10.1016/j.lwt.2015.06.008

Prakash, O., Talat, M., Hasan, S. H., & Pandey, R. K. (2008). Factorial design for the optimization of

enzymatic detection of cadmium in aqueous solution using immobilized urease from vegetable

waste. Bioresource Technology, 99(16), 7565-7572. https://doi.org/10.1016/j.biortech.2008.02.008

Rahal, A., Kumar, A., Singh, V., Yadav, B., Tiwari, R., Chakraborty, S., & Dhama, K. (2014). Oxidative

Stress, Prooxidants, and Antioxidants: The Interplay. BioMed Research International, 1-19.

https://doi.org/10.1155/ 2014/761264

Rufino, M. S. M., Alves, R. E., Fernandes, F. A. N., & Brito, E. S. (2011). Free radical scavenging

behavior of ten exotic tropical fruits extracts. Food Research International, 44(7), 2072-2075.

https://doi.org/10.1016/ j.foodres.2010.07.002

Santos, D. T., Veggi, P. C., & Meireles, M. A. A. (2010). Extraction of antioxidant compounds from

Jabuticaba (Myrciaria cauliflora) skins: Yield, composition and economical evaluation. Journal of

Food Engineering, 101(1), 23-31. https://doi.org/10.1016/j.jfoodeng.2010.06.005

Santos, D. T., Veggi, P. C., & Meireles, M. A. A. (2012). Optimization and economic evaluation of

pressurized liquid extraction of phenolic compounds from jabuticaba skins. Journal of Food

Engineering, 108(3), 444-452. https://doi.org/10.1016/j.jfoodeng.2011.08.022

Shao, Y., Wu, Q., Duan, J., Yue, W., Gu, W., & Wang, X. (2014). Optimisation of the solvent extraction

of bioactive compounds from Lophatherum gracile Brongn. using response surface methodology

and HPLC-PAD coupled with pre-column antioxidant assay. Anal. Methods, 6(1), 170-177.

https://doi.org/ 10.1039/C3AY41279B

Sharma, K., Assefa, A. D., Kim, S., Ko, E. Y., Lee, E. T., & Park, S. W. (2014). Evaluation of total

phenolics, flavonoids and antioxidant activity of 18 Korean onion cultivars: A comparative study.

Journal of the Science of Food and Agriculture, 94(8), 1521-1529. https://doi.org/10.1002/jsfa.6450

Silva, P. P. M., do CARMO, L. F., Silva, G. M., Silveira-Diniz, M. F., Casemiro, R. C., & Spoto, M. H.

F. (2013). Physical, chemical, and lipid composition of juçara (Euterpe edulis Mart.) pulp. Brazilian

Journal of Food and Nutrition, 24(1), 7-13.

Siraichi, J. T. G., Felipe, D. F., Brambilla, L. Z. S., Gatto, M. J., Terra, V. A., Cecchini, A. L., … Cortez,

D. A. G. (2013). Antioxidant Capacity of the Leaf Extract Obtained from Arrabidaea chica

Cultivated in Southern Brazil. PLoS ONE, 8(8), e72733.

https://doi.org/10.1371/journal.pone.0072733

44

Szydłowska-Czerniak, A., Tułodziecka, A., Karlovits, G., & Szłyk, E. (2015). Optimisation of

ultrasound-assisted extraction of natural antioxidants from mustard seed cultivars. Journal of the

Science of Food and Agriculture, 95(7), 1445-1453. https://doi.org/10.1002/jsfa.6840

Tadapaneni, R. K., Daryaei, H., Krishnamurthy, K., Edirisinghe, I., & Burton-Freeman, B. M. (2014).

High-Pressure Processing of Berry and Other Fruit Products: Implications for Bioactive Compounds

and Food Safety. Journal of Agricultural and Food Chemistry, 62(18), 3877-3885.

https://doi.org/10.1021/ jf404400q

Zeković, Z., Vladić, J., Vidović, S., Adamović, D., & Pavlić, B. (2016). Optimization of microwave-

assisted extraction (MAE) of coriander phenolic antioxidants-response surface methodology

approach: Microwave-assisted extraction of coriander phenolic antioxidants. Journal of the Science

of Food and Agriculture, 96(13), 4613-4622. https://doi.org/10.1002/jsfa.7679

Zengin, G., Sarikurkcu, C., Aktumsek, A., & Ceylan, R. (2014). Sideritis galatica Bornm.: A source of

multifunctional agents for the management of oxidative damage, Alzheimer’s’s and diabetes

mellitus. Journal of Functional Foods, 11, 538-547. https://doi.org/10.1016/j.jff.2014.08.011

Zhang, L., Wang, Y., Wu, D., Xu, M., & Chen, J. (2011). Microwave-Assisted Extraction of Polyphenols

from Camellia oleifera Fruit Hull. Molecules, 16(12), 4428-4437.

https://doi.org/10.3390/molecules16064428

Copyrights

Copyright for this article is retained by the author(s), with first publication rights granted to the journal.

This is an open-access article distributed under the terms and conditions of the Creative Commons

Attribution license (http://creativecommons.org/licenses/by/4.0/).

45

3.2 ARTIGO II

O artigo intitulado “Euterpe edulis waste extracts replace synthetic antioxidant on

conventional and antibiotic-free broiler meat” está submetido à revista Food Chemistry.

Food Chemistry

Euterpe edulis waste extracts replace synthetic antioxidant on conventional and

antibiotic-free broiler meat

Running title: Juçara waste extract reduce lipid and protein oxidation broiler meat

Beatriz da Silva Frasaoa,*, Marion Pereira da Costab, Bruna Leal Rodriguesa, Hariadyne

Abreu Bittia, Jéssica Diogo Baltarc, Regina Isabel Nogueirad, Carlos Adam Conte-

Juniora,c,e

a Department of Food Technology, Faculdade de Veterinária, Universidade Federal

Fluminense, 24230-340, Rio de Janeiro, Brazil.

b Department of Preventive Veterinary Medicine and Animal Production, Escola de

Medicina Veterinária e Zootecnia, Universidade Federal da Bahia, Ondina, Salvador,

Brazil

c Food Science Programe, Chemistry Institute, Universidade Federal do Rio de Janeiro,

21941-909, Rio de Janeiro, Brazil.

d Embrapa Food Technology, Brazilian Agricultural Research Corporation, Rio de

Janeiro, Brazil.

e National Institute for Health Quality Control, Oswaldo Cruz Foundation (FIOCRUZ),

Avenida Brasil 4.365, 21.040-900, Rio de Janeiro, RJ, Brazil.

*Corresponding author:

Beatriz da Silva Frasao, D.V.M., M.Sc.

Fluminense Federal University, Brazil.

Rua Vital Brazil Filho, 64. Niterói, Rio de Janeiro, Brazil. CEP: 24230-340.

Tel: +55 21 26299545

E-mail address: [email protected] (B. S. Frasao)

46

ABSTRACT

The purpose of this research was to evaluate the antioxidant potential of juçara waste

extracts to reduce oxidation processes on conventional and antibiotic-free broiler meat.

The juçara waste extracts were obtained by microwave-assistant extraction. Two different

extracts were tested based on the optimum point obtained to total phenolic content (extract

P) and the antioxidant activity (extract A). The treatments using conventional and

antibiotic-free broiler meat consisted of without antioxidant, with synthetic antioxidant

(BHT), with extract P and with extract A, totaling eight treatments. The juçara extract P

was highly effective in the stability of lipid oxidative degradation in both type of broiler

meat, which was equal successful as BHT. In addition, this extract was efficient in

reducing protein oxidation damage in conventional chicken meat. Therefore, the wastes

extract of juçara can be applied as a source of natural antioxidant to prevent the oxidative

process in conventional and antibiotic-free broiler meat.

Keywords: chicken meat; lipid oxidation; protein oxidation; phenolic compounds;

oxidation stability; color stability; natural antioxidant.

1. Introduction

Broiler meat has important nutritional characteristics, such as low saturated lipid

content and relatively high concentrations of polyunsaturated fatty acids (PUFAs)

(Nkukwana et al., 2014), which is recognized as a healthy product. However, the

predominance of unsaturated fatty acids favors the oxidation process (Bonoli, Caboni,

Rodriguezestrada, & Lercker, 2007). This mechanism is the major cause of meat

deterioration involving lipid and protein oxidation. The lipid oxidation results in rancidity

and the formation of undesirable odors and flavors and reduces sensory and nutritive

values of meat products (Nkukwana et al., 2014). The susceptibility of lipids to

peroxidation in tissue depends on the proportion of PUFA in lipid bilayers, the presence

47

of reactive oxygen species and nutritional oxidants (Brenes et al., 2008). A covalent

modification of protein induced either directly by reactive species or indirectly by

reaction with secondary by-products of oxidative stress was observed in protein oxidation

(Soladoye, Juárez, Aalhus, Shand, & Estévez, 2015). Redox imbalance and early protein

oxidation were related to meat quality (Carvalho et al., 2017).

Chickens of the conventional system were supplied with feed, although in natural

or organic systems, broilers are living in pastes and can eat vegetables and plants, which

can contain antioxidant compounds (Castellini, Mugnai, & Dal Bosco, 2002). Thus, can

be present differences in oxidative process on broiler meat of conventional and natural

creation (Cobanoglu et al., 2014). Thus, the natural rearing poultry it comes to creating

the product in free areas are grazed and fed a special diet of certified organic grains and

from the animal ingredients, without antibiotic for therapy or growth promoter (Brazilian

law nº 10,831, 23/12/2003), in the other hand boilers in conventional systems are given

processed feeds made with animal by-products and they are creating confined. The natural

rearing system reduces stress and increases the well-being and comfort is poultry. This

creation system is also related to improved sensory quality and taste of the meat

(Castellini et al., 2002). However, the natural chicken meat presents more reactant

substances of thiobarbituric acid (TBARS), with higher oxidation level (Castromán, Del

Puerto, Ramos, Cabrera, & Saadoun, 2013).

Juçara (Euterpe edulis) is a native Brazilian plant from Mata Atlântica. The

mature berries are globose and violet (Rufino et al., 2010). The strong purplish color

observed in juçara fruits can be potentially attributed to the presence of anthocyanins,

belonging to the group of flavonoids (Cavalcanti, Santos, & Meireles, 2011). Cyanidin-

3-glycoside and cyanidin-3-rutinoside are the most abundant anthocyanins in this fruit.

In addition, others bioactive compounds such as phenolic acids and tannin have been

48

identified in juçara fruit (Bicudo, Ribani, & Beta, 2014), which provide a high antioxidant

capacity to this fruit (Rufino et al., 2010). The juçara is usually marketed as pulp or juice,

during this processing, there is the production of wastes (seeds, endocarp and epicarp)

(Bicudo et al., 2014). According to Frasao, Costa, Rodrigues, Lima, & Conte-Junior et al.

(2017), the waste of Euterpe edulis can present an important antioxidant compounds. For

these reasons, the aim of this study was to evaluate the efficiency of natural antioxidants

from Euterpe edulis wastes extract to reduce lipid and protein oxidation in conventional

and natural broiler meat.

2. Material and methods

2.1 Fruit extracts

Euterpe eduli berrie wastes (epicarp and endocarp) were supplied by Juçaí

Industry (Juçaí®, Rio de Janeiro, Brazil, 22° 240 4400 S, 42° 570 5600 W) in May 2015.

The wastes were air dried at 24 ºC until constant weight (48h), and then ground utilizing

a manual grinder MSS-1B (Hario, Tokyo, Japan) (Frasao et al., 2017). Ground samples

were sieved through a 250 Mesh screen and stored at -20ºC until use.

Microwave-assistant extraction utilizing DGT 100 Plus system (Provecto

Analytics Ltda., Jundiaí, SP, Brazil) was applied to obtain juçara wastes extracts. After

the extracts were concentrated removing all ethanol in lyophilizer Edwards Pirani

501(São Paulo, Brazil). A total of two different extractions were performed, based on the

optimum point obtained when checked the total phenolic content (extract P) and the

antioxidant activity (extract A) according to previous study (Frasao et al., 2017).

49

The total phenolic (TPC), total flavonoids (TFC), total anthocyanins (TAC), and

total tannins (TTC) contents of extract were performed. The TPC values were used to

determine the quantity applied of each extract in the meat standardized 100 mg.kg-1.

2.2 Meat samples

Six kilograms of conventional (Rica® carioca da gema) and antibiotic free (Korin®

natural agriculture) broiler thighs and drumsticks were obtained. The samples were

transported in refrigerated conditions and boned. Meat with skin was ground in 8 and 6

mm. For patronization, 20% (w/w) of chicken fat was added. After that, 100 mg.kg-1 of

each extract and of BHT was added in respective treatments.

For negative control, any antioxidant was added (AFBC - antibiotic-free broiler

control and CBC - conventional broiler control); for positive control, a synthetic

antioxidant commonly used, butylated hydroxytoluene (BHT), was added (AFBP -

antibiotic-free broiler positive and CBP – conventional broiler positive); for treatments

with extract P (AFBEP - antibiotic-free broiler with TPC extract and CBEP –

conventional broiler with TPC extract); and treatments with extract A (AFBEA -

antibiotic-free broiler with antioxidant activity extract and CBEA-conventional broiler

with antioxidant activity extract) were added. Then it was mixed for one minute with a

food mixer. Then patties with 30 g were made. All samples were packaged under aerobic

conditions in polyethylene bags and were sealed with the vacuum-packaging machine

(TECMAQ, Vacuum sealer, AP 450). All samples were stored at 4±1ºC for 9 days, the

analyses were carried out on days 0, 3, 6 and 9. The experiment was carried out in

triplicate (n=3), and all analyses were also carried out in triplicate.

50

2.3. Antioxidant compounds content

Total polyphenols content was verified on extracts and on meat samples in the

days zero and nine of storage. For analysis in the chicken meat, a previous extraction of

the antioxidant compounds was performed. One gram of broiler treatments was added on

a vessel with 10 mL of methanol 95% (vol/vol) and stay under darkness for 48 hours.

The TPC was estimated based on Folin–Ciocalteu method described by

(Ainsworth & Gillespie, 2007). The absorbance values were measured at 765 nm. The

TFC was estimated by a colorimetric method developed by Chang, Yang, Wen, & Chern,

(2002). The absorbance was read at 415 and 700 nm. The TAC was estimated by the pH

differential method (Lee, Durst, & Wrolstad, 2005). Absorbance values at 520 and 700

nm were evaluated. The TTC was estimated according to Makkar (2003). The absorbance

value at 725 nm was read. A Spectrophotometer UV-1800 (Shimadzu Corporation,

Kyoto, Japan) was used. The results were expressed as mg gallic acid equivalent (GAE)

per mL of extract, mg of quercetin equivalents (QE) per mL of extract, mg cyanidin-3-

glucoside equivalents per liter of extract, and µg of tannic acid equivalents (TAE) per 100

mL of extract.

2.4 Antioxidant activity

The antioxidant capacity of extracts was evaluated in extracts using a β-carotene-

linoleic acid model system (Siraichi et al., 2013) with modifications (Frasao et al., 2017).

The absorbance of each sample was measured using a Spectrophotometer UV-1800

(Shimadzu Corporation, Kyoto, Japan) set at 470 and 700 nm immediately after sample

51

preparation (t=0 min) and at 30-min intervals until the end (t=120 min). The antioxidant

activity of extracts was expressed in percentage.

2.5. Proximate composition

The proximal composition of broiler meat matrixes was determined to

characterization. Moisture, protein content, and ash content were determined by the

Association of Official Analytical Chemist (AOAC, 2012) methods. The lipid content

was determined by Bligh & Dyer (1959).

2.6 Fatty acid profile

Fatty acid profile was determined to the characterization of broiler meat matrix.

Total lipids were obtained by a cold-extraction (Bligh & Dyer, 1959), in quadruplicate.

For methylation was used a solution with 10% HCl in methanol and hexane (Chin, Liu,

Storkson, Ha, & Pariza, 1992; Kishino, Ogawa, Ando, Omura, & Shimizu, 2002)

A gas chromatograph equipped with a flame ionization detector (Perkin Elmer,

Waltham, MA, USA) was used to analyses fatty acid methyl esters (FAME). An

OmegawaxTM 320 column (30 m length, 0.32 mm internal diameter, and 0.25 µm

particle size) (Supelco Inc., Bellefonte, PA, USA) was used to separation. The injector

and detector temperatures were set at 260 °C and 280 °C, respectively. The

chromatographic separation of 2 µl of FAMEs, 1:20 split, was achieved by gas

chromatography. The initial temperature of the oven was set at 110 °C, and the

temperature ramp was: increase from 110 to 233 °C at 40 °C/min, hold at 233 °C for 2

min, increase from 233 to 240 °C at 1 °C/min, and hold at 240 °C for 21 min. Helium was

52

used as the carrier gas at a flow rate of 1.8 mL/min (10 psi). FAME were identified

comparing the retention time of a commercial standard comprising methyl esters of 28

individual fatty acids (Supelco Inc., Bellefonte, PA, USA). The results were expressed as

relative percentage of the area (Memon, Talpur, Bhanger, & Balouch, 2011).

2.7 Oxidation processes

The lipid oxidation was carried out during storage (days 0, 3, 6 and 9) of

conventional and antibiotic-free meat samples. Quantification of substances reactive to

thiobarbituric acid (TBARS) was made in 532 nm by UV-1800 (Shimadzu Corporation,

Kyoto, Japan) in points of storage (Alcântara et al., 2015). The results were expressed as

mg of malonaldehyde (MDA) per gram of meat, based on a calibration curve.

The protein oxidation was carried out during storage (days 0, 3, 6 and 9) of

conventional and antibiotic-free broiler thigh and drumsticks meat samples. A 2,4-

Dinitrophenylhydrazine (DNPH) derivatization based assay was used to estimate total

carbonyl content (Armenteros, Heinonen, Ollilainen, Toldrá, & Estévez, 2009). The

absorbance was read at 280 nm against a bovine serum albumin standard curve, whereas

carbonyls content was calculated utilizing absorption at 370 nm and an absorptivity

coefficient for the protein hydrazones of 21.0 mM-1 cm-1. The results were expressed as

nmol of carbonyl per mg of protein.

2.8 Instrumental Color

A Minolta CM-600D spectrophotometer (Minolta Camera Co., Osaka, Japan) was

used to determinate the color parameters of samples on days 0, 3, 6 and 9 days of storage

53

at 4°C. Samples was exposed to oxygen for 5 minutes, and the sensor was mounted

directly on patties superficies to prevent ambient light noise (Zhuang & Bowker, 2016).

The color coordinates were determined: lightness (L*, 100 = white, 0 = black), redness

(a*, +red, −green), and yellowness (b*, +yellow, −blue). In addition, the chroma C*, hue

angle h°, and total color change ΔE* were also calculated (Incedayi, Tamer, Sinir, Suna,

& Çopur, 2016).

2.9 Statistical analysis

Results were reported as means ± standard deviation. Analysis of variance

(ANOVA) with Tukey test was applied to verify differences between treatments by

XLSTAT version 2013.2.03 (Addinsoft, Paris, France). Comparisons with p < 0.05 were

statically significant.

3. Results and discussion

3.1. Antioxidant compounds content and antioxidant activity of juçara extracts

The antioxidant compounds content and antioxidant activity of juçara extracts (P

and A) is presented in Table 1. Both extracts present similar content of TPC and TTC.

However, extract P presented the highest (p < 0.05) content TFC, whereas extract A

exhibited the highest (p < 0.05) TAC. In this way, the antioxidant activity of the extract

P is more related to the sum of the different antioxidant compounds (TFC, TAC and TTC),

while extract A is mainly related to the anthocyanins content (TAC). Regarding

antioxidant activity of juçara extracts, the extract A confirmed the optimal antioxidant

54

activity extraction presented the higher (p < 0.05) values compared to extract P.

Furthermore, extract A obtained antioxidant activity similar to synthetic antioxidant

(BHT) (positive control).

3.2. Broiler meat samples

3.2.1. Proximal composition and fatty acid profile

The proximate composition of treatments is shown on table 2. All treatments

present no difference (p > 0.05) in moisture and lipids content, while ash of conventional

broiler presented highest (p < 0.05) values than antibiotic-free broiler meat, and protein

present the opposite behavior (p < 0.05). These data could explain the fact of antibiotic-

free broiler meat presented high levels of protein oxidation in treatments with this matrix.

Concerning fatty acid profile, the results are shown on table 3. A similar

characteristic in this profile is also observed previously by Dalziel, Kliem, & Givens

(2015). The content of mono and polyunsaturated fatty acids in a meat matrix promote

with the lipid oxidation potential (Radha krishnan et al., 2014). This fact explained the

lipid oxidative behavior of treatments, which will be exposed future.

3.2.2. Antioxidant compounds content

Polyphenols content in broiler meat treatments is showed on table 4. TPC and

TFC values present no difference (p > 0,05) between all treatments on day 0 of storage.

The treatments with juçara waste extract addition (AFBEP, AFBEA, CBEP, CBEA)

presented the highest (p < 0.05) values of TAC and TTC, and for BHT treatments (AFBP,

55

CBP) for TCC also. The juçara fruit can be considered as a source of tannins (Frasao et

al., 2017), which can be related to their dark color. BHT is a synthetic antioxidant that

may be composed of molecules, which are identified as tannins once it size, explaining

the values found. On day 9, AFBP presented the highest (p < 0.05) TPC value, the

treatments with addition of juçara waste extracts (AFBEP, AFBEA, CBEP, CBEA) show

highest (p < 0.05) values of TFC and TAC. Regarding TTC value, AFBEP and AFBEA

presented highest (p < 0.05) values. This fact may be related to juçara fruit is considered

as a source of this compounds (Frasao et al., 2017), anthocyanins are responsible for their

purple color (Bicudo et al., 2014; Rufino et al., 2010).

During storage, AFBP and CBP show an increase (p < 0.05) on TPC. These

treatments were added with synthetic antioxidant (BHT), which are compounds of lower

complexity been broken down into smaller molecules (Cheynier, 2005), and these are

quantified.

The treatments with addition of juçara waste extracts (AFBEP, AFBEA, CBEP,

CBEA) increase (p < 0.05) TFC values when compared day 0 and 9. Broiler meat and

skin present naturally bioactive compounds (Onuh, Girgih, Aluko, & Aliani, 2014).

During storage, the muscle can undergo changes such as hydrolysis, and present its own

bioactive peptides (Fukada et al., 2016) which can be detected the flavonoids, and explain

the increase. Moreover, the flavonoids observed in the juçara extract, a natural fruit, are

more stable than the BHT used in this experiment. Once, those possibly present in the

BHT degrade more easily because they are compounds of lower complexity (Cheynier,

2005).

In addition, the control, have no addition of flavonoids, and BHT treatments have

degraded more easily, presenting no difference during storage, even though having the

formation of the bioactive peptides previously mentioned. Whereas the treatments added

56

of juçara waste extract, for having more stable compounds added to the bioactive

peptides, presenting an increase in the values of flavonoids. On the other hand, TAC

values of treatments with BHT and with juçara waste extract addition (AFBP, CBC,

AFBEP, AFBEA, CBEP, CBEA) showed a decrease (p < 0.05) during storage. This

behavior can be explained by the fact that anthocyanin can be consumed in the antioxidant

reaction, reducing the concentration of this compound. The CBP, CBEP, and CBEA

presented a decrease (p < 0.05) of TTC values. Tannins are polyphenols that precipitate

proteins and other macromolecules (Salminen, Karonen, & Sinkkonen, 2011). Since the

treatments made with conventional chicken presented higher contents of dry extract

(ashes), and tannins can be precipitate macromolecules, tannins compounds may have

been consumed in this reaction. Regarding the observed reduction in the values of the

treatment with BHT (CBP), it can be explained by the fact that the synthetic compounds

are less stable than the natural compounds derived from plants (Onuh et al., 2014).

Respect to the relevant equivalent quantification of polyphenols compounds

(TPC, TFC, TAC, and TTC) in the control treatments (AFBC and CBC), it may be related

to the fact that the dark musculature of the chicken presents molecules with antioxidant

properties (Fukada et al., 2016) and can be detected in these analyzes.

3.2.3. Lipid and protein oxidation

Through meat storage, the rancidity process is characterized as lipid oxidation,

which occurs in the double bond sites of triacylglycerol (Sohaib et al., 2017). All

treatments showed an increase in lipid oxidation during storage (Fig. 1A). AFBC

presented 1.40 to 7.77, AFBP 0.86 to 4.22, AFBEP 1.02 to 2.20, AFBEA 0.82 to 3.82,

57

CBC 0.69 to 2.92, CBP 0.71 to 1.95, CBEP 1.25 to 2.34, CBEA 0.85 to 3.01 mgMDA.g-

1 on day zero and nine, respectively.

On all storage days, the AFBC present the highest (p < 0.05) oxidation value, 1.40,

4.14, 5.68, 7.77 mgMDA.g-1, days 0, 3, 6, and 9, respectively. Średnicka-Tober et al.

(2016) point to a higher oxidation in organic broiler meat compared to the oxidation in

conventional chicken, by the fact of highest values of polyunsaturated fatty acid (PUFA)

on organic that predispose the lipid oxidation (Penko et al., 2015). Antibiotic-free broiler

meat shows highest values of PUFA (19.35%) than conventional (16.45%), explaining

the lipid oxidation values (Figure 1).

While on day 3 of storage the AFBP, AFBEP, AFBEA, CBC, CBP, CBEP, and

CBEA, and on day 6 of storage AFBEP, AFBEA, CBC, CBP, CBEP, and CBEA present

the lowest (p < 0.05) values of oxidation. BHT showed to be more efficient (p < 0.05) in

the reduction of lipid oxidation at the end of storage (day 9). However, the juçara waste

extract showed highest (p < 0.05) antioxidant activity on antibiotic-free broiler meat when

compared to the control (AFBC) without antioxidant. Although no difference (p > 0.05)

in the treatment with the use of synthetic (AFBP) and natural antioxidants (AFBEP and

AFBEA) was observed, its values of oxidation are similar. In addition, AFBEP and CBEP

values are close to CBP. On this way, we can suggest that the juçara waste extracts,

especially the one with the optimal extraction of TPC present as efficient antioxidant

action as the BHT. Therefore, it can be used as an antioxidant in chicken meat.

Lipid oxidation process modifies the chemical properties of particles, bring forth

loss of function or producing peroxides and aldehydes (Sohaib et al., 2017). Nevertheless,

the concentration of reaction substrates, prooxidant and antioxidant compounds content,

and the composition of the matrix, interfere to the oxidative stability, principle in complex

food matrixes as meat (Ramana, Srivastava, & Singhal, 2017). Therefore, the extract TPC

58

of juçara waste may be a technological alternative to promote lipid oxidation stability and

bring benefit to the consumer health.

The degree of protein oxidation in the treatments was verified determining nmol

of carbonyl per mg of protein. The treatments showed an increase (p < 0.05) in protein

oxidation during storage (Fig. 1B). Carbonyls generation is the most common damage to

oxidized proteins. These compounds were generated principle by oxidative deterioration

of amino acid (lysine, proline, histidine and arginine), and interfere with and impair the

function of the meat protein (Zhang, Xiao, & Ahn, 2013).

However, from day 3 to the end (day 9) of storage (Fig. 1B), AFBC (2.01, 2.06,

2.16, respectively), AFBP (1.67, 2.14, 2.24, respectively), AFBEP (1.82, 2.02, 2.31,

respectively), and AFBEA (1.90, 2.27, 2.27, respectively) showed the lowest values,

remaining stable (p > 0.05) until day 9. This fact may be related to the poultry breeding

system (Castellini et al., 2002). However, studies aimed at identifying the molecules that

may be responsible for this stability and its action must be performed to confirm this

characteristic.

On the contrary, CBC (without antioxidant) presented the highest (p < 0.05)

values, showing a high protein oxidation level in conventional broiler meat. CBP and

CBEP, from day 3 until the end (day 9) of storage, presented protein oxidation stability

(p > 0.05). Whereas, the CBEA treatment showed an increase (p < 0.05) of the levels of

protein oxidation in the points of analyses, becoming similar (p > 0.05) to the control

treatment (CBC) at the end of the storage period (day 9). Even though the CBP and CBEP

treatments did not differ statistically from the other treatments, it presents lower protein

oxidation values than the CBC and CBEA treatments. Hence, we propose that the extract

with optimal extraction of phenolic compounds (Extract P) presents an activity in the

reduction of protein oxidation similar to the synthetic antioxidant (BHT), being able to

59

be applied, once the oxidative process in food can be stabilized by addition of antioxidants

(Sohaib et al., 2017). Therefore, the extract TPC of juçara waste may be a technological

alternative to promote protein oxidation stability and bring benefit to the consumer health.

No research that used juçara waste extract as a preservative to stabilize the

oxidation processes applied directly on the poultry meat or meat and derivates were

found. The studies fund apply natural antioxidants from Quercus ilex L. subsp. Ballota,

Origanum vulgare extract, Salvia officinalis leaves, honey, and rose polyphenols (Feng

et al., 2016; Ferreira et al., 2017; Sampaio, Saldanha, Soares, & Torres, 2012; Zhang et

al., 2017). Therefore, this study is innovative, although more research related to this

application must be carried out.

3.2.4. Color characterization

The color, in meat, is an attribute directly related to the quality of the product,

interfering with consumer choice. Different factors can influence food color, as the

physical, chemical, biochemical and microbial, which can variety with post-mortem

process, maturation, microorganism growth, and storage (Feng et al., 2016). The color

characteristics of the treatments are shown in fig. 2.

Lightness value (L*) of AFBC and AFBEA did not differ (p > 0.05) during storage

in each one. The other treatments present a reduction (p < 0.05) on this values from the

beginning to the end of storage period. The reduction on AFBEP, CBEP and CBEA can

be explained by the presence of a waste extract of juçara, and the reaction of compounds

leading to darkening of the broiler meat. Moreover, a deposition of extract pigments can

be related to, once juçara waste extract show high levels of anthocyanins (Frasao et al.,

2017), a purple pigment. At the end of the storage period (day 9), no difference (p > 0.05)

60

was observed between the treatments. Therefore, the addition of the extract did not

interfere with the lightness of the meat when compared with controls at the end of storage

period.

Redness value (a*) on day 0 present difference (p < 0.05) between treatments.

CBC and CBP shows higher values, whereas AFBC and AFBP lowest. And AFBEP,

AFBEA, CBEP and CBEA did not differ (p > 0.05) between them but also other

treatments. The similarity between juçara treatments can be related to the presence of

compounds content on the extract, as flavonoids. This compounds coloring ranging from

pink to light red (Rufino et al., 2010). At the end of storage (day 9), AFBC shows the

highest (p < 0.05) values and, AFBEA and CBEP the lowest (p < 0.05) when compare

between treatments. During storage was observed an increase (p < 0.05) of this parameter

on AFBC and decrease (p < 0.05) on AFBEP, AFBEA, CBC, CBP, CBEP and CBEA

treatments at days 0 and 9. This behavior can be related to meat discoloration during the

storage period, potentially due oxidation of myoglobin molecule (Joseph, Suman,

Rentfrow, Li, & Beach, 2012).

Yellowness values (b*) be stable (p > 0.05) for treatments, except (p < 0.05)

AFBEP and AFBEA, during storage period. The decrease of this value can be related to

the presence of dark pigments that are distant from yellow and approach blue, such as

anthocyanin, which are purple pigments (Rufino et al., 2010). On day 0 the AFBC and

AFBP (p < 0.05) showed lowest values than other treatments. At the end of storage (day

9) AFBP still shows the lowest (p < 0.05) values, and CBEA shows the highest (p < 0.05).

In conventional broiler production systems, the feed is mostly with corn-based feed, with

right levels of carotenoids (Castromán et al., 2013), which results in an increase on

yellowness value of this meat.

61

Regarding the Chroma, value is obtained by a* and b* values (Incedayi et al.,

2016), the observed increased (p < 0.05) of AFBC during storage is related to the fact of

it present same behavior of a* value. And decreased of AFBEP and AFBEA treatments,

relate to the same behavior of a* and b* values, that shows a decrease (p < 0.05) too.

When compare treatments on day zero of storage AFBC and AFBP showed the lowest (p

< 0.05) values, whereas on day 9 of storage AFBP presented the lowest (p < 0.05) and

CBEA showed highest (p < 0.05). So, this parameter behavior was related to the value

observed in a* and b* at this point.

Hue angle values (hº) is expressed in degrees starting in red (0º), with a gradual

increase to yellow (90º), green (180º) and blue (270º) colors (Incedayi et al., 2016).

During the storage period, AFBC shows a decrease (p < 0.05), while AFBEA, CBC, CBP,

and CBEP show an increase on h º values. On day 0 AFBC, AFBP and CBEA present

highest values, whereas CBC and CBP show lowest. On day 9 of storage, AFBC present

lowest value, while CBEP present highest. In spite of this variation, all treatments present

values near 90º (yellow), corroborating with the coloration of the chicken meat, which

had low concentrations of myoglobin (Carvalho et al., 2017; Joseph et al., 2012), being

classified as white meat instead of red meat.

Considering the ΔE* value is obtained by L*, a* and b* values (Incedayi et al.,

2016). On day 0 of storage CBP present the highest (p < 0.05) value of total color changes,

whereas AFBC, AFBEP, AFBEA shows the lowest values, it can be related to the results

observed in a* and b*, since they are used to obtain the values of ΔE*. On day 9 of

storage, no difference (p > 0.05) was observed between the treatments, this is related to

same behavior also observed in L*, since this variable is used in the parameter calculation.

During storage time (9 days) AFBP, CBC, CBP, CBEP, and CBEA shows a decrease on

62

total color changes the value. This parameter behavior was related to the value observed

in a* parameter of this treatments.

The muscle structure and pigment concentration interfere on color changes in

meat and meat products (Feng et al., 2016; Ferreira et al., 2017). In this study, the

variations observed in treatments with juçara extract can be attributed to the presence of

some pigments as anthocyanin. Furthermore, variations on color parameters in control

treatment of antibiotic-free broiler meat can be related to the high oxidation processes

observed, changing the muscle structure.

4. Conclusion

The addition of juçara waste extract with the optimal extraction of phenolic

compounds in conventional and antibiotic-free broiler meat was highly effective in the

stability of lipid oxidation. In addition, this extract was efficient in reducing protein

oxidation damage in conventional chicken meat. In this way, we can conclude that this

Euterpe edulis waste extract exhibited high impact on the oxidative stability of broiler

meat. Therefore, the juçara waste can be used as a source of natural antioxidants for

application in chicken meat to prevent oxidative processes improving meat quality.

Acknowledgments: Juçara samples were supplied by Juçaí Industry (Juçaí®, Rio de

Janeiro, Brazil).

Funding This work was supported by the Coordination of Enhancement of People of a

Superior Level [process nº. 125, CAPES/Embrapa 15/2014, CAPES, Brazil], Research

Foundation of the State of Rio de Janeiro [process nº. E-26/201.185/2014, FAPERJ,

63

Brazil], the National Council of Technological and Scientific Development [processes nº.

311361/2013-7, 311422/2016-0 and 150200/2017-0, CNPq, Brazil].

Conflict of interest: Authors declared no conflict of interest.

References

Ainsworth, E. A., & Gillespie, K. M. (2007). Estimation of total phenolic content and

other oxidation substrates in plant tissues using Folin–Ciocalteu reagent. Nature

Protocols, 2(4), 875–877. https://doi.org/10.1038/nprot.2007.102

Alcântara, A. V. de, Azevedo, P. L., Mársico, E. T., Monteiro, M. L., Rodrigues, B. L.,

& Conte Junior, C. A. (2015). Comparative Study on Total Lipid Quantification and

Oxidative Rancidity Determination in Freshwater Fish Species with Different Fat

Levels. Journal of Food Studies, 4(1), 34. https://doi.org/10.5296/jfs.v4i1.8362

AOAC. (2012). Official Methods of analysis (19th ed.). Washington, DC: Association

of Official Agricultural Chemists.

Armenteros, M., Heinonen, M., Ollilainen, V., Toldrá, F., & Estévez, M. (2009).

Analysis of protein carbonyls in meat products by using the DNPH-method,

fluorescence spectroscopy and liquid chromatography–electrospray ionisation–mass

spectrometry (LC–ESI–MS). Meat Science, 83(1), 104–112.

https://doi.org/10.1016/j.meatsci.2009.04.007

Bicudo, M. O. P., Ribani, R. H., & Beta, T. (2014). Anthocyanins, Phenolic Acids and

Antioxidant Properties of Juçara Fruits (Euterpe edulis M.) Along the On-tree Ripening

Process. Plant Foods for Human Nutrition, 69(2), 142–147.

https://doi.org/10.1007/s11130-014-0406-0

Bligh, E. G., & Dyer, W. J. (1959). A rapid method of total lipid extraction and

purification. Canadian Journal of Biochemistry and Physiology, 37(8), 911–917.

Bonoli, M., Caboni, M., Rodriguezestrada, M., & Lercker, G. (2007). Effect of feeding

fat sources on the quality and composition of lipids of precooked ready-to-eat fried

chicken patties. Food Chemistry, 101(4), 1327–1337.


Brenes, A., Viveros, A., Goni, I., Centeno, C., Sayago-Ayerdy, S. G., Arija, I., & Saura-

Calixto, F. (2008). Effect of Grape Pomace Concentrate and Vitamin E on Digestibility

of Polyphenols and Antioxidant Activity in Chickens. Poultry Science, 87(2), 307–316.

https://doi.org/10.3382/ps.2007-00297

Carvalho, R. H., Ida, E. I., Madruga, M. S., Martínez, S. L., Shimokomaki, M., &

Estévez, M. (2017). Underlying connections between the redox system imbalance,

64

protein oxidation and impaired quality traits in pale, soft and exudative (PSE) poultry

meat. Food Chemistry, 215, 129–137. https://doi.org/10.1016/j.foodchem.2016.07.182

Castellini, C., Mugnai, C., & Dal Bosco, A. (2002). Effect of organic production system

on broiler carcass and meat quality. Meat Science, 60(3), 219–225.

Castromán, G., Del Puerto, M., Ramos, A., Cabrera, M. C., & Saadoun, A. (2013).

Organic and conventional chicken meat produced in Uruguay: Colour, ph, fatty acids

composition and oxidative status. American Journal of Food and Nutrition, 1(2), 12–21.

Cavalcanti, R. N., Santos, D. T., & Meireles, M. A. A. (2011). Non-thermal

stabilization mechanisms of anthocyanins in model and food systems—An overview.

Food Research International, 44(2), 499–509.

https://doi.org/10.1016/j.foodres.2010.12.007

Chang, C.-C., Yang, M.-H., Wen, H.-M., & Chern, J.-C. (2002). Estimation of total

flavonoid content in propolis by two complementary colorimetric methods. Journal of

Food and Drug Analysis, 10(3). Retrieved from

http://search.proquest.com/openview/8ed5f78aa3317908039c7a8ca3740050/1?pq-

origsite=gscholar

Cheynier, V. (2005). Polyphenols in foods are more complex than often thought. The

American Journal of Clinical Nutrition, 81(1), 223S–229S.

Chin, S. F., Liu, W., Storkson, J. M., Ha, Y. L., & Pariza, M. W. (1992). Dietary

sources of conjugated dienoic isomers of linoleic acid, a newly recognized class of

anticarcinogens. Journal of Food Composition and Analysis, 5(3), 185–197.

Cobanoglu, F., Kucukyilmaz, K., Cinar, M., Bozkurt, M., Catli, A. U., & Bintas, E.

(2014). Comparing the profitability of organic and conventional broiler production.

Revista Brasileira de Ciência Avícola, 16(1), 89–95.

Feng, L., Shi, C., Bei, Z., Li, Y., Yuan, D., Gong, Y., & Han, J. (2016). Rosemary

Extract in Combination with ɛ-Polylysine Enhance the Quality of Chicken Breast

Muscle during Refrigerated Storage. International Journal of Food Properties, 19(10),

2338–2348. https://doi.org/10.1080/10942912.2015.1130053

Ferreira, V. C. S., Morcuende, D., Hérnandez-López, S. H., Madruga, M. S., Silva, F.

A. P., & Estévez, M. (2017). Antioxidant Extracts from Acorns ( Quercus ilex L.)

Effectively Protect Ready-to-Eat (RTE) Chicken Patties Irrespective of Packaging

Atmosphere: Acorn as antioxidant in convenience food…. Journal of Food Science,

82(3), 622–631. https://doi.org/10.1111/1750-3841.13640

Frasao, B. D. S., Costa, M. P. da, Rodrigues, B. L., Lima, B. R. C., & Conte-Junior, C.

A. (2017). Natural Antioxidant Activity and Compounds Content from Wastes of

Euterpe edulis Berries. Journal of Agricultural Science, 9(3), 178.

https://doi.org/10.5539/jas.v9n3p178

Fukada, Y., Mizutani, S., Nomura, S., Hara, W., Matsui, R., Nagai, K., … Terashima,

M. (2016). Antioxidant activities of a peptide derived from chicken dark meat. Journal

65

of Food Science and Technology, 53(5), 2476–2481. https://doi.org/10.1007/s13197-

016-2233-9

Incedayi, B., Tamer, C. E., SINIR, G. Ö., Suna, S., & ÇOPUR, Ö. U. (2016). Impact of

different drying parameters on color, β-carotene, antioxidant activity and minerals of

apricot (Prunus armeniacaL.). Food Science and Technology (Campinas), 36(1), 171–

178.

Joseph, P., Suman, S. P., Rentfrow, G., Li, S., & Beach, C. M. (2012). Proteomics of

Muscle-Specific Beef Color Stability. Journal of Agricultural and Food Chemistry,

60(12), 3196–3203. https://doi.org/10.1021/jf204188v

Kishino, S., Ogawa, J., Ando, A., Omura, Y., & Shimizu, S. (2002). Ricinoleic Acid

and Castor Oil as Substrates for Conjugated Linoleic Acid Production by Washed Cells

of Lactobacillus plantarum. Bioscience, Biotechnology, and Biochemistry, 66(10),

2283–2286. https://doi.org/10.1271/bbb.66.2283

Lee, J., Durst, R. W., & Wrolstad, R. E. (2005). Determination of total monomeric

anthocyanin pigment content of fruit juices, beverages, natural colorants, and wines by

the pH differential method: collaborative study. Journal of AOAC International, 88(5),

1269–1278.

Makkar, H. P. (2003). Quantification of tannins in tree and shrub foliage: a laboratory

manual. Springer Science & Business Media. Retrieved from

http://books.google.com/books?hl=en&lr=&id=hvulr-

9ok_wC&oi=fnd&pg=PR1&dq=%22Preparation+of+sample+for+determination+of+ga

llic+acid+present+in+free+and%22+%22for+quantification+of+tannins+may+be+based

+on+the+chemical+properties+of%22+%22or+by%22+&ots=FhxznH3aVK&sig=nAJ

GRZDcKXtQD2jb37U_UKqfTl0

Memon, N. N., Talpur, F. N., Bhanger, M. I., & Balouch, A. (2011). Changes in fatty

acid composition in muscle of three farmed carp fish species (Labeo rohita, Cirrhinus

mrigala, Catla catla) raised under the same conditions. Food Chemistry, 126(2), 405–

410. https://doi.org/10.1016/j.foodchem.2010.10.107

Nkukwana, T. T., Muchenje, V., Masika, P. J., Hoffman, L. C., Dzama, K., & Descalzo,

A. M. (2014). Fatty acid composition and oxidative stability of breast meat from broiler

chickens supplemented with Moringa oleifera leaf meal over a period of refrigeration.

Food Chemistry, 142, 255–261. https://doi.org/10.1016/j.foodchem.2013.07.059

Onuh, J. O., Girgih, A. T., Aluko, R. E., & Aliani, M. (2014). In vitro antioxidant

properties of chicken skin enzymatic protein hydrolysates and membrane fractions.

Food Chemistry, 150, 366–373. https://doi.org/10.1016/j.foodchem.2013.10.107

Penko, A., Polak, T., Lušnic Polak, M., Požrl, T., Kakovič, D., Žlender, B., & Demšar,

L. (2015). Oxidative stability of n-3-enriched chicken patties under different package-

atmosphere conditions. Food Chemistry, 168, 372–382.


66

Ramana, K. V., Srivastava, S., & Singhal, S. S. (2017). Lipid Peroxidation Products in

Human Health and Disease 2016. Oxidative Medicine and Cellular Longevity, 2017, 1–

2. https://doi.org/10.1155/2017/2163285

Rufino, M. do S. M., Alves, R. E., de Brito, E. S., P?rez-Jim?nez, J., Saura-Calixto, F.,

& Mancini-Filho, J. (2010). Bioactive compounds and antioxidant capacities of 18 non-

traditional tropical fruits from Brazil. Food Chemistry, 121(4), 996–1002.


Salminen, J.-P., Karonen, M., & Sinkkonen, J. (2011). Chemical Ecology of Tannins:

Recent Developments in Tannin Chemistry Reveal New Structures and Structure-

Activity Patterns. Chemistry - A European Journal, 17(10), 2806–2816.

https://doi.org/10.1002/chem.201002662

Sampaio, G. R., Saldanha, T., Soares, R. A. M., & Torres, E. A. F. S. (2012). Effect of

natural antioxidant combinations on lipid oxidation in cooked chicken meat during

refrigerated storage. Food Chemistry, 135(3), 1383–1390.


Siraichi, J. T. G., Felipe, D. F., Brambilla, L. Z. S., Gatto, M. J., Terra, V. A., Cecchini,

A. L., … Cortez, D. A. G. (2013). Antioxidant Capacity of the Leaf Extract Obtained

from Arrabidaea chica Cultivated in Southern Brazil. PLoS ONE, 8(8), e72733.

https://doi.org/10.1371/journal.pone.0072733

Sohaib, M., Anjum, F. M., Arshad, M. S., Imran, M., Imran, A., & Hussain, S. (2017).

Oxidative stability and lipid oxidation flavoring volatiles in antioxidants treated chicken

meat patties during storage. Lipids in Health and Disease, 16(1).

https://doi.org/10.1186/s12944-017-0426-5

Soladoye, O. P., Juárez, M. L., Aalhus, J. L., Shand, P., & Estévez, M. (2015). Protein

Oxidation in Processed Meat: Mechanisms and Potential Implications on Human

Health: Protein oxidation, nutrition, and health…. Comprehensive Reviews in Food

Science and Food Safety, 14(2), 106–122. https://doi.org/10.1111/1541-4337.12127

Średnicka-Tober, D., Barański, M., Seal, C., Sanderson, R., Benbrook, C., Steinshamn,

H., … Leifert, C. (2016). Composition differences between organic and conventional

meat: a systematic literature review and meta-analysis. British Journal of Nutrition,

115(06), 994–1011. https://doi.org/10.1017/S0007114515005073

Zhang, Q. Q., Jiang, M., Rui, X., Li, W., Chen, X. H., & Dong, M. S. (2017). Effect of

rose polyphenols on oxidation, biogenic amines and microbial diversity in naturally dry

fermented sausages. Food Control, 78, 324–330.

https://doi.org/10.1016/j.foodcont.2017.02.054

Zhang, W., Xiao, S., & Ahn, D. U. (2013). Protein Oxidation: Basic Principles and

Implications for Meat Quality. Critical Reviews in Food Science and Nutrition, 53(11),

1191–1201. https://doi.org/10.1080/10408398.2011.577540

Zhuang, H., & Bowker, B. (2016). Effect of marination on lightness of broiler breast

fillets varies with raw meat color attributes. LWT - Food Science and Technology, 69,

233–235. https://doi.org/10.1016/j.lwt.2016.01.054

67

Table 1 Antioxidant compounds and antioxidant activity of Juçara (Euterpe edulis) wastes extracts

Extracts TPC1 TFC2 TAC3 TTC4 Antioxidant Activity 5

0 min 30 min 60 min 90 min 120 min

Extract P 2.39±0.07 A,a 2.68±0.01 A,a 0.84±0.01 C,b 0.62±0.08 C,a 100.00±0.10 A,a 82.13±0.02 B,b 68.46 ±0.07 C,b 58.06 ±0.11 D,b 49.80 ±0.10 E,b

Extract A 2.16±0.06 A,a 1.11±0.08 B,b 0.91±0.01 C,a 0.61±0.04 C,a 100.00±0.05 A,a 94.26±0.12 B,a 89.90 ±0.13 BC,a 85.94 ±0.10 CD,a 81.31 ±0.11 D,a

BHT - - - - 100.00±0.02 A,a 91.57±0.12 B,a 87.31±0.10 C,a 84.05±0.13 CD,a 80.27±0.12 E,a

All results are the means ± SD (n = 3). 1(mgGAE.mL-1); 2(mgQE. mL -1); 3(mgC3QE. L -1); 4(µgTAE.100mL-1); 5(AA%)

a-b Same letters prescribe that there was no difference between the lines results; different letters determine the difference.

A-E Same letters prescribe that there was no difference between the columns results; different letters determine the difference.

Extract P is Euterpe edulis extract obtained with the optimal extraction of TPC yield

Extract A is Euterpe edulis extract obtained with the optimal extraction of antioxidant activity yield.

BHT is a positive control used for determine antioxidant activity

68

Table 2 Proximate composition of broiler meat treatments

Treatments Moisture Lipid Ash Protein

AFBC 71.87±0.40a 8.31±0.50a 0.79±0.04 b 21.99±0.04 a

AFBP 72.19±0.31a 8.71±0.28a 0.76±0.05 b 21.96±0.05 a

AFBEP 69.73±0.34a 8.26±0.62a 0.81±0.03 b 21.91±0.03 a

AFBEA 69.73±0.87a 8.66±0.40a 0.80±0.05 b 21.90±0.05 a

CBC 71.87±0.03a 7.82±0.18a 1.20±0.15a 19.05±0.17 b

CBP 71.87±0.54a 8.35±0.30a 1.15±0.09a 19.04±0.53 b

CBEP 69.26±0.66a 7.77±0.86a 1.15±0.10a 19.05±0.01 b

CBEA 69.44±0.41a 8.43±0.64a 1.10±0.04a 19.05±0.01 b

All results are the means ± SD (n = 3).

Means that do not share a letter are significantly different

AFBC-antibiotic-free broiler control; CBC-conventional broiler control; AFBP- antibiotic-free broiler with

BHT; CBP – conventional broiler with BHT; AFBEP-antibiotic-free broiler with TPC optimal extract;

CBEP – conventional broiler with TPC optimal extract; AFBEA-antibiotic-free broiler with antioxidant

activity optimal extract; CBEA-conventional broiler with antioxidant activity optimal extract.

Results are expressed in percentage.

69

Table 3 Fatty acid profile of broiler meat matrixes

Broiler meat

Antibiotic Free Conventional

C6:0 2.35±0.09 A 2.31±0.19 A

C8:0 0.26±0.01A 0.26±0.03 A

C10:0 0.63±0.01A 0.74±0.02 A

C11:0 0.30±0.01 A 0.31±0.04 A

14:0 42.20±2.42 B 54.99±2.54 A

16:0 13.55±1.34 A 9.57±1.43 B

16:1 1.83±0.29 A 0.70±0.19 B

17:0 1.57±0.10 A 1.40±0.12 A

18:0 0.65±0.12 A 0.11±0.02 B

18:1n7 7.35±0.76 A 5.12±0.35 B

18:1n9 9.59±0.67 A 7.87±0.47 B

18:2n6 12.83±1.54 A 9.62±1.50 B

18:3n6 0.75±0.12 A 0.70±0.02 A

18:3n3 0.28±0.12 A 0.16±0.02 A

20:1 0.37±0.09 A 0.17±0.03 B

20:2 0.23±0.01 A 0.14±0.01 A

20:3n6 2.99±0.50 A 2.16±0.43 A

20:4n6 1.67±0.53 B 3.21±0.33 A

22:2 0.36±0.01 A 0.31±0.03 A

DHA (22:6n3) 0.24±0.03 A 0.14±0.02 A

∑ SFA 61.51±0.30 B 69.69±0.32 A

∑ MUFA 19.14±0.25 A 13.86±0.17 B

∑ PUFA 19.35±0.23 A 16.45±0.21 B SFA = saturated fatty acid; MUFA = monounsaturated fatty acid; PUFA = polyunsaturated fatty acid; DHA

= docosahexaenoic acid

All results are the means ± SD (n = 3), g/100 g fatty acids.

Means that do not share a letter are significantly different.

70

Table 4 Antioxidant compounds content in natural and conventional broiler meat at days 0 and 9 storage at 4±1ºC

Analysis Day Antibiotic Free Conventional

AFBC AFBP AFBEP AFBEA CBC CBP CBEP CBEA

TPC1 0 22.22±1.04 A,a 22.26±3.38 A,b 24.16±1.61 A,a 23.25±3.18 A,a 18.82±1.95 A,a 18.74±1+85 A,b 23.32±2.30 A,a 20.72±2.94 A,a

9 36.91±1.94 AB,a 43.00±1.21 A,a 26.54±1.54 B,a 28.13±4.32 B,a 25.07±1.24 B,a 35.30±1.14 AB,a 25.00±3.99 B,a 29.66±1.75 B,a

TFC2 0 36.76±3.46 A,a 35.24±3.30 A,a 34.88±6.01 A,b 29.63±3.65 A,b 30.22±2.05 A,a 35.05±3.19 A,a 31.66±6.56 A,b 34.54±6.21 A,b

9 36.12±1.19 B,a 42.78±1.29 B,a 59.92±3.59 A,a 50.89±6.30 A,a 35.99±4.11 B,a 42.17±6.87 B,a 56.70±6.32 A,a 54.48±1.98 AB,a

TAC3 0 3.42±0.17 C,a 4.36±0.41 BC,a 11.86±1.96 A,a 13.19±1.77 A,a 3.74±0.89 C,a 5.36±0.75 B,a 7.29±1.89 B,a 5.11±1.36 B,a

9 1.04±0.15 B,a 0.95±0.08 B,b 2.55±0.03 A,b 2.69±0.12 A,b 1.66±0.01 AB,a 1.06±0.01 B,b 2.76±0.07 A,b 2.02±0.09 A,b

TTC4 0 0.33±0.00 B,b 0.48±0.00 A,a 0.49±0.00 A,a 0.51±0.00 A,a 0.28±0.00 B,b 0.45±0.00 A,a 0.60±0.00 A,a 0.46±0.00 A,a

9 0.34±0.00 B,b 0.45±0.00 B,a 0.50±0.00 A,a 0.63±0.00 A,a 0.27±0.00 B,b 0.24±0.00 B,b 0.21±0.00 B,b 0.21±0.00 B,b All results are the means ± SD (n = 3). 1(mgGAE.g-1); 2(mgQE. g -1); 3(mgC3QE. 100g -1); 4(µgTAE.100g-1)

a-b Same letters prescribe that there was no difference between the lines results; different letters determine the difference.

A-B Same letters prescribe that there was no difference between the columns results; different letters determine the difference.

AFBC-antibiotic-free broiler control; CBC-conventional broiler control; AFBP- antibiotic-free broiler with BHT; CBP – conventional broiler with BHT; AFBEP-antibiotic-free

broiler with TPC optimal extract; CBEP – conventional broiler with TPC optimal extract; AFBEA-antibiotic-free broiler with antioxidant activity optimal extract; CBEA-

conventional broiler with antioxidant activity optimal extract.

71

Figures

Fig.1. Oxidation of broiler meat treatments during storage at 4ºC, for 10 days. (A) Lipid

oxidation. (B) Protein oxidation. All results are the means with standard deviation (n = 3).

a-b Same letters prescribe that there was no difference between the treatments in the same day results within

the analysis; different letters determine the difference.

A-D Same letters prescribe that there was no difference between the days results within the analysis;

different letters determine the difference.

AFBC-antibiotic-free broiler control; CBC-conventional broiler control; AFBP- antibiotic-free broiler with

BHT; CBP – conventional broiler with BHT; AFBEP-antibiotic-free broiler with TPC optimal extract;

CBEP – conventional broiler with TPC optimal extract; AFBEA-antibiotic-free broiler with antioxidant

activity optimal extract; CBEA-conventional broiler with antioxidant activity optimal extract.

mgMDA.g-1= miligrams of malonaldeyde per grams of broiler meat.

nmolCnyl.mg-1= nano mols of carbonyl per miligrams of broiler meat protein.

72

Fig.2. Color characterization of broiler treatments during 10 days storage at 4 ºC. (A) Lightness value (L*), (B) Redness value (a*), (C) Yellowness

value (b*), (D) Chroma values (C*), (E) Hue Angle values (hº), (F) Total Color Change values (ΔE*). All results are the means ± SD (n = 3).

a-d Same letters prescribe that there was no difference between the treatments in the same day results within the analysis; different letters determine the difference.

A-C Same letters prescribe that there was no difference between the days results within the analysis; different letters determine the difference.

73

AFBC-antibiotic-free broiler control; CBC-conventional broiler control; AFBP- antibiotic-free broiler with BHT; CBP – conventional broiler with BHT; AFBEP-antibiotic-free

broiler with TPC optimal extract; CBEP – conventional broiler with TPC optimal extract; AFBEA-antibiotic-free broiler with antioxidant activity optimal extract; CBEA-

conventional broiler with antioxidant activity optimal extract.

74

3.3 ARTIGO III

O artigo intitulado “Caryocar brasiliense and Euterpe edulis wastes as natural

antioxidant source for pre-oxidized antibiotic free broiler meat” está submetido à revista

Food Control.

Food Control

Caryocar brasiliense and Euterpe edulis wastes as natural antioxidant source for

pre-oxidized antibiotic free broiler meat

Beatriz da Silva Frasaoa,*, Marion Pereira da Costab, Fabricio de Oliveira Silvac, Bruna

Leal Rodriguesa, Jéssica Diogo Baltarc, Jasmim Valéria Arcanjo Araujoa, Daniel

Perronec, Renata Torrezand, Carlos Adam Conte-Juniora,c,e

a Department of Food Technology, Faculty of Veterinary, Universidade Federal

Fluminense, Rua Vital Brasil Filho, 54, 24230-340, Niteroi, Rio de Janeiro, Brazil.

b Department of Preventive Veterinary Medicine and Animal Production, School of

Veterinary Medicine and Zootecnia, Universidade Federal da Bahia, Avenida Adhemar

de Barros, 500, 40170-110, Ondina, Salvador, Brazil


Avenida Athos da Silveira Ramos, 419, 21941-909, Cidade Universitária, Rio de Janeiro,

Brazil.

d Embrapa Food Technology, Brazilian Agricultural Research Corporation, Avenida das

Américas, 29,501, 23020-470, Guaratiba, Rio de Janeiro, Brazil.

e National Institute for Health Quality Control, Oswaldo Cruz Foundation (FIOCRUZ),

Avenida Brasil 4,365, 21040-900, Rio de Janeiro, RJ, Brazil.


Beatriz da Silva Frasao, D.V.M., M.D.

Fluminense Federal University, Brazil.


Tel: +55 21 26299545


75

ABSTRACT

The aim of this study was to determine the potential of waste extracts from the pequi

(Caryocar brasiliense) and juçara (Euterpe edulis) to reduce oxidation processes in

antibiotic free broiler meat. Once, the use of natural antioxidants extracted from fruits

processing wastes has been neglected, and these residues present high content of these

bioactive compounds, however, they are often discarded by the industry. The samples

were previously submitted to UV-C radiation, 1.161 mW / cm² for 10 minutes, with the

purpose of accelerating the rancidity process. Pequi and juçara waste extracts were

obtained by microwave-assistant extraction (MAE). A total of four treatments were made

with antibiotic free broiler thighs and drumstick meat: BC – with any antioxidant

(Negative control), BP – with BHT (Positive control), BE – with juçara extract, BCb –

with pequi extract. Color, pH, lipid and protein oxidation (days 0, 2, 4, 6, 8 and 10),

antioxidants contents and activity (days 0 and 10), proximal composition and fatty acid

profile (day 0) were carried out. Pequi waste extract presents highest antioxidants content

and activity. BE and BCb treatments present highest total phenolic (TPC) and flavonoids

(TFC) content, and BE present highest total monomeric anthocyanins content (TAC).

TFC increased during storage in all treatments. Waste extracts of C. brasiliense presented

the highest antioxidant activity on lipidic oxidation for antibiotic free broiler meat.

Moreover, both extracts presented high antioxidant activity on protein oxidation. Thus,

despite the pequi bark extract has a better action on the oxidation reduction both, this

extract and the juçara wastes extract can be used as a technological strategy to reduce the

oxidative process in antibiotic free broiler meat for poultry industry.

Keywords: Antibiotic free chicken, oxidation stability, phenolic compounds, UV-C

radiation, color.

76

1. Introduction

The oxidation is a major cause of chicken meat spoilage during storage time

(Sebranek, Sewalt, Robbins, & Houser, 2005). Thus, lipid and protein oxidation are

directly related to deterioration and reduced shelf life in minced meat products. Lipid

oxidation initiated in the unsaturated fatty acids fraction and form hydroperoxides, which

are susceptible to oxidation (Krishnan et al., 2014). This process produces changes in

meat quality parameters and besides decreasing the nutritional value. In protein oxidation,

a covalent modification of protein is induced either directly by reactive species or

indirectly by reaction with secondary by-products of oxidative stress (Soladoye, Juárez,

Aalhus, Shand, & Estévez, 2015). However, oxidation in meat products can be controlled

or minimized by using food additives, such as the antioxidants (Jayawardana, Liyanage,

Lalantha, Iddamalgoda, & Weththasinghe, 2015).

The food industry usually uses synthetic antioxidants to reduce or minimize the

oxidative process in meat, such as butylated hydroxyanisole (BHA), butylated

hydroxytoluene (BHT), and tertiary butyl hydroquinone (TBHQ). However, it can present

toxicological and carcinogenic effects (Kumar, Yadav, Ahmad, & Narsaiah, 2015).

Therefore, consumers have become increasingly preference to natural preservatives. In

addition, the use of natural antioxidants provides better consumer acceptance (Costa et

al., 2017) due to the appeal of health. However, few researches report the use of natural

antioxidant-rich fruit extracts as inhibitors of lipid and protein oxidation to promoters of

shelf life and quality in chicken meat products (Ferreira et al., 2017; Hwang et al., 2015;

Klangpetch, Phromsurin, Hannarong, Wichaphon, & Rungchang, 2016).

For these reasons, the aim of this study was to evaluate the antioxidant capacity

of waste extracts from the processing of Brazilian native fruits (Caryocar brasiliense and

77

Euterpe edulis) to inhibit the oxidation process in antibiotic free broiler meat. In addition,

as a pre-stage, UV-C radiation was applied to stimulate the oxidation process to potentiate

the antioxidant effect.

2. Material and Methods

2.1 UV-C radiation

To determine the time of exposure to UV-C irradiation necessary for pre-dispose

the oxidation in chicken meat, four treatments were performed: control without irradiation

(WI), UV-C exposure 1.161 mW/cm² for 5 minutes (5I), 10 minutes (10I) and 15 minutes

(15I). These times were determined based on previous studies (Chun, Kim, Lee, Yu &

Song, 2010; Park & Ha, 2014) and laboratory experiences. In addition, the lipid oxidation

in broiler meat (no exposed and exposed) was evaluated during 10 days at 4±1ºC. For the

application of UV-C light, a previously constructed stainless steel barrel-shaped chamber

(Lazaro et al., 2014) was used.

2.2 Samples preparation

2.2.1. Pequi and Juçara waste samples

Pequi (Caryocar brasiliense) fruit was collected from Montes Claros-MG (16º 44'

06" S, 43º 51' 42" W), in January and February 2016. Epicarp and external mesocarp of

pequi were separated. Epicarp and endocarp of juçara (Euterpe edulis) berries were

supplied by Juçaí Industry (Juçaí®, Rio de Janeiro, Brazil, 22° 240 4400 S, 42° 570 5600

78

W) in May 2015. The samples were blanching and immediately frozen at -20ºC for

inactivating enzymes to maintain the general properties. The wastes were air dried at 60

ºC until constant weight (9h) in the oven with forced air circulation (330 drier, FANEM®,

Brazil), and then ground in a mill (A11 Bsic, IKA® Werke, Staufen, Germany). Ground

samples were sieved through a 250 Mesh screen. All samples were stored at -20 °C until

further use.

2.2.2. Obtaining extracts

The extracts were obtained by microwave-assistant extraction (MAE) utilizing a

DGT 100 Plus system (Provecto Analytics Ltd., Jundiaí, SP, Brazil). Briefly, aliquots of

500 mg of fruit powder were added to 25 mL of aqueous ethanol solution 94% (v/v),

sealed into the extraction vessels, and subjected to extraction with 670W microwave

power for 110 seconds. After each extraction, the vessels were cooled to 25 ºC before

centrifugation at 1,400 × g for 10 min at 4 ºC. The precipitate was re-extracted with an

additional 25 mL of the same ethanol solution and at the same MAE conditions; the

supernatants were pooled and stored in amber vials at -20 ºC. Analysis of total phenolic,

flavonoids and monomeric anthocyanins, and antioxidant activity were carried out for the

two extracts. TPC was used to dosage the volume of extracts to applied in broiler meat

treatments (100 mg/kg).

2.2.3. Broiler meat preparation

Five kilograms of antibiotic free (AF) broiler thighs and drumsticks were obtained

from Korin® natural agriculture. The broiler thighs and drumsticks were transported in

79

refrigerated conditions. Samples were boned and meat with skin was ground (8 and 6

mm). For padronization 20% (w/w) of broiler fat was added. Thin layer 0.5 cm mixed

meat and fat were exposed to UV-C radiation (1.195 mW/cm² for 10 minutes) to induced

oxidation in meat.

After, 100 mg/kg of each extract or of BHT was added in respective treatments.

For negative control, any antioxidant was added (BC – Broiler control); for positive

control add synthetic antioxidant (BP – Broiler positive); for treatments with fruit,

Euterpe edulis (BE – Broiler Euterpe) and Caryocar brasilense (BCb – Broiler Caryocar

brasilense) wastes extract were added. It was mixed for one minute with a food mixer.

Then biological models with 30 g were made. All samples were packaged under aerobic

conditions in polyethylene bags and were sealed with the vacuum-packaging machine

(TECMAQ, Vacuum sealer, AP 450). The experiment was carried out in triplicate.

Samples were storage at 4±1ºC for 10 days. The color, pH, lipid and protein

oxidation analyses were carried out on days 0, 2, 4, 6, 8 and 10. The antioxidant analysis

was carried out on days 0 and 10 and for extracts. Proximal composition and fatty acid

profile were carried out on day 0, for characterization. All analyses were carried out in

triplicate.

2.3. Analytical methods

2.3.1. Antioxidant Compounds

Total phenolic content (TPC), total flavonoids content (TFC) and total monomeric

anthocyanins content (TAC) of E. edulis waste extracts and broiler treatments was

estimated based on, respectively: Folin–Ciocalteu method at 765 nm (Ainsworth &

80

Gillespie, 2007), colorimetric method at 415 and 700 nm (Chang, Yang, Wen, & Chern,

2002), and pH differential (pH 1.0 and pH 4.5) method at 520 and 700 nm (Lee, Durst, &

Wrolstad, 2005). The absorbance values were measured using a Spectrophotometer UV-

1800 (Shimadzu Corporation, Kyoto, Japan). The results were expressed as mg gallic acid

equivalent (GAE) per mL of extract, mg of quercetin equivalents (QE) per mL of extract,

and mg cyanidin-3-glucoside equivalents per liter of extract.

2.3.2. Antioxidant Activity

β-carotene bleaching assay was used to determine the antioxidant activity of

extracts using a β-carotene-linoleic acid model system modified by (Frasao, Costa,

Rodrigues, Lima, & Conte-Junior, 2017), using a Spectrophotometer UV-1800

(Shimadzu Corporation, Kyoto, Japan). The antioxidant activity of extracts was expressed

in percentage.

2.3.3. Proximal Composition and pH

Moisture (reference 940.05) was determined by the stove method at 105ºC

(AOAC, 2012). Protein content (reference 954.01) was determined by the micro Kjeldahl

method (AOAC, 2012). The ash content (reference 942.05) was determined by total

carbonization of the sample (AOAC, 2012). The lipid content was determined by Bligh

& Dyer (1959). Samples pH was measured by a digital potentiometer (model PG1800,

Cap Lab, SP, Brazil).

2.3.4. Fatty Acid Profile

81

Cold-extraction of total lipids from the samples was proceeded in quadruplicate

based on Bligh & Dyer (1959) with slight modifications as previously described.

Methylation was achieved through an acidic reaction (10% HCl in methanol) and hexane

(Chin, Liu, Storkson, Ha, & Pariza, 1992; Kishino, Ogawa, Ando, Omura, & Shimizu,

2002).

Fatty acid methyl esters (FAME) were analyzed using a gas chromatograph

equipped with a flame ionization detector (Perkin Elmer, Waltham, MA, USA) and were

separated with an OmegawaxTM 320 column (30 m length, 0.32 mm internal diameter,

and 0.25 µm particle size) (Supelco Inc., Bellefonte, PA, USA). The sample size was 2

µl and the split used was 1:20. The injector and detector temperatures were set at 260 °C

and 280 °C, respectively. The initial temperature of the oven was set at 110 °C, and the

temperature ramp was: increase from 110 to 233 °C at 40 °C/min, hold at 233 °C for 2

min, increase from 233 to 240 °C at 1 °C/min, and hold at 240 °C for 21 min. Helium was

used as the carrier gas at a flow rate of 1.8 mL/min (10 psi). FAME was identified

comparing the retention time of a commercial standard comprising methyl esters of 28

individual fatty acids (Supelco Inc., Bellefonte, PA, USA). The results were expressed in

percentage as proposed by Memon, Talpur, Bhanger, & Balouch (2011).

2.3.5. Lipid Oxidation

The secondary products of lipid oxidation will be measured in UV-1800

(Shimadzu Corporation, Kyoto, Japan) in 532 nm by quantification of substances reactive

to thiobarbituric acid (TBARS) in points of storage using the methodology modified by

82

Alcântara et al. (2015). The results were expressed as mg of malonaldehyde (MDA) per

gram of meat, based on a calibration curve.

2.3.6. Protein Oxidation

The total carbonyl content was estimated utilizing a 2,4-dinitrophenylhydrazine

(DNPH) derivatization assay based on the method modified by Armenteros, Heinonen,

Ollilainen, Toldrá, & Estévez (2009). The protein content was estimated utilizing the

absorbance value at 280 nm against a bovine serum albumin standard curve, whereas

carbonyls content was calculated utilizing absorption at 370 nm and an absorptivity

coefficient for the protein hydrazones of 21.0 mM-1 cm-1. The results were expressed as

nmol of carbonyl per mg of protein.

2.4. Instrumental Color

Color determinations were made at 10°C by means of a Minolta CM-600D

spectrophotometer (Minolta Camera Co., Osaka, Japan). Natural broiler samples exposed

to oxygen for 5 minutes and the sensor was mounted directly on patties superficie to

prevent ambient light noise (Zhuang & Bowker, 2016). The following color CIELab

coordinates were determined: lightness (L*, 100 = white, 0 = black), redness (a*, + red,

−green), and yellowness (b*, + yellow, −blue). In addition, the total color change ΔE*,

hue angle h°, and chroma C* were also calculated (Incedayi, Tamer, Sinir, Suna, &

Çopur, 2016).

2.5. Statistical analysis

83

Results were represented as means ± standard deviation. Analyses of variance

(ANOVA) and Tukey test were performed to determine the difference. Differences were

considered significant at p < 0.05. Software XLSTAT version 2013.2.03 (Addinsoft,

Paris, France) was used.

3. Results and Discussion

3.1. Determination of UV-C radiation time

Meat without exposure (WI) present initially low values of lipid oxidation (p <

0.05) than the others (5I, 10I and 15I) (Fig.1A), which confirms the pre-exposure of the

chicken meat to oxidation due to the action of UV-C radiation. However, only I10 and

I15 treatments presented greater lipid oxidation (P < 0.05) than the control from the

beginning to the end of the storage period. Therefore, the I10 treatment was sufficient to

stimulate oxidation in chicken meat.

3.2. Antioxidant compounds and activity of the natural extracts

TPC, TFC and TAC of extracts from wastes of Caryocar brasiliense and Euterpe

edulis contents were exhibited in table 1. The C. brasiliense extract present highest levels

of TPC, TFC and TAC when compared to E. edulis extract (Table 1), indicating that the

pequi peel has a major concentration of these compounds than the juçara waste (p<0.05).

However, both extracts presented satisfactory levels of natural antioxidant compounds

84

when compared to other studies that used extraction conditions similar to our research

(Frasao et al., 2017; Monteiro, da Silva, da S Martins, Barin, & da Rosa, 2015).

Regarding antioxidant activity, at 0 time, both extracts present the same activity

(100%) (p>0.05). Nonetheless, already with 30 minutes, and until the end of the analysis

(120 min), the C. brasiliense waste extract had the highest (p<0.05) antioxidant activity

(Table 1). This can be related to the more concentration of antioxidant compounds in this

extract than E. edulis waste extract, even though the same extraction parameter. This

positive relation between the concentration of phenolic compounds and the antioxidant

activity was observed by other authors (Frasao et al., 2017; Monteiro et al., 2015; Rocha,

Melo, Paula, Nobre, & Abreu, 2015).

3.3. Broiler meat characterization and pH

The fatty acid profile of the raw material (chicken meat) presented, in g/100g,

C6:0 (2.52±0.29), C8:0 (0.27±0.02), C10:0 (0.67±0.07), C11:0 (0.31±0.01), C14:0

(48.69±4.52), C16:0 (11.67±1.42), C16:1 (1.09±0.38), C17:0 (1.47±0.09), C18:0

(0.540.10), C18:1n7 (6.39±0.96), C18:1n9 (8.29±0.89), C18:2n6 (9.87±1.40), C18:3n6

(0.92±0.12), C18:3n3 (0.17±0.02), C20:1 (0.16±0.01), C20:2 (0.13±0.01), C20:3n6

(2.91±0.48), C20:4n6 (2.29±0.50), C22:2 (0.36±0.01), docosahexaenoic acid (DHA –

C22:6n3 - 0.14±0.01). In this way, saturated fatty acids (67.28/82.76%) have a higher

proportion when compared to monounsaturated (15.94/8.15%) and polyunsaturated

(16.78/9.09%) fatty acids. A similar characteristic in this profile is also observed

previously by Dalziel, Kliem, & Givens (2015). The content of mono and polyunsaturated

fatty acids in a meat matrix interferes with the lipid oxidation potential of it (Krishnan et

al., 2014).

85

With respect to the proximate composition analysis, no difference was observed

between the treatments (BC, BB, BE and BCb) (Table 2). The addition of the extracts

does not influence these parameters, once it consists basically of antioxidant compounds.

Therefore, in this study, the proximate composition of the treatments (BC, BB, BE and

BCb) cannot be considered as a bias factor.

The BC shows an increased pH values, while treatments with synthetic and natural

antioxidants (BB, BE and BCb) (Fig. 2), presented no difference (p>0.05) in initial and

final pH values. However, the pH value only shows the difference (p<0.05) between the

treatments (BB, BE and BCb) and BC at the last day of storage, in which BC presented

the highest pH value. This can be explained by the fact that antioxidants also act as

preservatives in general (Andrés, Petrón, Adámez, López, & Timón, 2017; Klangpetch et

al., 2016), inhibiting the deterioration process.

3.4. Antioxidant extracts action in pre-oxidized broiler meat

3.4.1. Antioxidant Compounds

The results of TPC, TFC and TAC in broiler meat treatments (BB, BE and BCb)

during refrigerated storage time (0 and 10 days) are showed on table 3.

For TPC, in the first day, BC (control) showed the lowest concentration, differing

(p<0.05) from the BB, BE and BCb. This difference is related to the fact that in the control

treatment no extract or synthetic antioxidant was added. On the other hand, at the end of

the storage period (10th day), only treatments with natural antioxidants (BE and BCb)

differed (p<0.05) from the control (BC). The phenolics presented in natural extracts are

more complex and stable to degradation, whereas those possibly present in the synthetic

86

antioxidant (BHT) are more labile because they are compounds of lower complexity

(Cheynier, 2005). Comparing the TPC contents of day 0 and 10, the BE was the only

treatment that did not present a difference during this period, while BC, BB and BCb have

a decrease in this value. Probably, this behavior can be explained by consumption of

phenolic compounds in antioxidant reaction (Cheynier, 2005), reducing the concentration

of these compounds.

Regarding TFC in the first day, BCb presented the highest concentration, differing

(p<0.05) not only of the BC but also of the BB and BE (p<0.05). The pequi peel probably

present more flavonoids content than juçara and synthetic antioxidant, which justifies its

higher initial concentration of this compound. On day 10, in all treatments (BC, BB, BE

and BCb) when compared to day 0 was observed an increase of flavonoids content. This

increase may be related to the presence of a naturally compounds in broiler meat and skin

(Lafarga & Hayes, 2014; Onuh, Girgih, Aluko, & Aliani, 2014). Therefore, during

storage, the muscle can undergo changes such as hydrolysis, and present its own bioactive

peptides (Fukada et al., 2016) which can be detected as flavonoids.

BE treatment exhibited the highest concentration of anthocyanins (TAC), at day

0 and 10, when compared to the other treatments (BC, BB and BCb). The juçara fruit is

considered as a source of anthocyanins, which are responsible for their purple color

(Bicudo, Ribani, & Beta, 2014). On the other hand, when the days of storage were

compared, the treatments BE and BCb showed no difference (p>0.05), whereas in

treatments BC and BB there was a reduction of these compounds. This behavior can be

observed by the fact that anthocyanins can be consumed in the antioxidant reaction,

reducing the concentration of this compounds (Cheynier, 2005).

With respect to the relevant equivalent quantification of antioxidant compounds

(TPC, TFC and TAC) in the control treatment (BC), it may be related to the fact that the

87

dark musculature of the chicken presents compounds with antioxidant properties (Fukada

et al., 2016) and can also be detected in these analyzes.

3.4.2. Lipid and Protein Oxidation

The degree of lipid oxidation of the treatments (BC, BB, BE and BCb) was

verified using thiobarbituric acid reagents and the results expressed in milligrams of

malonaldehyde per gram of meat. All treatments showed an increase in lipid oxidation

during storage (Fig. 1B). BC present 2.28 to 4.22, BB 1.64 to 4.01, BE 1.70 to 4.07, and

BCb 1.78 to 2.89 mgMDA.g-1, on day 0 and 10, respectively (Fig. 1B). During meat

storage, oxidation takes place the double bond sites in the triacyleglycerol molecules bond

in meat and result in a deterioration, observed through rancidity (Sohaib et al., 2017).

On the first day of storage, treatments added with antioxidant compounds had

lower lipid oxidation than the negative control (BC). While on day 2 of storage, the BHT

showed to be more efficient in the reduction of oxidation, however from day 4 of storage

pequi extract presented greater antioxidant action until the end of the storage, presenting

lowest values, 2.52, 2.56, 2.79, 2.89 mgMDA.g-1, days 4, 6, 8, and 10, respectively. A

stability of the lipid oxidative process in this treatment can also be observed in this period.

Pequi extract is a source of antioxidant compounds that act as preservatives in the

refrigerated chicken meat, regarding lipid oxidation, and probably reduced this loss.

Therefore, the pequi peel extract proved to be a potential natural antioxidant to be used

in chicken meat, and possibly in meat products.

Lipid oxidation is considered a process that modify the chemical properties of

molecules, which can lead to loss of function or generation of compounds such as

aldehydes and peroxides (Sohaib et al., 2017). Repeated consumption of oxidized fat can

88

pose a health risk to the consumer, as cardiovascular deseases. However, oxidative

stability in complex food such as meat depends on the composition, concentration of

reaction substrates, prooxidants and antioxidants compounds content (Ramana,

Srivastava, & Singhal, 2017). Therefore, the use of pequi extract to the reduction of the

formation of peroxides may be an alternative to bring benefit to the health of the

consumer.

With respect to protein oxidation, in the first day of storage, BE (2.32) and BCb

(2.12) presented the highest rates (Fig. 1C). However, on day 2 the BC (2.64) and BB

(2.38) showed a greater increase, whereas BCb (2.28, 2.33, 2.31, respectively) and BE

(2.304, 2.34, 2.40, respectively) remained stable until day 6. At this point was observed

a decrease in the carbonyls components. At the last day of storage was observed lower

protein oxidation rates than those observed at the beginning in BE (1.66) and BCb (1.39),

whereas BC (1.71) and BB (2.03) present highest. The degree of protein oxidation in the

treatments was verified determining nmol of carbonyl per mg of protein. Generation of

carbonyls is the most common damage to oxidized proteins (Zhang, Xiao, & Ahn, 2013).

The structural arrangement and amino acid composition determine the function of

proteins in food matrixes and products, such as emulsification, solubility, and gelation.

Carbonyl compounds were generated principle by oxidative deterioration of amino acid

(lysine, proline, histidine and arginine). These generated compounds interfere with and

impair the function of the meat protein. The addition of antioxidants is one way to reduce

this oxidative process of proteins in food (Sohaib et al., 2017).

The behavior of the carbonyl compounds along storage can be explained by the

fact that the carbonyl derivatives can react with lysine amino groups or with proteins or

even between different proteins thus allowing protein cross-linkages, which can be

formed intra- and intermolecular cross-links, reducing the carbonyl concentration (Shen,

89

Spikes, Kopečeková, & Kopeček, 1996; Zhang et al., 2013). At day 10, BCb present

lowest protein oxidation rates, show pequi extract as the best to stabilize this process.

While BB present the highest rates, show this synthetic antioxidant have not a satisfactory

applicability for stabilization of protein oxidation. BE present similar levels to control,

hence can affirm that the extract of the pequi peel presented better stabilizing power.

Therefore, the use of the pequi extract has an importance in terms of optimizing the

conservation of meat products by the reduction of protein oxidation.

Studies that apply natural antioxidants directed in meat or product used rosemary

extract, acorn extract, mugwort extract, tropical citrus peel extracts, and rose extract on

broiler meat, and observed an action in the stabilization of lipid and protein oxidation

(Feng et al., 2016; Ferreira et al., 2017; Hwang et al., 2015; Klangpetch et al., 2016;

Zhang et al., 2017). However, no research was found that used the juçara wastes and pequi

peel extract as a preservative, stabilizing the oxidation processes, applied in poultry meat

or meat. Therefore, this study is innovative, although more research related to this

application must be carried out.

3.4.5. Instrumental color

Food color is influenced by different factors, such as the chemical, physical,

biochemical, and microbial, which can change according to microorganism growth,

maturation process, post-mortem process, and storage (Feng et al., 2016). In meat, the

color is an important attribute considerate by consumers to characterized the quality of

the product, interfering with consumer choice. The color characterization of the antibiotic

free broiler meat treatments during the storage are shown in fig.3. The lightness (L*),

90

yellowness (b*), and total color change (ΔE*) did not differ (p>0.05) at the beginning to

the end of storage time.

Lightness (L*) values not differ at the beginning to the end of storage time in all

treatments. When compare treatments, values not differ (p>0.05) from BC and BB, but

BE and BCb present lower (p<0.05) values of this parameter from the others two and not

differs (p>0,05) between them, after two days of storage. This behavior can be explained

by the fact of the BE and BCb treatments have extract wastes add and the addition of the

extract in these treatments and reaction of compounds present leading to a browning of

the broiler meat. Besides that, during storage can be occurred a deposition of pigments of

these extracts, once juçara present high level of anthocyanins and pequi present

carotenoids. Anthocyanins are purple pigments and carotenoids are orange, contributing

to the darkening detected.

Redness (a*) values present no difference (p>0.05) when compared the

treatments, but decrease (p<0.05) during storage of all of them. This reduction of the red

intensity during the storage of the samples can be attributed to the denaturation of heme-

globin and iron oxidation to ferric form. Since, brownish pigments were formed by the

chemical degradation, mainly denatured globin hemochromes (Ferreira et al., 2017).

Yellowness (b*) values did not differ (p>0.05) at the beginning to the end of

storage time in all treatments. However, the BCb treatment present lower (p<0.05) values

of this parameter. Which can be explained by the presence of carotenoids pigments, which

attribute the orange color (Ribeiro, Fernandes, Alves, & Naves, 2014). This color is

measured after yellow, with yellow being the most positive value, the orange has lower

values (Incedayi et al., 2016), corroborating with the hypothesis.

Considering that the value of Chroma is calculated using the values of a* and b*,

the observed decrease (p<0.05) of this value during storage only in the BCb treatment is

91

related to the fact that the others treatment present values of b* higher. This difference,

as mentioned previously, may be linked to the presence of carotenoid pigments (Ribeiro,

Fernandes, Alves, & Naves, 2014). When compare the treatments, at the end of storage

BE and BCb did not differ (p>0.05) but, this two differ (p<0.05) from BC and BB, which

are similar (p>0.05). Corroborating with the hypothesis mentioned, once BE had purple

pigments as anthocyanins.

Hue Angle (hº) is measured in degrees and starts in red (0º), a gradual increase to

yellow (90º), green (180º) and blue (270º) (Incedayi et al., 2016). The increase (p<0.05)

in the values of this angle in all treatments agrees with the reduction observed in the

redness parameter, considering that the values approach is between yellow and red (67-

72º), corroborating to the presence of brownish pigments. When compared the hº of

treatment BCb present the lowest (p<0.05) values, this can be explained by the fact of

interference of extract, probably by pequi present carotene, which can attribute variation

of orange color (Incedayi et al., 2016; Ribeiro, Fernandes, Alves, & Naves, 2014).

Resgarding that the ΔE* uses in the calculation the values of the parameters L*,

a* and b*, as the treatment BCb presented smaller values in two (L* and b*) of these

parameters, the total color change attributed to this treatment was also lower (p<0,05)

than the one observed in the others. BCb present lower (p<0.05) values of ΔE* since day

2. At the end of storage (day 10) BE present similar (p>0.05) values of BCb which can

be explained by the low values of lightness (L*), observed at this time in treatment with

juçara extract.

The color changes in meat can be attributed to muscle structure and pigment

concentration (Feng et al., 2016; Ferreira et al., 2017). In this article, probably the

variations observed on treatment with pequi (BCb) and juçara (BE) waste extract can be

92

attributed to the presence of some pigments such as carotenoids or anthocyanin,

respectively.

4. Conclusion

In conclusion, the direct addition of pequi pell extract was highly effective in the

stability of lipid and protein oxidative degradation in pre-oxidized antibiotic free broiler

meat. Therefore, the use of pequi peel as a source of natural antioxidant for application in

chicken meat has proved to be more effective than the use of synthetic antioxidant (BHT).

On the other hand, although less efficient than pequi pell extract, the juçara waste extract

can also be used as a technological strategy to reduce the oxidative process in antibiotic

free broiler meat for poultry industry.

Acknowledgments: Juçara samples were supplied by Juçaí Industry (Juçaí®, Rio de

Janeiro, Brazil).

Funding: This work was supported by the The support by Coordination of Enhancement

of People of a Superior Level [process nº. 125, CAPES/Embrapa 15/2014, CAPES,

Brazil], Research Foundation of the State of Rio de Janeiro [process nº. E-

26/201.185/2014, FAPERJ, Brazil], the National Council of Technological and Scientific

Development [processes nº. 311361/2013-7, 311422/2016-0 and 150200/2017-0, CNPq,

Brazil].

Conflict of interest: Authors declared no conflict of interest.

93

References

Ainsworth, E. A., & Gillespie, K. M. (2007). Estimation of total phenolic content and

other oxidation substrates in plant tissues using Folin–Ciocalteu reagent. Nature

Protocols, 2(4), 875–877. https://doi.org/10.1038/nprot.2007.102

Alcântara, A. V. de, Azevedo, P. L., Mársico, E. T., Monteiro, M. L., Rodrigues, B. L.,

& Conte Junior, C. A. (2015). Comparative Study on Total Lipid Quantification and

Oxidative Rancidity Determination in Freshwater Fish Species with Different Fat Levels.

Journal of Food Studies, 4(1), 34. https://doi.org/10.5296/jfs.v4i1.8362

Andrés, A. I., Petrón, M. J., Adámez, J. D., López, M., & Timón, M. L. (2017). Food by-

products as potential antioxidant and antimicrobial additives in chill stored raw lamb

patties. Meat Science, 129, 62–70. https://doi.org/10.1016/j.meatsci.2017.02.013

AOAC. (2012). Official Methods of analysis (19th ed.). Washington, DC: Association of

Official Agricultural Chemists.

Armenteros, M., Heinonen, M., Ollilainen, V., Toldrá, F., & Estévez, M. (2009). Analysis

of protein carbonyls in meat products by using the DNPH-method, fluorescence

spectroscopy and liquid chromatography–electrospray ionisation–mass spectrometry

(LC–ESI–MS). Meat Science, 83(1), 104–112.

https://doi.org/10.1016/j.meatsci.2009.04.007

Bicudo, M. O. P., Ribani, R. H., & Beta, T. (2014). Anthocyanins, Phenolic Acids and

Antioxidant Properties of Juçara Fruits (Euterpe edulis M.) Along the On-tree Ripening

Process. Plant Foods for Human Nutrition, 69(2), 142–147.

https://doi.org/10.1007/s11130-014-0406-0

94

Bligh, E. G., & Dyer, W. J. (1959). A rapid method of total lipid extraction and

purification. Canadian Journal of Biochemistry and Physiology, 37(8), 911–917.

Chang, C.-C., Yang, M.-H., Wen, H.-M., & Chern, J.-C. (2002). Estimation of total

flavonoid content in propolis by two complementary colorimetric methods. Journal of

Food and Drug Analysis, 10(3). Retrieved from

http://search.proquest.com/openview/8ed5f78aa3317908039c7a8ca3740050/1?pq-

origsite=gscholar

Cheynier, V. (2005). Polyphenols in foods are more complex than often thought. The

American Journal of Clinical Nutrition, 81(1), 223S–229S.

Chin, S. F., Liu, W., Storkson, J. M., Ha, Y. L., & Pariza, M. W. (1992). Dietary sources

of conjugated dienoic isomers of linoleic acid, a newly recognized class of

anticarcinogens. Journal of Food Composition and Analysis, 5(3), 185–197.

Chun, H. H., Kim, J. Y., Lee , B. D., Yu, D. J., Song, K. B. (2010).Effect of UV-C

irradiation on the inactivation of inoculated pathogens and quality of chicken breasts

during storage. Food Control, 21, 276-280. doi:10.1016/j.foodcont.2009.06.006

Costa, M. P., Monteiro, M. L. G., Frasao, B. S., Silva, V. L. M., Rodrigues, B. L.,

Chiappini, C. C. J., & Conte-Junior, C. A. (2017). Consumer perception, health

information, and instrumental parameters of cupuassu (Theobroma grandiflorum) goat

milk yogurts. Journal of Dairy Science, 100(1), 157–168.

https://doi.org/10.3168/jds.2016-11315

Dalziel, C. J., Kliem, K. E., & Givens, D. I. (2015). Fat and fatty acid composition of

cooked meat from UK retail chickens labelled as from organic and non-organic

production systems. Food Chemistry, 179, 103–108.


95

Feng, L., Shi, C., Bei, Z., Li, Y., Yuan, D., Gong, Y., & Han, J. (2016). Rosemary Extract

in Combination with ɛ-Polylysine Enhance the Quality of Chicken Breast Muscle during

Refrigerated Storage. International Journal of Food Properties, 19(10), 2338–2348.

https://doi.org/10.1080/10942912.2015.1130053

Ferreira, V. C. S., Morcuende, D., Hérnandez-López, S. H., Madruga, M. S., Silva, F. A.

P., & Estévez, M. (2017). Antioxidant Extracts from Acorns (Quercus ilex L.) Effectively

Protect Ready-to-Eat (RTE) Chicken Patties Irrespective of Packaging Atmosphere:

Acorn as antioxidant in convenience food…. Journal of Food Science, 82(3), 622–631.

https://doi.org/10.1111/1750-3841.13640

Frasao, B. D. S., Costa, M. P. da, Rodrigues, B. L., Lima, B. R. C., & Conte-Junior, C.

A. (2017). Natural Antioxidant Activity and Compounds Content from Wastes of Euterpe

edulis Berries. Journal of Agricultural Science, 9(3), 178.

https://doi.org/10.5539/jas.v9n3p178

Fukada, Y., Mizutani, S., Nomura, S., Hara, W., Matsui, R., Nagai, K., … Terashima, M.

(2016). Antioxidant activities of a peptide derived from chicken dark meat. Journal of

Food Science and Technology, 53(5), 2476–2481. https://doi.org/10.1007/s13197-016-

2233-9

Hwang, K.-E., Kim, H.-W., Song, D.-H., Kim, Y.-J., Ham, Y.-K., Lee, J.-W., … Kim,

C.-J. (2015). Effects of antioxidant combinations on shelf stability of irradiated chicken

sausage during storage. Radiation Physics and Chemistry, 106, 315–319.

https://doi.org/10.1016/j.radphyschem.2014.08.014

Incedayi, B., Tamer, C. E., SINIR, G. Ö., Suna, S., & ÇOPUR, Ö. U. (2016). Impact of

different drying parameters on color, β-carotene, antioxidant activity and minerals of

96

apricot (Prunus armeniacaL.). Food Science and Technology (Campinas), 36(1), 171–

178.

Jayawardana, B. C., Liyanage, R., Lalantha, N., Iddamalgoda, S., & Weththasinghe, P.

(2015). Antioxidant and antimicrobial activity of drumstick (Moringa oleifera) leaves in

herbal chicken sausages. LWT - Food Science and Technology, 64(2), 1204–1208.

https://doi.org/10.1016/j.lwt.2015.07.028

Kishino, S., Ogawa, J., Ando, A., Omura, Y., & Shimizu, S. (2002). Ricinoleic Acid and

Castor Oil as Substrates for Conjugated Linoleic Acid Production by Washed Cells of

Lactobacillus plantarum. Bioscience, Biotechnology, and Biochemistry, 66(10), 2283–

2286. https://doi.org/10.1271/bbb.66.2283

Klangpetch, W., Phromsurin, K., Hannarong, K., Wichaphon, J., & Rungchang, S.

(2016). Antibacterial and antioxidant effects of tropical citrus peel extracts to improve

the shelf life of raw chicken drumettes. International Food Research Journal, 23(2).

Retrieved from

http://search.ebscohost.com/login.aspx?direct=true&profile=ehost&scope=site&authtyp

e=crawler&jrnl=19854668&AN=114317987&h=V0Kzt0pXOmuSYd%2B1xbVX37jou

JW5xvvgazyHAyq5NAdfrszlkbsLfPj2cQhDmelc%2BQw0O52CrsUfWUPQxVKR5g%

3D%3D&crl=c

Krishnan, H., K., Babuskin, S., Azhagu Saravana Babu, P., Sasikala, M., Sabina, K.,

Archana, G., … Sukumar, M. (2014). Antimicrobial and antioxidant effects of spice

extracts on the shelf life extension of raw chicken meat. International Journal of Food

Microbiology, 171, 32–40. https://doi.org/10.1016/j.ijfoodmicro.2013.11.011

https://doi.org/10.1016/j.ijfoodmicro.2013.11.011

97

Kumar, Y., Yadav, D. N., Ahmad, T., & Narsaiah, K. (2015). Recent Trends in the Use

of Natural Antioxidants for Meat and Meat Products: Use of natural antioxidants for

meat…. Comprehensive Reviews in Food Science and Food Safety, 14(6), 796–812.

https://doi.org/10.1111/1541-4337.12156

Lafarga, T., & Hayes, M. (2014). Bioactive peptides from meat muscle and by-products:

generation, functionality and application as functional ingredients. Meat Science, 98(2),

227–239. https://doi.org/10.1016/j.meatsci.2014.05.036

Lazaro, C. A., Conte-Junior, C. A., Monteiro, M. L. G., Canto, A. C. V. S., Costa-Lima,

B. R. C., Mano, S. B., & Franco, R. M. (2014). Effects of ultraviolet light on biogenic

amines and other quality indicators of chicken meat during refrigerated storage. Poultry

Science, 93(9), 2304–2313. https://doi.org/10.3382/ps.2013-03642

Lee, J., Durst, R. W., & Wrolstad, R. E. (2005). Determination of total monomeric

anthocyanin pigment content of fruit juices, beverages, natural colorants, and wines by

the pH differential method: collaborative study. Journal of AOAC International, 88(5),

1269–1278.

Memon, N. N., Talpur, F. N., Bhanger, M. I., & Balouch, A. (2011). Changes in fatty acid

composition in muscle of three farmed carp fish species (Labeo rohita, Cirrhinus mrigala,

Catla catla) raised under the same conditions. Food Chemistry, 126(2), 405–410.


Monteiro, S. S., da Silva, R. R., da S Martins, S. C., Barin, J. S., & da Rosa, C. S. (2015).

Phenolic compounds and antioxidant activity of extracts of pequi peel (Caryocar

brasiliense Camb.). International Food Research Journal, 22(5). Retrieved from

http://www.ifrj.upm.edu.my/22%20(05)%202015/(36).pdf

98

Onuh, J. O., Girgih, A. T., Aluko, R. E., & Aliani, M. (2014). In vitro antioxidant

properties of chicken skin enzymatic protein hydrolysates and membrane fractions. Food

Chemistry, 150, 366–373. https://doi.org/10.1016/j.foodchem.2013.10.107

Park, S. Y., Ha, S. (2014). Ultraviolet-c radiation on the fresh chicken breast: inactivation

of major foodborne viruses and changes in physicochemical and sensory qualities of

product. Food Bioprocess Technology, v.1, p. 1-12. DOI 10.1007/s11947-014-1452-1

Ramana, K. V., Srivastava, S., & Singhal, S. S. (2017). Lipid Peroxidation Products in

Human Health and Disease 2016. Oxidative Medicine and Cellular Longevity, 2017, 1–

2. https://doi.org/10.1155/2017/2163285

Ribeiro, D. M., Fernandes, D. C., Alves, A. M., & Naves, M. M. V. (2014). Carotenoids

are related to the colour and lipid content of the pequi (Caryocar brasiliense Camb.) pulp

from the Brazilian Savanna. Food Science and Technology (Campinas), 34(3), 507–512.

https://doi.org/10.1590/1678-457x.6369

Rocha, L. B., Melo, A. M., Paula, S. L. A., Nobre, S. A. M., & Abreu, I. N. (2015). Gallic

acid as the major antioxidant in pequi (Caryocar brasiliense Camb.) fruit peel. Revista

Brasileira de Plantas Medicinais, 17(4), 592–598. https://doi.org/10.1590/1983-

084X/14_062

Sebranek, J. G., Sewalt, V. J. H., Robbins, K. L., & Houser, T. A. (2005). Comparison of

a natural rosemary extract and BHA/BHT for relative antioxidant effectiveness in pork

sausage. Meat Science, 69(2), 289–296. https://doi.org/10.1016/j.meatsci.2004.07.010

Shen, H.-R., Spikes, J. D., Kopečeková, P., & Kopeček, J. (1996). Photodynamic

crosslinking of proteins. I. Model studies using histidine-and lysine-containing N-(2-

99

hydroxypropyl) methacrylamide copolymers. Journal of Photochemistry and

Photobiology B: Biology, 34(2–3), 203–210.

Sohaib, M., Anjum, F. M., Arshad, M. S., Imran, M., Imran, A., & Hussain, S. (2017).

Oxidative stability and lipid oxidation flavoring volatiles in antioxidants treated chicken

meat patties during storage. Lipids in Health and Disease, 16(1).

https://doi.org/10.1186/s12944-017-0426-5

Soladoye, O. P., Juárez, M. L., Aalhus, J. L., Shand, P., & Estévez, M. (2015). Protein

Oxidation in Processed Meat: Mechanisms and Potential Implications on Human Health:

Protein oxidation, nutrition, and health…. Comprehensive Reviews in Food Science and

Food Safety, 14(2), 106–122. https://doi.org/10.1111/1541-4337.12127

Zhang, Q. Q., Jiang, M., Rui, X., Li, W., Chen, X. H., & Dong, M. S. (2017). Effect of

rose polyphenols on oxidation, biogenic amines and microbial diversity in naturally dry

fermented sausages. Food Control, 78, 324–330.

https://doi.org/10.1016/j.foodcont.2017.02.054

Zhang, W., Xiao, S., & Ahn, D. U. (2013). Protein Oxidation: Basic Principles and

Implications for Meat Quality. Critical Reviews in Food Science and Nutrition, 53(11),

1191–1201. https://doi.org/10.1080/10408398.2011.577540

Zhuang, H., & Bowker, B. (2016). Effect of marination on lightness of broiler breast

fillets varies with raw meat color attributes. LWT - Food Science and Technology, 69,

233–235. https://doi.org/10.1016/j.lwt.2016.01.054

100

Table 1 Antioxidant content and antioxidant activity of pequi (Caryocar brasiliense) and juçara (Euterpe edulis) wastes extracts

Extracts TPCa TFCb TACc Antioxidant Activity d

0 min 30 min 60 min 90 min 120 min

Caryocar brasiliense 3.77±0.14 A,a 1.64±0.01 B,a 0.92±0.08 C,a 100.00±0.10 A,a 100.00±0.12 A,a 96.96 ±0.05 B,a 93.01 ±0.13 C,a 90.44 ±0.11 C,a

Euterpe edulis 0.34±0.00 A,b 0.24±0.00 B,b 0.21±0.04 C,b 100.00±0.05 A,a 90.48±0.10 B,b 85.11 ±0.11 BC,b 81.74 ±0.12 CD,c 78.42 ±0.12 D,c

BHT - - - 100.00±0.02 A,a 92.04 B,b 89.82 C,b 86.45 D,b 83.74 E,b

All results are the means ± SD (n = 3). a(mgGAE.mL-1); b(mgQE. mL -1); c(mgC3QE. L -1); d(AA%)

a-c Same letters prescribe that there was no difference between the lines results; different letters determine the difference.

A-E Same letters prescribe that there was no difference between the columns results; different letters determine the difference.

BHT is a positive control used for determine antioxidant activy.

101

Table 2 Proximate composition of broiler meat treatments

Treatments Moisture Protein Ash Lipid

BC 67.35±0.75a 19.45±0.17a 0.96±0.01a 8.01±0.08 a

BB 67.79±0.14a 19.44±0.53a 0.96±0.02a 8.16±0.06 a

BE 69.20±0.51a 19.85±0.01a 0.94±0.01a 7.95±0.08 a

BCb 69.00±0.14a 20.37±0.51a 0.98±0.01a 8.00±0.04 a


Means that do not share a letter are significantly different.

BC – broiler control; BB-broiler meat with BHT; BE – broiler meat with E. edulis; BCb – broiler meat with

C. brasiliense.

102

Table 3 Antioxidant contents in broiler meat treatments of storage in 4ºC

Treatments TPC

(mg AGE.100g-1)

TFC

(mgQE.100g-1)

TAC

(mgC3GE.100g-1)

Day 0 Day 10 Day 0 Day 10 Day 0 Day 10

BC 58.57±3.05 A,b 45.46±4.20 B,b 81.11±1.62 B,c 333.07±3.66 A,b 3.06±0.04 A,b 0.96±0.05 B,c

BB 70.81±5.36 A,ab 49.52±4.96 B,b 205.39±4.05 B,b 373.89±3.14 A,ab 3.59±0.30 A,ab 0.50±0.09 B,c

BE 68.64±3.85 A,ab 62.30±7.01 A,a 201.47±1.44 B,b 360.68±4.60 A,ab 4.03±0.04 A,a 4.34±0.09 A,a

BCb 77.79±6.22 A,a 67.46±2.51 B,a 245.95±4.20 B,a 413.13±2.49 A,a 3.08±0.01 A,b 3.55±0.65 A,b


a-c Same letters prescribe that there was no difference between the treatments in the same day results within the analysis; different letters determine the difference.

A-B Same letters prescribe that there was no difference between the days results within the analysis; different letters determine the difference.

BC – broiler control; BB-broiler meat with BHT; BE – broiler meat with E. edulis; BCb – broiler meat with C. brasiliense.

103

Figures

Fig.1. Lipid oxidation of broiler meat submitted with different times under UV-c

irradiation (A), and oxidation of broiler meat treatments during storage at 4ºC, for 10

days. (B) Lipid oxidation. (C) Protein oxidation. All results are the means with standard deviation (n = 3).

a-d Same letters prescribe that there was no difference between the treatments in the same day results within


A-D Same letters prescribe that there was no difference between the days results within the analysis;


WI –without irradiation; 5I –5 minutes irradiation; 10I –10 minutes irradiation; 15I – 15 minutes irradiation;


C. brasiliense.

mgMDA.g-1= miligrams of malonaldeyde per grams of broiler meat.

nmolCnyl.mg-1= nano mols of carbonyl per miligrams of brailer meat protein.

104

Fig.2. pH value of broiler meat treatments during storage at 4ºC, for 10 days. All results are the means with standard deviation (n = 3).

a-b Same letters prescribe that there was no difference between the treatments in the same day results within


A-C Same letters prescribe that there was no difference between the days results within the analysis;



C. brasiliense.

105

Fig.3. Color characterization of broiler treatments during 10 days storage at 4 ºC. All results are the means ± SD (n = 3).

a-b Same letters prescribe that there was no difference between the treatments in the same day results within the analysis; different letters determine the difference.

A-C Same letters prescribe that there was no difference between the days results within the analysis; different letters determine the difference.

BC – broiler control; BB-broiler meat with BHT; BE – broiler meat with E. edulis; BCb – broiler meat with C. brasiliense.

106

3.4 ARTIGO IV

O artigo intitulado “Molecular detection, typing, and quantification of Campylobacter spp.

in foods of animal origin” está publicado na revista Comprehensive Reviews in Food Science and

Food Safety.

Comprehensive Reviews in Food Science and Food Safety

Vol. 16, No. 4; p. 721–734, 2017

ISSN: 1541-4337

Molecular Detection, Typing and Quantification of Campylobacter spp. in Foods of Animal

Origin

Beatriz da Silva Frasao1,2, Victor Augustus Marin3 and Carlos Adam Conte-Junior1,4*

1 Department of Food Technology, Fluminense Federal University (UFF), Niteroi, RJ, Brazil

2 Department of Epidemiology and Public Health, Federal Rural University of Rio de Janeiro, Rio

de Janeiro (UFRRJ), RJ, Brazil

3 Department of Food Science, Federal University of the State of Rio de Janeiro (UNIRIO), Rio de

Janeiro, RJ, Brazil

4 National Institute for Health Quality Control, Oswaldo Cruz Foundation (FIOCRUZ), Rio de

Janeiro, RJ, Brazil

* Contact information for Corresponding Author Professor Carlos Adam Conte Junior, D.V.M., M.Sc., Ph.D. Department of Food Technology- Fluminense Federal University, Brazil Rua Vital Brazil Filho, 64. Niterói, Rio de Janeiro, Brazil. CEP: 24230-340 Phone number: +55 (21) 26299545; E-mail: [email protected] Word count: 12,080

Short version of title Campylobacter Molecular Tools in Food . . .

Choice of journal/section

Comprehensive Reviews in Food Science and Food Safety

Author disclosures

All authors declare no conflict of interest.

107

ABSTRACT: Campylobacteriosis, the most frequently reported zoonosis and the main bacterial

foodborne infection in humans, is caused by Campylobacter spp., with C. jejuni and C. coli being

the most common agents. These bacteria can be found in the intestinal tracts of cattle, dogs,

cats, sheep, poultry, and pigs. Isolation of these microorganisms is laborious because they require

specific media and a low oxygen concentration for growth. Additionally, differentiation among

species using conventional methods is difficult, as very few biochemical characteristics differ

among the various species. However, with advances in molecular microbiological techniques,

these approaches are being broadly applied to help overcome challenges in the identification,

differentiation, and quantification of Campylobacter in foodstuffs. Polymerase chain reaction

(PCR) is crucial for species identification and confirmation, allowing for detection of a given genus

or species as well as the presence of antibiotic resistance genes. Multiplex PCR is necessary for

identifying two or more Campylobacter pathogens at the species level or different antibiotic

resistance genes, and real-time PCR is widely applied for Campylobacter quantification. As with

the conventional method, simple real time PCR is applied for quantification of a microorganism,

a gene, or a species, whereas real-time multiplex PCR should be used for quantifying more than

one Campylobacter species or different resistance genes, such as those specific for

fluoroquinolones and macrolides. Tools such as pulsed-field gel electrophoresis (PFGE) and

multilocus sequence typing (MLST) are commonly used for typing. For PFGE, the banding pattern

determines the relatedness of isolates, revealing correlation between bacteria isolated from

different sources, and the data can be analyzed by DNA "fingerprinting" using PulseNet. It is

possible to detect thousands of instances of pathogen contamination of food, and MLST is widely

used to characterize bacteria based on seven conserved housekeeping genes. Employed in

studies of population biology, epidemiological investigations, and pathogenic evolution of

bacteria, MLST data are stored in an electronic database (PubMLST database) that can be freely

accessed. This review contributes to the discussion regarding the main and most widely used

molecular methods for Campylobacter identification as well as methods showing strong potential

for identifying, quantifying, and typing this important pathogen.

108

Keywords: PCR, MLST, PFGE, retail meat, foodborne pathogen

109

LIST OF ABREVIATIONS

C. jejuni – Campylobacter jejuni

C. coli – Campylobacter coli

PCR – Polymerase Chain Reaction

qPCR – Real-time Polymerase Chain Reaction

PFGE – Pulsed-field Gel Electrophoresis

MLST – Multilocus Sequence Typing

DNA – deoxyribonucleic acid

PulseNet – PFGE database

PubMLST – MLST database

CDC – Centers for Disease Control and Prevention

USDA – United States Department of Agriculture

EFSA – European Food Safety Authority

FDA – Food and Drug Administration

REA – restriction endonuclease analysis

REP – repetitive extragenic palindromic

ERIC – enterobacterial repetitive intergenic consensus

RT-PCR – reverse transcription-Polymerase Chain Reaction

RFLP – restriction fragment length polymorphism

dNTP – deoxynucleotide triphosphate

bp – base pair

110

LIST OF CHAPTER TITLES

Introduction .................................................................................................................................

.................................................................................................................................................111

Characteristics of Campylobacter spp. ......................................................................................

.................................................................................................................................................112

Main Considerations......................................................................................... …. ...... 112

Foods Involved in Outbreaks and Importance for Public Health ........................... ...... 113

Molecular Biology and the Importance of the Use of Molecular Microbiology ..............115

Molecular Methods Applied for Campylobacter spp..........................................................116

Molecular Tools Used for Detection of Campylobacter spp. in Food of Animal Origin .118

Polymerase Chain Reaction (PCR) ...................................................................... ...... 118

Multiplex PCR ...................................................................................................... ...... 120

Real-time PCR (qPCR) ........................................................................................ ...... 121

Multiplex Real-Time PCR (qRT-PCR) .................................................................. ...... 123

Molecular Tools Used for Typing Campylobacter spp. in foods of animal origin ...........124

Pulsed-field Gel Electrophoresis (PFGE) ............................................................. ...... 124

Multilocus Sequence Typing (MLST).................................................................... ...... 127

Conclusions ............................................................................................................................130

111

INTRODUCTION

Previously classified as Vibrio spp., the Campylobacter genus was first proposed in 1963 by Sébald

and Véron. Campylobacter comprises a genus of gram-negative, micro-aerophilic, flagellated

bacteria that usually have a gull-wing shape. Coccoid forms can be observed in old or inviable

cultures. These thin (0.2 to 0.5 nm) and long (0.5 to 5 nm) microorganisms are mobile due to a

single polar flagellum two to three times the length of the cell itself (Nachamkin 2001; Franco

and Landgraf 2008). These bacteria can be found in the intestinal tracts of cattle, dogs, cats, and

sheep, with poultry and pigs being the most common reservoirs of C. jejuni and C. coli,

respectively (Stern and others 2003; USDA 2013), all of which are sources of infection for humans.

Transmission occurs via direct contact with feces or by food cross-contamination due to raw or

undercooked meat and raw milk (CDC 2013). Campylobacteriosis is the most frequently reported

zoonosis and the main bacterial foodborne disease in humans (Zendehbad and others 2015).

Because poultry and pigs have a higher prevalence of this microorganism in their natural

microbiota, the main foods involved in relation to public health are poultry and pork (Stern and

others 2003; Gallay and others 2007).

Isolation of Campylobacter is laborious, as these bacteria require enriched media and low

oxygen concentrations. Additionally, differentiation between species through conventional

bacteriology is difficult, as only very few biochemical characteristics differ among species (Miller

and others 2010). Thus, it is easier and faster to employ molecular biology techniques such as

polymerase chain reaction (PCR) and sequencing for identification purposes. In addition, tools

such as pulsed-field gel electrophoresis (PFGE) and multilocus sequence typing (MLST) are the

currently the most commonly used for typing (Goering 2010; Miller and others 2010; Behringer

112

and others 2011; Gharst and others 2013; Manfreda and others 2016; Pan and others 2016; Vidal

and others 2016; Oh and others 2017; Schleihauf and others 2017; Vinueza-Burgos and others

2017; Zhang and others 2017).

Within this context, the purpose of this review is to describe the main molecular

techniques used for the isolation and identification of Campylobacter spp. and to recommend

the fastest, most accurate, and most sensitive techniques with the best potential for typing and

identifying this genus in a food matrix.

CHARACTERISTICS OF CAMPYLOBACTER SPP.

Main Considerations

Public health services worldwide pay great attention to Campylobacter spp. because these

microorganisms are pathogenic to humans and commonly found in the gastrointestinal tracts of

cattle, dogs, cats, and sheep, though poultry and pigs are the most common reservoirs (USDA

2013). In 2009, the Campylobacter genus contained 29 species and 13 subspecies. In 2010, the

number of species rose to 32, though the number of subspecies remained the same (Euzéby

2010), with no change since (Euzéby 2014). Several species of Campylobacter may compromise

the health of humans and animals. In regard to foodborne disease, the most important species

are the thermophilic types C. jejuni, C. coli, C. lari, and C. upsaliensis, particularly the first two

(EFSA 2013).

Transmission and infection involve the consumption of feces-contaminated raw or

undercooked meat, especially poultry, and contaminated water. The disease begins with invasion

of the host gastrointestinal tract (Nachamkin and others 2008). For humans, C. jejuni is

113

considered the most pathogenic and is isolated more frequently than C. coli. Co-infection with C.

coli may also occur (Niederer and others 2012). The number of human campylobacteriosis cases

has increased worldwide, surpassing the number of cases of salmonellosis and shigellosis (Cover

and others 2014). Although it is still the most reported zoonotic disease, the number of human

cases of campylobacteriosis in the European Union decreased in 2012 for the first time in over a

five-year period (EFSA 2014b). The economic cost of the disease in developed countries in terms

of days away from work and medical treatment is significant (Newell and others 2010); for

example, the cost to the public health system and in terms of lost productivity in the EU has been

estimated at approximately 2.4 billion euros per year (EFSA 2014a).

Foods Involved in Outbreaks and Importance for Public Health

Products improperly handled or undercooked foods, especially poultry, pork, beef, and raw milk,

are primarily responsible for Campylobacter spp. infection because these species are a

constituent of the natural intestinal microbiota of birds, pigs, and cows (Jayasena and Jo 2013;

Frasao and Aquino 2014). In cattle, the prevalence of Campylobacter is 2.7% in carcass samples

(Wieczorek and Osek 2013). C. jejuni has also been found in many other foods, such as vegetables,

seafood, and animal species not intended for human consumption (FDA 2012). In Tanzania,

13.4% and 9.7% of raw milk and beef carcasses are positive for Campylobacter spp., respectively

(Kashoma and others 2016). Consumption of raw vegetables and fruits can also be a risk factor,

as Verhoeff-Bakkenes and others (2011) found a rate of 0.23% for the relationship between

Campylobacter infection and consumption of these products.

114

Most Campylobacter infections are associated with consumption of poultry and by-

products that have been contaminated during processing (Hermans and others 2011; Wagenaar

and others 2013). There are reports to date assessing the risk of Campylobacter in broiler

chickens (Dong and others 2015), and raw poultry meat is considered a high-risk raw material

with regard to the presence of Campylobacter spp. The evisceration stage is the most important

step for preventing slaughter contamination, and Campylobacter detection may be employed to

indicate microbiological safety (Jacxsens and others 2011). Rahimi and Ameri (2011) investigated

Campylobacter in poultry and found a higher prevalence in chicken meat (47.0%), followed by

quail (43.0%), partridge (35.3%), turkey (28.8%), and ostrich (4.8%) meats. Campylobacter is

mainly found in the cecum of birds; however, these animals display no symptoms (EFSA 2013).

The most prevalent species is C. jejuni, isolated from 92.0% of samples. Although most studies

describe C. jejuni as the most frequent species in broilers and laying hens (Aquino and others

2002), a survey by Miller and others (2010) in Grenada found C. coli to be the most frequent

species found in these animals.

Pigs are also responsible for the transmission of C. coli, as cited by various authors (Koike

and others 2008; Bratz and others 2013; von Altrock and others 2013). For example, Qin and

others (2011) found that 98.9% of swine tested carried C. coli. In 2013, 76.2% of the strains

isolated from pigs by von Altrock and others (2013) in Lower Saxony, Germany, were found to

consist of C. coli, with 21.1% being C. jejuni. A high prevalence of C. coli (42.4%) was also found

on pig breeding farms in Japan (Haruna and others 2013).

In the USA, campylobacteriosis outbreaks have been associated with non-pasteurized

milk or with pasteurized milk failure (Taylor and others 2013). In 2011 and 2012, the Centers for

115

Disease Control and Prevention (CDC) reported that most outbreaks linked to foodborne diseases

were also linked to unpasteurized (raw) milk (CDC 2014).

MOLECULAR BIOLOGY AND THE IMPORTANCE OF THE USE OF MOLECULAR

MICROBIOLOGY

Molecular biology was considerably advanced in the 1970s, and it became increasingly obvious

that phenotype expression is a characteristic of the genotype of an organism. Thus, it is important

to study microbial diversity and differences between food matrices and to precisely identify the

microorganisms responsible for a foodborne disease (Juste and others 2008). The genome is the

primary "molecular identity" of the bacterial cell, and DNA sequences from phylogenetic studies

are available in public databases (Olsen and others 1992; Benson and others 2004; Cole and

others 2005; D'Auria and others 2006), which facilitates and expedites species identification by

comparison with these sequences. Molecular methods have been applied in clinically relevant

areas, including epidemiological studies, giving rise to the term 'molecular epidemiology' (Siemer

and others 2005; Goering 2010).

Molecular tools are now available and affordable for the food industry and can be

implemented for food quality control and safety. Due to the need for rapid results, molecular

techniques have been developed for the identification of microorganisms in foodstuffs

(Ceuppens and others 2014). Molecular techniques, especially molecular typing techniques, are

used to characterize variability within a species. These techniques can also be used to track

specific types (strains with similar or identical standard features) in epidemiological studies. In

the case of C. jejuni and C. coli, two species that share similar niches and cause similar symptoms

116

in humans, few studies have reached the same results with different techniques applied to the

same set of samples (Behringer and others 2011).

Advances in DNA techniques applied to foodborne pathogens have improved the

understanding of epidemiology (Behringer and others 2011). Molecular approaches have helped

scientists determine that C. jejuni and C. coli are present in commercial broiler production

worldwide (He and others 2010). Moreover, rapid and direct quantification of Campylobacter

spp. in complex substrates, such as stool or environmental samples, is essential to facilitate

epidemiological studies on these pathogens in poultry and pig production systems (Leblanc-

Maridor and others 2011).

Molecular identification methods for Campylobacter spp. are rapid and specific through

detection of specific segments of DNA or RNA. Additionally, sequencing provides a rapid way to

detect specific DNA segments, enabling species and even subspecies determination (Gharst and

others 2013). In the search for more accurate and faster results as well as easier detection,

molecular techniques have been tested and used for the detection, identification, and

quantification of Campylobacter spp. in various food matrices and in foods of animal origin.

MOLECULAR METHODS APPLIED FOR CAMPYLOBACTER SPP.

Isolation and identification of Campylobacter spp. is laborious and difficult due to the particular

growth demands and to the phenotypic similarity between species. Culturing requires rich media

and low oxygen. Differentiation between species through conventional bacteriology is

challenging, as there are no major biochemical differences among species (Miller and others

2010; Toplak and others 2012). According to Toplak and others (2012), several techniques have

117

been proposed and tested as alternatives to classical procedures over the last 10 years. These

authors mainly referred to methods based on PCR. Overall, molecular typing of strains is a tool

of great importance for studying the genetic diversity of Campylobacter spp. and allows for

tracking of strains that cause infections in humans (Kittl and others 2013; Duarte and others

2014).

In addition to the molecular methods already described for the isolation and identification

of Campylobacter, plasmid profiling, restriction endonuclease analysis (REA), ribotyping,

repetitive extragenic palindromic (REP) sequence analysis, enterobacterial repetitive intergenic

consensus (ERIC) sequence analysis, reverse transcription-PCR (RT-PCR), nested PCR, and PCR

ribotyping represent useful methods. However, the most commonly used techniques for typing

isolates of Campylobacter are based on amplification of a short segment of DNA (repetitive

element sequence-based PCR (REP-PCR)), amplification and restriction of a particular gene

(restriction fragment length polymorphism, RFLP-flaA), restriction and migration of large

chromosomal segments (pulsed-field gel electrophoresis, PFGE), sequencing of housekeeping

fragments (multilocus sequence typing, MLST), PCR and sequencing (Goering 2010; Miller and

others 2010; Behringer and others 2011).

Frequently employed for identification purposes, molecular biology techniques such as

PCR and sequencing are easy and rapid approaches. Techniques such as PFGE and MLST are the

commonly used for typing of isolates (Goering 2010; Miller and others 2010; Behringer and

others 2011; Gharst and others 2013).

118

MOLECULAR TOOLS USED FOR DETECTION OF CAMPYLOBACTER SPP. IN FOOD

OF ANIMAL ORIGIN

Polymerase Chain Reaction (PCR)

PCR, which was described by Kary Mullis in 1980, is based on the principle of enzymatic

nucleic acid replication and is applied for fast and easy amplification of DNA. This method has an

irreplaceable role as one of the basic approaches for DNA analysis (Stanek 2013). This method is

both rapid and specific and can be applied for detection of pathogens in food, including

Campylobacter in products of animal origin (Giesendorf and others 1992; Wegmüller and others

1993; Docherty and others 1996; Jackson and others 1996; Ng and others 1997; Waage and

others 1999; O’Sulivan and others 2000; Sail and others 2003; Frasao and others 2015a, b; Raja

and others 2017).

As the main molecule examined using these techniques, DNA can be extracted from

different matrices of interest. To obtain a pure and ideal concentration of DNA, appropriate

techniques for extraction should be used. Raja and others (2017) tested the efficiency of three

types of extraction to obtain Campylobacter DNA from poultry meat: boiling, a bacterial DNA

extraction kit (Qiagen), and phenol-chloroform-isoamyl alcohol (25: 24: 1) extraction. Of the

methods tested, the Qiagen kit resulted in the highest purity and DNA concentration, whereas

the boiling method presented low purity. This difference can be explained by the utilization of a

spin column in the Qiagen kit, allowing for better and easier removal of impurities. However, the

high cost of the kit led the authors to select the phenol-chloroform-isoamyl alcohol (25: 24: 1)

extraction method, which provided a good level of purity and concentration. The choice of

method will depend on the relevant conditions. Some authors use the boiling method (Shams

and others 2017; Zang and others 2017), others prefer the kit (Frasao and others 2015a, b; Ayaz

119

and others 2016; Gosselin-Theberge and others 2016; Rodgers and others 2016), whereas others

employ phenol-chloroform-isoamyl alcohol (25: 24: 1) extraction (Raja and others 2017).

For the PCR technique, a mixture of reagents is prepared to produce a reaction buffer,

including magnesium chloride, deoxynucleotide triphosphates (dNTPs, i.e., guanine, adenine,

thymine, and cytosine bases), oligonucleotides (primers) complementary to the gene of interest,

Taq polymerase, and the DNA sample. Primers may be between 18 and 35 bp and normally

amplify segments of DNA between 200 and 800 bp. This mixture is placed in a thermocycler,

which is programmed for a series of cycles depending on the microorganism and the primers

used. In the first stage, the DNA is denatured, followed by cooling for annealing of the primer to

the DNA strand; the sample is then subjected to a high temperature for DNA synthesis and

extension (Hue-Roye and Vege 2008). For Campylobacter, a temperature of approximately 94ºC

is applied for denaturation, with annealing at 52-54ºC and extension at 72ºC (Frasao and others,

2015a, b; Raja and others 2017; Zang and others 2017).

A benefit to the food supply is achieved when PCR technology is used to detect pathogenic

agents in foods, with important considerations for reducing limitations of PCR inhibition by the

food matrix composition and the detection of dead cells. However, quantification is excluded

(Postollec and others 2011). With PCR, specificity is enhanced by using primers specific for

Campylobacter (von Altrock and others 2013; Lemos and others 2015; Han and others 2016), C.

coli (Gonzalez and others 1997; von Altrock and others 2013; Fontanot and others 2014a; Lemos

and others 2015; Frasao and others 2015a, b; Han and others 2016), C. jejuni (von Altrock and

others 2013; Fontanot and others 2014a; Lemos and others 2015; Ayaz and others 2016; Han and

others 2016; Raja and others 2017), C. lari (Fontanot and others 2014a), and C. upsaliensis

120

(Fontanot and others 2014a) (Table 1). In addition to these specific primers, it is possible to

amplify to different sizes (bp) by using a primer linked to the 16S-23S ITS sequence, as this region

has a variable size and is interspersed within well-conserved regions, allowing differentiation

between C. jejuni and C. coli (Fontanot and others 2014b). Virulence and toxin genes, such as

cadF and cdtB, are also examined (Lemos and others 2015) to verify the importance of strains to

public health.

After amplification, the products are separated by gel electrophoresis, and the timeframe

required for gel analysis as well as the inability to verify large numbers of strains are major

impediments to this approach. In addition, although ethidium bromide is a relatively inexpensive

reagent for DNA gel staining, it poses human and environmental safety concerns (Barletta and

others 2013). Despite the limitations regarding this technique, PCR does allow for verification of

the presence of a unique species in an amplification reaction and requires more time than

multiplex PCR, which enables determination of the presence of more than one species in a single

reaction (Gharst and others 2013; Stanek 2013).

Multiplex PCR

Multiplex PCR (mPCR), allowing detection of 2 or more species in the same sample, has been

developed in recent years (Gharst and others 2013). In experiments in which there is a need to

identify different species of Campylobacter, or different genera, application of mPCR has great

potential. However, this technique has some limiting factors, such as identifying or obtaining

primers that have similar annealing temperatures (El-Adawy and others 2012).

121

This methodology can readily be applied to Campylobacter spp. and C jejuni (Frasao and

others 2015b) as well as C. coli, as has been described by various authors (Bratz and others 2013;

Zendehbad and others 2015; Kashoma and others 2016; Rodgers and others 2016; Shams and

others 2017); C. jejuni, C. coli, C. lari, and C. upsaliensis can also be identified using this method

(Girgis and others 2014) (Table 1). In addition, Raja and Rao (2016) used the technique to detect

two different pathogens, C. jejuni and Listeria monocytogenes, in chicken meat during processing.

Nonetheless, complex sample preparation methods and manipulation of amplification products,

i.e., gel electrophoresis detection methods, are required, which hampers the routine use of these

methods in food microbiology laboratories (Sails and others 2003). Accordingly, other faster PCR

techniques have been developed, such as real-time PCR.

Real-time PCR (qPCR)

Among the molecular methods based on PCR, real-time PCR (qPCR) offers speed, robustness, and

high sensitivity and specificity for analysis. Accurate quantification of DNA and RNA can be

performed. As this method enables online detection of the PCR product (Juste and others 2008),

eliminating the need to manipulate PCR products after amplification, the risk of false-positive

results through cross-contamination between amplification products and subsequent test

samples is reduced (Sails and others 2003; McKillip and Drake 2004). Quantitative PCR methods

with endpoint detection utilize an internal or external control with known concentrations that

are amplified in parallel with the tested samples, and the results for a sample are provided from

control data (Reischl and Kochanowski 1995). However, this methodology has limitations in its

accuracy because the final quantity of the product that is accumulated in the final PCR process is

122

very susceptible to small variations. The TaqMan 5 nuclease PCR method utilizes a fluorogenically

labeled probe, which when hybridized and cleaved allows detection of the PCR product

accumulated during the amplification reaction (Livak and others 1995). The fluorescence emitted

is the direct result of the specific PCR product incorporating that probe. This increase can be

monitored in real time, allowing accurate quantification of the DNA or RNA sequence (Gibson

and others 1996).

This method has the ability to quantify target organisms in complex matrices and is

therefore a promising tool for improving the safety and quality of food. Indeed, food scientists

employ using real-time PCR for security management and food quality (Martínez and others

2011). Compared to conventional PCR, the possible rapid and reliable detection as well as

quantification of specific pathogens is highly desirable (Josefsen and others 2010), and there is a

reduced risk of contamination because the presence of labeled DNA is indicated by an increase

in fluorescence. Additionally, it is possible to quantify specific microorganisms (Dolan and others

2010). This methodology is attractive because it is fast and robust, as there is no need for

processing to detect the amplified product (Barletta and others 2013).

The application of real-time PCR to the food industry supports the detection of

pathogens; the approach is recognized and trusted (Boyer and Combrisson 2013), and it has been

used to detect different species of Campylobacter (Postollec and others 2011; Vencia and others

2014). For detection of the Campylobacter genus, the primers used are specific for 16 rRNA genes

(Garcia and others 2013; de Boer and others 2015; Gosselin-Theberge and others 2016).

However, for detection of C. jejuni, the primers can be specific for the hipO gene (de Boer and

others 2015), the ccoN or the hypO gene (Toplak and others 2012), the rpoB gene (Rantsiou and

123

others 2010) or open reading frame (ORF) C (Sails and others 2003). For detection of C. coli,

primers specific for the cadF gene (Toplak and others 2012) or the glyA gene (de Boer and others

2015) have been used. A significant number of studies report using qPCR for detection of

Campylobacter spp. However, due to some difficulties, there are few reports of the use of this

methodology for quantification of Campylobacter in food; for example, all Campylobacter

bacteria present in the sample, including dead cells, are detected (Josefsen and others 2010;

Melero and others 2011). Thus, RNA can be extracted to evaluate only viable strains (Josefsen

and others 2010). Similarly, conventional PCR and multiplex real-time PCR allow evaluation of the

presence of different species or genera in the same reaction.

Multiplex Real-Time PCR (qRT-PCR)

Segments of DNA can be amplified in a simple multiple reaction to simultaneously detect and

differentiate various species and strains of bacteria. Several studies have been conducted for

discriminating among different species of Campylobacter, especially C. jejuni and C. coli, C. jejuni,

C. coli and C. lari, or C. jejuni, C. coli and C. upsaliensis, and for detection of different genera, such

as Campylobacter, Salmonella, and Shigella (He and others 2010; Barletta and others 2013), C.

coli, C. jejuni, Escherichia coli O157:H7, and Salmonella spp. (Taminiau and others 2014), or C.

jejuni, Mycobacterium bovis, Enterobacter sakazaki, Shigella boydii, Clostridium perfringens

(Karus and others 2017) (Table 1).

For simultaneous detection of C. jejuni and C. coli, primers for amplifying the hypo gene

(amidohydrolase benzoylglycine) and the glyA gene (serine hydroxymethyltransferase) are used.

The hypO gene is responsible for the hippurate activity found exclusively in C. jejuni, and the glyA

124

gene is found in a unique sequence in C. coli (Leblanc-Maridor and others 2011). A combination

of primers for amplifying the ccoN gene was reported to be specific for C. jejuni, and the addition

of primers specific for C. coli cadF has been used for simultaneous detection of both species

(Toplak and others 2012). Amplification of the hypO gene (C. jejuni) and cadF gene (C. coli) has

also been employed (Toplak and others 2012). Simultaneous detection of thermophilic species

using the bipA gene was validated for C. upsaliensis and C. lari, and the cje0832 gene as used for

C. jejuni and C. coli (Bonjoch and others 2010). For simultaneous detection of C. jejuni, C. coli, C.

lari, C. upsaliensis, and C. fetus subsp. fetus, primers specific for the hypo for the first, sapB2 for

the last, and glyA for others were utilized (Wang and others 2002). Primers amplifying the 16S

RNA gene detect the efflux pump, which characterizes cmeABC resistance, and the hypo gene is

used to detect C. jejuni; the cdtA gene is used to detect C. coli and the peptidyl gene to detect C.

lari and allow simultaneous detection of the presence of the efflux pump for identifying the C.

jejuni, C. coli, and C. lari (He and others 2010). Additionally, a commercial real-time PCR-based

method kit for detecting C. jejuni, C. coli, and C. lari in foods, fruit and vegetable-based products

and dairy products was validated by Vencia and others (2014).

However, PCR techniques, including PCR, multiplex PCR, q-PCR, and q-RT-PCR, do not

allow for the molecular characterization of Campylobacter. Conversely, PFGE and MLST are

efficient tools for this purpose.

MOLECULAR TOOLS USED FOR TYPING CAMPYLOBACTER SPP. IN FOODS OF

ANIMAL ORIGIN

Pulsed-field Gel Electrophoresis (PFGE)

125

In 1980, an electrophoretic “alternative” was developed based on the principle of periodic

reorientation of the electric field (migration and DNA) relative to the direction of the gel. As

smaller DNA molecules require less time than larger molecules to redirect after application of a

gradual increase in electrophoretic pulse time, the observed different directions allow for

separation of DNA fragments of different sizes, from kb to Mb. Electrophoresis separates

molecules according to their electric charge, with the formation of strips or bands grouping

similar fragments (Goering 2010). PFGE is based on gel electrophoresis of restriction-digested

genomic DNA (Noormohamed and Fakhr 2014).

The principle of PFGE is that DNA molecules, including Mb-size fragments, can be

separated by applying a periodic pulse to the electric field in different directions. Fragments

hundreds of kb in length migrate proportional to their sizes and the pulse time (Goering 2010).

In this case, the pattern of the bands determines the relatedness of the isolates (Noormohamed

and Fakhr 2014). Due to its efficiency, PFGE prevents compacting of the fragments and allows for

separation of intact chromosomes of yeast and molds. However, as mammalian chromosomes

are too large, special restriction enzymes that first cleave DNA fragments of 40 kb to 2 Mb are

required (Mawer and Leach 2014).

This methodology is widely used for typing to obtain a clear comparison of genomic

relationships among bacterial isolates, with the ability to correlate isolated microorganisms from

different sites and samples. This technique is classified as a third-generation technique that uses

molecular interaction and is considered the “gold standard” for evaluating inter-relationships

between isolates, including foodborne pathogens (Goering 2010; Chung and others 2012;

Noormohamed and Fakhr 2014). Additionally, a network project, called Campynet, to standardize

126

subtyping methods for Campylobacter in the European Union was created in 1998. Three

protocols were validated: fla-PCR RFLP, PFGE, and amplified fragment length polymorphism

(AFLP) (www.svs.dk/campynet). In addition, outbreaks of foodborne illness can be detected and

examined using data obtained and "fingerprinting" patterns in PulseNet, a network of national

and international laboratories for foodborne disease. As PFGE is the molecular subtyping method

of choice for PulseNet laboratories, it is possible to detect thousands of food outbreaks (CDC

2013).

Typing of Campylobacter strains isolated from pigs, poultry, turkey, sheep, and lambs by

PFGE has been described, mainly in outbreak investigations for correlating the isolates from sick

patients with those from animal products (Silva and others 2016; Lahti and others 2017a). In

many cases, the sample must be digested with the restriction enzymes SmaI and KpnI for

efficiency (Abley and others 2012; Melero and others 2012; Garcia and others 2013; Abay and

others 2014). A first digestion with the SmaI enzyme and a second digestion with the SmalI

enzyme were also introduced (Postollec and others 2011). However, only SmaI was applied by

Oyarzabal and others (2013), Silva and others (2016), and Lahti and others (2017a, b).

In New Zealand, the most frequently isolated PFGE genotypes of Campylobacter spp. from

sheep were typically natural strains in ovine feces and those observed to cause disease in humans

(Gilpin and others 2013). Silva and others (2016) found that Campylobacter clones belonging to

poultry flocks to indicate endemic strains with horizontal transmission among birds. In addition,

the genetic profile associated with different farms suggested different sources of contamination.

Lahti and others (2017b) determined that human and cattle C. jejuni isolates belong to same

cluster; thus, cattle were considered the source of microorganisms at that particular dairy farm.

127

However, patterns not distinguishable after multiple attempts were excluded. In one study,

isolates from chicken rectal swabs presented high similarity (100%), with the lowest being 26%;

such similarity indicates a level of homogeneity and identical genotypes. Nonetheless, other

authors identified differences in resistance profiles, including multidrug-resistant strains (Bakhshi

and others 2016). The presence of 6 genotypes indistinguishable from human clinical isolates

suggests that the survival data generated by this study are applicable to zoonotic Campylobacter

strains (Chung and others 2012). In addition, because of the potential to identify and determine

groups of bacteria or food outbreaks, this methodology can be applied for assessing gene

location, such as gentamicin-resistant genes on a plasmid or the chromosome (Yao and others

2017).

PFGE is widely used as a genotyping method for bacteria, including foodborne pathogens,

enabling determination of the genetic proximity of these microorganisms. However, several

factors can influence gel resolution and quality of the results, including variations in voltage,

pulse time, gel concentration, temperature, buffer solution, angle between the alternating fields,

sample preparation, and choice of restriction enzyme. Moreover, its disadvantages include the

requirement of expensive equipment and complex protocols, without standardized methods for

result interpretation, which makes it difficult to compare with data from other researchers

(Noormohamed and Fakhr 2014). Another method of genotyping is MLST, which can confirm

small differences in strains that are considered identical in PFGE and allows for a better

comparison between results obtained by different scientists.

Multilocus Sequence Typing (MLST)

128

In 1998, MLST was proposed as a universal and definitive method for characterizing bacteria

(Maiden and others 1998). This technique is used for the characterization of bacterial isolates

based on the sequences of internal fragments of 7 housekeeping genes that are fairly conserved.

Each recorded sequence of each gene is given a number (Noormohamed and Fakhr 2014). MLST

can be used for epidemiological investigations, studies of population biology, and the pathogenic

evolution of bacteria (Urwin and Maiden 2003; Maiden 2006; Strachan and others 2012;

Noormohamed and Fakhr 2014). Unlike most techniques used for typing, which compare the

sizes of DNA fragments on gels, the allelic profiles obtained by MLST can be compared with those

found in databases, and the results are unambiguous (Maiden and others 1998).

A series of 7 integers represents the alleles of 7 housekeeping loci. The alleles at each of

the 7 loci define the sequence type of each isolate, and the different sequences found within

bacterial species are assigned to distinct alleles for each housekeeping gene. The sequences are

indicated by different numbers of alleles, despite differences in nucleotides between alleles and

the fact that such differences can be found at a single nucleotide site or at many sites (Maiden

and others 1998).

In MLST, gene fragments are amplified from chromosomal DNA using PCR. For each gene

fragment, sequences are compared, and the sequence of identical isolates receives the same

number assigned to an allele. The number of alleles at each of the 7 loci is assigned by comparing

the sequences of each fragment with all sequences previously identified including at that locus.

For each strain, the combination of the 7 allele numbers defines the allelic profile of the strain,

and a multilocus sequence type is assigned to each different allelic profile. The relationship

between each multilocus sequence type is illustrated in a dendrogram (Maiden and others 1998).

129

Due to variation, MLST tool can detect more alleles per locus than other molecular typing

methods and data can be compared between laboratories and stored in electronic databases for

wide access, thus supporting global epidemiology and comparison (Dingle and others 2001). The

MLST patterns for C. jejuni and C. coli have been determined and available (Dingle and others

2002; Jolley and Maiden 2010;; PubMLST.org 2016). This technique can be applied to almost all

species of bacteria and other haploid organisms, including those difficult to culture, and for

characterizing hypervariable genomes, such as that of Campylobacter spp. (Maiden and others

1998; Dingle and others 2001; Behringer and others 2011; Noormohamed and Fakhr 2014; Wei

and others 2014).

MLST requires PCR amplification of the 7 MLST loci: aspA (aspartase), glnA (glutamine

synthetase), gltA (citrate synthase), glyA (serine hydroxy methyl transferase), tkt (transketolase),

pgm (phospho glucomutase), and uncA (ATP synthase alpha subunit). This technique is described

in several studies of isolated Campylobacter spp. strains from ducks, milk, chickens, pork, and

beef (Strachan and others 2012; Stone and others 2013; Bianchini and others 2014; Carrique-Mas

and others 2014; Noormohamed and Fakhr 2014; Revez and others 2014; Wei and others 2014).

This tool is commonly used to determine the sequence types (STs) of Campylobacter isolates as

well as genotypes and genetic diversity (Strachan and others 2012; Stone and others 2013;

Bianchini and others 2014; Revez and others 2014; Wei and others 2014; Vidal and others 2016)

and for typing (Behringer and others 2011; Abley and others 2012; Egger and others 2012;

Manfreda and others 2016; Pan and others 2016; Vinueza-Burgos and others 2017). MLST can be

applied to determine macrolide and quinolone resistance based on partial sequences of 23S rRNA

and gyrA genes (Jonas and others 2015). It can also detect the level of genetic diversity of species

130

and predict inter-species transmission, as reported for experiments on pig and poultry farms

(Ceuppens and others 2014), and to determine genetic relatedness between C. jejuni and C. coli

isolates from retail meat sources (Noormohamed and Fakhr 2014) and Campylobacter isolates

from chicken flocks on two farms (Zhang and others 2017). MLST has also been used in reports

of outbreaks and for determining public health cases (Schleihauf and others 2017) and

epidemiological relationships of C. jejuni strains from chickens and humans (Oh and others 2017).

In all these studies, STs and clonal complexes (CCs) were assigned using the C. jejuni or C. coli

PubMLST database.

This technology is of great importance for the genotyping of Campylobacter and is an

important tool for elucidating the diversity of animal hosts for Campylobacter isolates. In

addition, this technique can be used in the epidemiological investigation of outbreaks and related

diseases. MLST provides not only information on transmission routes to humans but also on host-

specific emergence of antibiotic-resistant clones and their persistence within the animal host and

environment (Stone and others 2013). However, it is not possible to examine the bacterial

genome or determine codons mutated when testing antimicrobial resistance.

CONCLUSIONS

Current molecular methodologies constitute breakthroughs in detecting and typing

microorganisms responsible for foodborne illness. PCR is an important technique for the

differentiation of species within Campylobacter and can be used for confirmation of strains

assessed using conventional microbiology. Although quantification is not possible using this

technique, it was and still is widely used to confirm and identify species, virulence genes and even

131

plasmids responsible for antimicrobial resistance. To lower the cost of technology, multiplex PCR

is an important tool for simultaneous detection of certain species and even genera such as C. coli,

C. jejuni, C. coli, C. jejuni, and C. lari, as well as Salmonella, Shigella and Campylobacter. Allowing

for bacterial quantification, real-time PCR (qPCR) has been applied for the identification and

quantification of Campylobacter spp. The application of multiplex PCR in real time allows not only

simultaneous identification of different species but also quantification of each species in one

analysis or reaction. With regard to species difficult to quantify, isolate, or distinguish, such as

Campylobacter spp., PFGE is an important technique enabling research on the entire food supply

chain as well as the tracing and estimation of the same strain responsible for contamination, from

the raising of the animal to the foodborne illness in a human. In addition, MLST is of great

importance for the genotyping of Campylobacter spp., as well as elucidating the diversity of

animal hosts of Campylobacter isolates. With this tool, detection of host-specific emergence of

antibiotic-resistant clones and their persistence within the animal host, the environment, and

food can be achieved. Moreover, PCR should be used when the research aim is to detect the

presence or absence of Campylobacter and specific species in food. Another application is

determination of particular characteristics, such as antibiotic resistance and virulence genes.

Multiplex PCR should be performed when the goal is identification of a microorganism at the

species level or a different species. However, when quantification is the objective, real-time PCR

should be applied. PFGE can be used to correlate strains isolated from different sites in an effort

to determine the level of relationship between strains. The MLST approach is also able to detect

the level of genetic diversity of species and predict inter-species transmission. PFGE and MLST

can be used to type and determine the relationship between contaminated products and human

132

cases in outbreaks. In view of these state-of-the-art techniques, current molecular tools are both

promising and important for the identification and differentiation of Campylobacter spp., as well

as for the quantification and determination of characteristics of different strains.

Acknowledgements

The authors thank the Research Foundation of the State of Rio de Janeiro (grants E-

26/201.185/2014 and E-26/010.001911/2015, FAPERJ, Brazil) and the National Council of

Technological and Scientific Development (grant 311361/2013-7, CNPq, Brazil) for financial

support. B.S. Frasao was supported by the Coordination of Enhancement of People of a Superior

Level (grant 125, 15/2014, CAPES/EMBRAPA, Brazil) graduate scholarship.

Author Contributions

Frasão interpreted and compiled the data and drafted the manuscript. Marin researched prior

studies. Conte-Junior supervised and reviewed the writing of the manuscript.

References

Abay S, Kayman T, Otlu B, Hizlisoy H, Aydin F, Ertas N. 2014. Genetic diversity and antibiotic

resistance profiles of Campylobacter jejuni isolates from poultry and humans in Turkey.

Int J Food Microbiol 178:29–38.

Abley MJ, Wittum TE, Funk JA, Gebreyes WA. 2012. Antimicrobial susceptibility, pulsed-field gel

electrophoresis, and multi-locus sequence typing of Campylobacter coli in swine before,

during, and after the slaughter process. Foodborne Pathog Dis 9:506–12.

133

Ansari-Lari M, Hosseinzadeh S, Shekarforoush SS, Abdollahi M, Berizi E. 2011. Prevalence and risk

factors associated with Campylobacter infections in broiler flocks in Shiraz, southern

Iran. Int J Food Microbiol 144(3): 475–9.

Aquino MH, Filgueiras AL, Ferreira MC, Oliveira SS, Bastos MC, Tibana A. 2002. Antimicrobial

resistance and plasmid profiles of Campylobacter jejuni and Campylobacter coli from

human and animal sources. Lett Appl Microbiol 34:149–53.

Ayaz N, Goncuoglu M, Cakmak O, Erol I. 2016. Comparison of hipO and ceuE gene based PCR

assays for the detection of Campylobacter jejuni. J Clin Microbiol Biochem Technol 8:6–

8.

Bakhshi B, Kalantar M, Rastegar-Lari A, Fallah F. 2016. PFGE genotyping and molecular

characterization of Campylobacter spp. isolated from chicken meat. Iran J Vet Res

17:177–83.

Barletta F, Mercado EH, Lluque A, Ruiz J, Cleary TG, Ochoa TJ. 2013. Multiplex real-time PCR for

detection of Campylobacter, Salmonella, and Shigella. J Clin Microbiol 51:2822–9.

Behringer M, Miller WG, Oyarzabal OA. 2011. Typing of Campylobacter jejuni and Campylobacter

coli isolated from live broilers and retail broiler meat by flaA-RFLP, MLST, PFGE and REP-

PCR. J Microbiol Methods 84:194–201.

Benson DA, Karsch-Mizrachi I, Lipman DJ, Ostell J, Wheeler DL. 2004. GenBank: update. Nucleic

Acids Res 32:D23–26.

Bianchini V, Borella L, Benedetti V, Parisi A, Miccolupo A, Santoro E, Recordati C, Luini M. 2014.

Prevalence in bulk tank milk and epidemiology of Campylobacter jejuni in dairy herds in

Northern Italy. Appl Environ Microbiol 80:1832–7.

134

Bonjoch X, Calvó L, Soler M, Ruiz-Rueda O, Garcia-Gil LJ. 2010. A new multiplexed real-time PCR

assay to detect Campylobacter jejuni, C. coli, C. lari, and C. upsaliensis. Food Anal

Methods 3:40–46.

Boyer M, Combrisson J. 2013. Analytical opportunities of quantitative polymerase chain reaction

in dairy microbiology. Int Dairy J 30:45–52.

Bratz K, Bucker R, Golz G, Zakrzewski SS, Janczyk P, Nockler K, Alter T. 2013. Experimental

infection of weaned piglets with Campylobacter coli-excretion and translocation in a pig

colonisation trial. Vet Microbiol 162:136–43.

Carrique-Mas JJ, Bryant JE, Cuong NV, Hoang NV, Campbell J, Hoang NV, Dung TT, Duy DT, Hoa

NT, Thompson C, Hien VV, Phat VV, Farrar J, Baker S. 2014. An epidemiological

investigation of Campylobacter in pig and poultry farms in the Mekong delta of Vietnam.

Epidemiol Infect 142:1425–36.

CDC/US (Center for Desease Control and Prevention). 2014. New CDC data on foodborne disease

outbreaks. Available from: http://www.cdc.gov/features/foodborne-diseases-

data/?s_cid=cdc_homepage_feature_002. Accessed 2014 June 25.

CDC/US (Centers for Disease Control and Prevention). 2013. Campylobacter. Available from:

http://www.cdc.gov/nczved/divisions/dfbmd/diseases/campylobacter/. Accessed 2013

November 12.

Ceuppens S, Li D, Uyttendaele M, Renault P, Ross P, Ranst MV, Cocolin L, Donaghy J. 2014.

Molecular methods in food safety microbiology: interpretation and implications of

nucleic acid detection. Compr Rev Food Sci Food Saf 13:551–77.

http://www.cdc.gov/features/foodborne-diseases-data/?s_cid=cdc_homepage_feature_002

http://www.cdc.gov/features/foodborne-diseases-data/?s_cid=cdc_homepage_feature_002

135

Chung S, Yi J, Jang MH, Joo SI, Ra EK, Kim SY, Chang CL, Park SS, Kim EC. 2012. Comparison of

modified multiple-locus variable-number tandem-repeat fingerprinting with pulsed-

field gel electrophoresis for typing clinical isolates of Staphylococcus aureus. Ann Lab

Med 32:50–6.

Cole JR, Chai B, Farris RJ, Wang Q, Kulam SA, McGarrell DM, Garrity GM, Tiedje JM. 2005. The

ribosomal database project (RDP-II): sequences and tools for high-throughput rRNA

analysis. Nucleic Acids Res 33:D294–6.

Cover KE, Ruiz SA, Chapman AS. 2014. Reported gastrointestinal infections in the U.S. Air Force,

2000-2012. MSMR 21:2–7.

D'Auria G, Pushker R, Rodriguez-Valera F. 2006. IWoCS: analyzing ribosomal intergenic

transcribed spacers configuration and taxonomic relationships. Bioinformatics 22:527–

31.

de Boer P, Rahaoui H, Leer RJ, Montijn RC, van der Vossen JM. 2015. Real-time PCR detection of

Campylobacter spp.: a comparison to classic culturing and enrichment. Food Microbiol

51:96–100.

Denis M, Soumet C, Rivoal K, Ermel G, Blivet D, Salvat G, Colin P. 1999. Development of a m-PCR

assay for simultaneous identification of Campylobacter jejuni and C. coli. Lett Appl

Microbiol 29:406–10.

Dingle KE, Colles FM, Wareing DR, Ure R, Fox AJ, Bolton FE, Bootsma HJ, Willems RJ, Urwin R,

Maiden MC. 2001. Multilocus sequence typing system for Campylobacter jejuni. J Clin


136

Dingle KE, Colles FM, Wareing DR, Ure R, Wagenaar JA, Duim B, Bolton FJ, Fox AJ, Wareing DR,

Maiden MC. 2002. Molecular characterization of Campylobacter jejuni clones: a basis

for epidemiologic investigation. Emerg Infect Dis 8:949–55.

Docherty L, Adams MR, Patel P, McFadden J. 1996. The magnetic immuno-polymerase chain

reaction assay for the detection of Campylobacter in milk and poultry. Lett Appl


Dolan A, Burgess CM, Fanning S, Duffy G. 2010. Application of quantitative reverse-transcription

PCR (qRT-PCR) for the determination of the total viable count (TVC) on meat samples. J

Appl Microbiol 109:91–8.

Dong QL, Barker GC, Gorris LG, Tian MS, Song XY, Malakar PK. 2015. Status and future of

quantitative microbiological risk assessment in China. Trends Food Sci Technol 42:70–

80.

Duarte A, Santos A, Manageiro V, Martins A, Fraqueza MJ, Canica M, Domingues FC, Oleastro M.

2014. Human, food and animal Campylobacter spp. isolated in Portugal: high genetic

diversity and antibiotic resistance rates. Int J Antimicrob Agents 44:306–13.

EFSA (European Food Safety Authority). 2013. Panel on biological hazards. Scientific opinion on

the evaluation of molecular typing methods for major food-borne microbiological

hazards and their use for attribution modelling, outbreak investigation and scanning

surveillance: part 1 (evaluation of methods and applications). EFSA J 11:3502.

EFSA (European Food Safety Authority). 2014a. Campylobacter. Available from:

http://www.efsa.europa.eu/en/topics/topic/campylobacter.htm. Accessed 2016 June

1.

137

EFSA (European Food Safety Authority). 2014b. Campylobacter decreases slightly, Salmonella

down, Listeria up-EFSA and ECDC say. Available from:

http://www.efsa.europa.eu/en/press/news/140219.htm. Accessed 2016 May 28.

Egger R, Korczak BM, Niederer L, Overesch G, Kuhnert P. 2012. Genotypes and antibiotic

resistance of Campylobacter coli in fattening pigs. Vet Microbiol 155:272–78.

El-Adawy H, Hotzel H, Tomaso H, Neubauer H, Hafez HM. 2012. Elucidation of colonization time

and prevalence of thermophilic Campylobacter species during turkey rearing using

multiplex polymerase chain reaction. Poult Sci 91:454–9.

Euzéby JP. 2010. List of prokaryotic names with standing in nomenclature: genus Campylobacter.

Available from: http://www.bacterio.net/campylobacter.html. Accessed 2016

December 20.

Euzéby JP. 2014. List of prokaryotic names with standing in nomenclature: genus Campylobacter.

Available from: http://www.bacterio.net/campylobacter.html. Accessed 2016

December 23.

FDA (Food and Drug Administration). 2012. Bad bug book, foodborne pathogenic microorganisms

and natural toxins-Campylobacter jejuni. 2nd ed. FDA p 14–17. Available from:

http://vm.cfsan.fda.gov/~mow/intro.html.

Fontanot M, Iacumin L, Cecchini F, Comi G, Manzano M. 2014a. Rapid detection and

differentiation of important Campylobacter spp. in poultry samples by dot blot and PCR.

Food Microbiol 43:28–34.

138

Fontanot M, Iacumin L, Cecchini F, Comi G, Manzano M. 2014b. PorA specific primers for the

identification of Campylobacter species in food and clinical samples. LWT-Food Sci

Technol 58:86–92.

Franco BDGM, Landgraf M. 2008. Microrganismos patogênicos de importância em alimentos. In:

Microbiologia dos alimentos. São Paulo: Atheneu. p 33–81.

Frasao BS, Aquino MHC. 2014. Campylobacter spp. em aves (Gallus gallus domesticus) e suínos

(Sus domesticus): resistência a antimicrobianos e importância na saúde coletiva.

Enciclopédia Biosfera 10:745–58.

Frasao BS, Cortes LR, Nascimento ER, Cunha NC, Almeida VL, Aquino MHC. 2015a. Detecção de

resistência às fluoroquinolonas em Campylobacter isolados de frangos de criação

orgânica. Pesq Vet Bras 35:613–9.

Frasao BS, Medeiros V, Barbosa AV, de Aguiar WS, dos Santos FF, Abreu DLDC, Clementino MM,

de Aquino MHC. 2015b. Detection of fluoroquinolone resistance by mutation in gyrA

gene of Campylobacter spp. isolates from broiler and laying (Gallus gallus domesticus)

hens, from Rio de Janeiro State, Brazil. Cienc Rural 45:2013–18.

Gallay A, Prouzet-Mauléon V, Kempf I, Lehours P, Labadi L, Camou C, Denis M, de Valk H,

Desenclos J-C, Mégraud F. 2007. Campylobacter antimicrobial drug resistance among

humans, broiler chickens, and pigs, France. Emerg Infect Dis 13:259–66.

Garcia AB, Kamara JN, Vigre H, Hoorfar J, Josefsen MH. 2013. Direct quantification of

Campylobacter jejuni in chicken fecal samples using real-time PCR: evaluation of six

rapid DNA extraction methods. Food Anal Methods 6:1728–38.

139

Gharst G, Oyarzabal OA, Hussain SK. 2013. Review of current methodologies to isolate and

identify Campylobacter spp. from foods. J Microbiol Methods 95:84–92.

Gibson UE, Heid CA, Williams PM. 1996. A novel method for real time quantitative RT-PCR.

Genome Res 6:995–1001.

Giesendorf BA, Quint WG, Henkens MH, Stegeman H, Huf FA, Niesters HG. 1992. Rapid and

sensitive detection of Campylobacter spp. in chicken products by using the polymerase

chain reaction. Appl Environ Microbiol 58:3804–8.

Gilpin BJ, Walshe G, On SL, Smith D, Marshall JC, French NP. 2013. Application of molecular

epidemiology to understanding campylobacteriosis in the Canterbury region of New

Zealand. Epidemiol Infect 141:1253–66.

Girgis SA, Rashad SS, Othman HB, Bassim HH, Kassem NN, El-Sayed FM. 2014. Multiplex PCR for

identification and differentiation of Campylobacter species and their antimicrobial

susceptibility pattern in Egyptian patients. Int J Curr Microbiol App Sci 3:861–75.

Goering RV. 2010. Pulsed field gel electrophoresis: a review of application and interpretation in

the molecular epidemiology of infectious disease. Infect Genet Evol 10:866–75.

Gonzalez I, Grant KA, Richardson PT, Park SF, Collins MD. 1997. Specific identification of the

enteropathogens Campylobacter jejuni and Campylobacter coli by using a PCR test

based on the ceuE gene encoding a putative virulence determinant. J Clin Microbiol

35:759–63.

Gosselin-Theberge M, Taboada E, Guy RA. 2016. Evaluation of real-time PCR assays and standard

curve optimisation for enhanced accuracy in quantification of Campylobacter

environmental water isolates. J Microbiol Methods 129:70–7.

140

Han X, Zhu D, Lai H, Zeng H, Zhou K, Zou L, Wu C, Han G, Liu S. 2016. Prevalence, antimicrobial

resistance profiling and genetic diversity of Campylobacter jejuni and Campylobacter

coli isolated from broilers at slaughter in China. Food Control 69:160–70.

Haruna M, Sasaki Y, Murakami M, Mori T, Asai T, Ito K, Yamada Y. 2013. Prevalence and

antimicrobial resistance of Campylobacter isolates from beef cattle and pigs in Japan. J

Vet Med Sci 75:625–8.

He Y, Yao X, Gunther NW, Xie Y, Tu S-I, Shi X. 2010. Simultaneous detection and differentiation of

Campylobacter jejuni, C. coli, and C. lari in chickens using a multiplex real-time PCR

assay. Food Anal Methods 3:321–29.

Hermans D, van Deun K, Messens W, Martel A, van Immerseel F, Haesebrouck F, Rasschaert G,

Heyndrickx M, Pasmans F. 2011. Campylobacter control in poultry by current

intervention measures ineffective: urgent need for intensified fundamental research.

Vet Microbiol 152:219–28.

Hue-Roye K, Vege S. 2008. Principles of PCR-based assays. Immunohematology 24:170–5.

Jackson CJ, Fox AJ, Jones DM. 1996. A novel polymerase chain reaction assay for the detection

and speciation of thermophilic Campylobacter spp. J Appl Bacteriol 81:467–73.

Jacxsens L, Luning PA, Marcelis WJ, van Boekel T, Rovira J, Oses S, Kousta M, Drosinos E, Jasson

V, Uyttendaele M. 2011. Tools for the performance assessment and improvement of

food safety management systems. Trends Food Sci Technol 22:S80–89.

Jayasena DD, Jo C. 2013. Essential oils as potential antimicrobial agents in meat and meat

products: a review. Trends Food Sci Technol 34:96–108.

141

Jolley KA, Maiden MC. 2010. BIGSdb: scalable analysis of bacterial genome variation at the

population level. BMC Bioinformatics 11:595.

Jonas R, Kittl S, Overesch G, Kuhnert P. 2015. Genotypes and antibiotic resistance of bovine

Campylobacter and their contribution to human campylobacteriosis. Epidemiol Infect

143:2373–80.

Josefsen MH, Lofstrom C, Hansen TB, Christensen LS, Olsen JE, Hoorfar J. 2010. Rapid

quantification of viable Campylobacter bacteria on chicken carcasses, using real-time

PCR and propidium monoazide treatment, as a tool for quantitative risk assessment.

Appl Environ Microbiol 76:5097–104.

Juste A, Thomma BP, Lievens B. 2008. Recent advances in molecular techniques to study

microbial communities in food-associated matrices and processes. Food Microbiol

25:745–61.

Karus A, Ceciliani F, Bonastre AS, Karus V. 2017. Development of simple multiplex real-time PCR

assays for foodborne pathogens detection and identification on lightcycler. Maced Vet

Rev 40:53–58.

Kashoma IP, Kassem, II, John J, Kessy BM, Gebreyes W, Kazwala RR, Rajashekara G. 2016.

Prevalence and antimicrobial resistance of Campylobacter isolated from dressed beef

carcasses and raw milk in Tanzania. Microb Drug Resist 22:40–52.

Kittl S, Heckel G, Korczak BM, Kuhnert P. 2013. Source attribution of human Campylobacter

isolates by MLST and Fla-typing and association of genotypes with quinolone resistance.

PLoS One 8:e81796.

142

Koike R, Asai T, Ozawa M, Ishikawa H. 2008. The use of therapeutic antimicrobials for food-

producing animals. Annual Report of the National Veterinary Assay Laboratory 45:30–

33.

LaGier MJ, Joseph LA, Passaretti TV, Musser KA, Cirino NM. 2004. A real-time multiplexed PCR

assay for rapid detection and differentiation of Campylobacter jejuni and Campylobacter

coli. Mol Cell Probes 18:275–82.

Lahti E, Lofdahl M, Agren J, Hansson I, Engvall EO. 2017a. Confirmation of a campylobacteriosis

outbreak associated with chicken liver pate using PFGE and WGS. Zoonoses Public

Health 64:14–20.

Lahti E, Rehn M, Ockborn G, Hansson I, Agren J, Engvall EO, Jernberg C. 2017b. Outbreak of

campylobacteriosis following a dairy farm visit: confirmation by genotyping. Foodborne

Pathog Dis doi: 10.1089/fpd.2016.225.

Leblanc-Maridor M, Beaudeau F, Seegers H, Denis M, Belloc C. 2011. Rapid identification and

quantification of Campylobacter coli and Campylobacter jejuni by real-time PCR in pure

cultures and in complex samples. BMC Microbiol 11:113.

Lemos A, Morais L, Fontes MDC, Pires I, Vieira-Pinto M. 2015. Campylobacter spp. isolation from

infected poultry livers with and without necrotic lesions. Food Control 50:236–42.

Linton D, Lawson AJ, Owen RJ, Stanley J. 1997. PCR detection, identification to species level, and

fingerprinting of Campylobacter jejuni and Campylobacter coli direct from diarrheic

samples. J Clin Microbiol 35:2568–72.

143

Linton D, Owen RJ, Stanley J. 1996. Rapid identification by PCR of the genus Campylobacter and

of five Campylobacter species enteropathogenic for man and animals. Res Microbiol

147:707–18.

Livak KJ, Flood SJ, Marmaro J, Giusti W, Deetz K. 1995. Oligonucleotides with fluorescent dyes at

opposite ends provide a quenched probe system useful for detecting PCR product and

nucleic acid hybridization. PCR Methods Appl 4:357–62.

Logan JM, Edwards KJ, Saunders NA, Stanley J. 2001. Rapid identification of Campylobacter spp.

by melting peak analysis of biprobes in real-time PCR. J Clin Microbiol 39:2227–32.

Lund M, Nordentoft S, Pedersen K, Madsen M. 2004. Detection of Campylobacter spp. in chicken

fecal samples by real-time PCR. J Clin Microbiol 42:5125–32.

Maiden MC, Bygraves JA, Feil E, Morelli G, Russell JE, Urwin R, Zhang Q, Zhou J, Zurth K, Caugant

DA, Feavers IM, Achtman M, Spratt BG. 1998. Multilocus sequence typing: a portable

approach to the identification of clones within populations of pathogenic

microorganisms. Proc Natl Acad Sci U S A 95:3140–5.

Maiden MC. 2006. Multilocus sequence typing of bacteria. Annu Rev Microbiol 60:561–88.

Manfreda G, Parisi A, De Cesare A, Mion D, Piva S, Zanoni RG. 2016. Typing of Campylobacter

jejuni isolated from Turkey by genotypic methods, antimicrobial susceptibility, and

virulence gene patterns: a retrospective study. Foodborne Pathog Dis 13:93–100.

Marshall SM, Melito PL, Woodward DL, Johnson WM, Rodgers FG, Mulvey MR. 1999. Rapid

identification of Campylobacter, Arcobacter, and Helicobacter isolates by PCR-

restriction fragment length polymorphism analysis of the 16S rRNA gene. J Clin Microbiol

37:4158–60.

144

Martínez N, Martín MC, Herrero A, Fernández M, Alvarez MA, Ladero V. 2011. qPCR as a powerful

tool for microbial food spoilage quantification: significance for food quality. Trends Food

Sci Technol 22:367–76.

Mawer JSP, Leach DRF. 2014. Branch migration prevents DNA Loss during double-strand break

repair. PLoS Genet 10(8): e1004485.

McKillip JL, Drake M. 2004. Real-time nucleic acid-based detection methods for pathogenic

bacteria in food. J Food Prot 67:823–32.

Melero B, Cocolin L, Rantsiou K, Jaime I, Rovira J. 2011. Comparison between conventional and

qPCR methods for enumerating Campylobacter jejuni in a poultry processing plant. Food


Melero B, Juntunen P, Hanninen ML, Jaime I, Rovira J. 2012. Tracing Campylobacter jejuni strains

along the poultry meat production chain from farm to retail by pulsed-field gel

electrophoresis, and the antimicrobial resistance of isolates. Food Microbiol 32:124–8.

Miller RS, Miller WG, Behringer M, Hariharan H, Matthew V, Oyarzabal OA. 2010. DNA

identification and characterization of Campylobacter jejuni and Campylobacter coli

isolated from caecal samples of chickens in Grenada. J Appl Microbiol 108:1041–9.

Nachamkin I, Szymanski C, M, Blaser MJ. 2008. Campylobacter. Washinton, DC: ASM Press.

Available from: http://www.cabdirect.org/abstracts/20083230307.html. Accessed 2013

October 11.

Nachamkin I. 2001. Campylobacter jejuni. Food micobiology: fundamentals and frontiers.

Washington, DC: ASM Press.

145

Newell DG, Koopmans M, Verhoef L, Duizer E, Aidara-Kane A, Sprong H, Opsteegh M, Langelaar

M, Threfall J, Scheutz F, van der Giessen J, Kruse H. 2010. Food-borne diseases-the

challenges of 20 years ago still persist while new ones continue to emerge. Int J Food

Microbiol 139 Suppl 1:S3–15.

Ng LK, Kingombe CI, Yan W, Taylor DE, Hiratsuka K, Malik N, Garcia MM. 1997. Specific detection

and confirmation of Campylobacter jejuni by DNA hybridization and PCR. Appl Environ


Niederer L, Kuhnert P, Egger R, Buttner S, Hachler H, Korczak BM. 2012. Genotypes and antibiotic

resistances of Campylobacter jejuni and Campylobacter coli isolates from domestic and

travel-associated human cases. Appl Environ Microbiol 78:288–91.

Noormohamed A, Fakhr MK. 2014. Molecular typing of Campylobacter jejuni and Campylobacter

coli isolated from various retail meats by MLST and PFGE. Foods 3:82–93.

O'Sullivan N, Fallon R, Carroll C, Smith T, Maher M. 2000. Detection and differentiation of

Campylobacter jejuni and Campylobacter coli in broiler chicken samples using a

PCR/DNA probe membrane based colorimetric detection assay. Mol Cel Probes 14(1):7–

16. https://doi.org/10.1006/mcpr.1999.0274

Oh JY, Kwon YK, Wei B, Jang HK, Lim SK, Kim CH, Jung SC, Kang MS. 2017. Epidemiological

relationships of Campylobacter jejuni strains isolated from humans and chickens in

South Korea. J Microbiol 55:13–20.

Olsen GJ, Overbeek R, Larsen N, Marsh TL, McCaughey MJ, Maciukenas MA, Kuan WM, Macke

TJ, Xing Y, Woese CR. 1992. The ribosomal database project. Nucleic Acids Res. 20:2199–

200.

146

Oyarzabal OA, Williams A, Zhou P, Samadpour M. 2013. Improved protocol for isolation of

Campylobacter spp. from retail broiler meat and use of pulsed field gel electrophoresis

for the typing of isolates. J Microbiol Methods 95:76–83.

Pan H, Ge Y, Xu H, Zhang J, Kuang D, Yang X, Su X, Huang Z, Shi X, Xu X, Meng J. 2016. Molecular

characterization, antimicrobial resistance and Caco-2 Cell invasion potential of

Campylobacter jejuni/coli from young children with diarrhea. Pediatr Infect Dis J 35:330–

4.

Postollec F, Falentin H, Pavan S, Combrisson J, Sohier D. 2011. Recent advances in quantitative

PCR (qPCR) applications in food microbiology. Food Microbiol 28:848–61.

PubMLST.org. 2016. Campylobacter MLST home page. Available at: PubMLST.org. Accessed 2017

April 5.

Pusterla N, Byrne BA, Hodzic E, Mapes S, Jang SS, Magdesian KG. 2010. Use of quantitative real-

time PCR for the detection of Salmonella spp. in fecal samples from horses at a

veterinary teaching hospital. Vet J 186:252–5.

Qin SS, Wu CM, Wang Y, Jeon B, Shen ZQ, Wang Y, Zhang Q, Shen JZ. 2011. Antimicrobial

resistance in Campylobacter coli isolated from pigs in two provinces of China. Int J Food


Rahimi E, Ameri M. 2011. Antimicrobial resistance patterns of Campylobacter spp. isolated from

raw chicken, turkey, quail, partridge, and ostrich meat in Iran. Food Control 22:1165–

70.

147

Raja SS, Rao VA, Babu RN, Raja A, Abraham RJJ, Thamizhannal M. 2017. Detection of

Campylobacter jejuni in chicken meat by polymerase chain reaction. Indian Vet J 94:25–

8.

Raja SS, Rao VA. 2016. Screening of chicken meat in Chennai for emerging food pathogens by

multiplex PCR. Int J Care Coord 5:80–1.

Rantsiou K, Lamberti C, Cocolin L. 2010. Survey of Campylobacter jejuni in retail chicken meat

products by application of a quantitative PCR protocol. Int J Food Microbiol 141:S75–9.

Reischl U, Kochanowski B. 1995. Quantitative PCR. Mol Biotechnol 3:55–71.

Revez J, Zhang J, Schott T, Kivisto R, Rossi M, Hanninen ML. 2014. Genomic variation between

Campylobacter jejuni isolates associated with milk-borne-disease outbreaks. J Clin


Ripabelli G, Tamburro M, Minelli F, Leone A, Sammarco ML. 2010. Prevalence of virulence-

associated genes and cytolethal distending toxin production in Campylobacter spp.

isolated in Italy. Comp Immunol Microbiol Infect Dis 33:355–64.

Rodgers JD, Simpkin E, Lee R, Clifton-Hadley FA, Vidal AB. 2016. Sensitivity of direct culture,

enrichment and PCR for detection of Campylobacter jejuni and C. coli in broiler flocks at

slaughter. Zoonoses Public Health doi: 10.1111/zph.12306.

Sails AD, Fox AJ, Bolton FJ, Wareing DRA, Greenway DLA. 2003. A real-time PCR assay for the

detection of Campylobacter jejuni in foods after enrichment culture. Appl Environ


148

Schleihauf E, Mutschall S, Billard B, Taboada EN, Haldane D. 2017. Comparative genomic

fingerprinting of Campylobacter: application in routine public health surveillance and

epidemiological investigations. Epidemiol Infect 145:299–309.

Shams S, Ghorbanalizadgan M, Mahmmodi SH, Piccirillo A. 2017. Evaluation of a multiplex PCR

assay for the identification of Campylobacter jejuni and Campylobacter coli. Infect

Epidemiol Med 3:6–8.

Siemer BL, Nielsen EM, On SL. 2005. Identification and molecular epidemiology of Campylobacter

coli isolates from human gastroenteritis, food, and animal sources by amplified

fragment length polymorphism analysis and penner serotyping. Appl Environ Microbiol

71:1953–8.

Silva DT, Tejada TS, Blum-Menezes D, Dias PA, Timm CD. 2016. Campylobacter species isolated

from poultry and humans, and their analysis using PFGE in southern Brazil. Int J Food


Stanek L. 2013. Polymerase chain reaction: basic principles and applications in molecular

pathology. Cesk Patol 49:119–21.

Stern NJ, Hiett KL, Alfredsson GA, Kristinsson KG, Reiersen J, Hardardottir H, Briem H, Gunnarsson

E, Georgsson F, Lowman R, Berndtson E, Lammerding AM, Paoli GM, Musgrove MT.

2003. Campylobacter spp. in Icelandic poultry operations and human disease. Epidemiol

Infect 130:23–32.

Stone D, Davis M, Baker K, Besser T, Roopnarine R, Sharma R. 2013. MLST genotypes and

antibiotic resistance of Campylobacter spp. isolated from poultry in Grenada. Biomed

Res Int 2013:794643.

149

Strachan NJ, MacRae M, Thomson A, Rotariu O, Ogden ID, Forbes KJ. 2012. Source attribution,

prevalence and enumeration of Campylobacter spp. from retail liver. Int J Food


Taminiau B, Korsak N, Lemaire C, Delcenserie V, Daube G. 2014. Validation of real-time PCR for

detection of six major pathogens in seafood products. Food Control 44:130–37.

Taylor EV, Herman KM, Ailes EC, Fitzgerald C, Yoder JS, Mahon BE, Tauxe RV. 2013. Common

source outbreaks of Campylobacter infection in the USA, 1997-2008. Epidemiol Infect

141:987–96.

Toplak N, Kovac M, Piskernik S, Mozina SS, Jersek B. 2012. Detection and quantification of

Campylobacter jejuni and Campylobacter coli using real-time multiplex PCR. J Appl


Urwin R, Maiden MC. 2003. Multi-locus sequence typing: a tool for global epidemiology. Trends


USDA (United States Department of Agriculture) 2013. Food safety and inspection service:

Campylobacter questions and answers. Available from:

http://www.fsis.usda.gov/wps/portal/fsis/topics/food-safety-education/get-

answers/food-safety-fact-sheets/foodborne-illness-and-disease/campylobacter-

questions-and-answers/CT_Index/. Accessed 2016 May 24.

van Doorn LJ, Verschuuren-Van Haperen A, Van Belkum A, Endtz HP, Vliegenthart JS, Vandamme

P, Quint WG. 1998. Rapid identification of diverse Campylobacter lari strains isolated

from mussels and oysters using a reverse hybridization line probe assay. J Appl Microbiol

84:545–50.

150

Vencia W, Nogarol C, Bianchi DM, Gallina S, Zuccon F, Adriano D, Gramaglia M, Decastelli L. 2014.

Validation according to ISO 16140:2003 of a commercial real-time PCR-based method

for detecting Campylobacter jejuni, C. coli, and C. lari in foods. Int J Food Microbiol

177:78–80.

Verhoeff-Bakkenes L, Jansen HA, in 't Veld PH, Beumer RR, Zwietering MH, van Leusden FM. 2011.

Consumption of raw vegetables and fruits: a risk factor for Campylobacter infections. Int

J Food Microbiol 144:406–12.

Vidal AB, Colles FM, Rodgers JD, McCarthy ND, Davies RH, Maiden MC, Clifton-Hadley FA. 2016.

Genetic diversity of Campylobacter jejuni and Campylobacter coli isolates from

conventional broiler flocks and the impacts of sampling strategy and laboratory method.

Appl Environ Microbiol 82:2347–55.

Vinueza-Burgos C, Wautier M, Martiny D, Cisneros M, Van Damme I, De Zutter L. 2017.

Prevalence, antimicrobial resistance and genetic diversity of Campylobacter coli and

Campylobacter jejuni in Ecuadorian broilers at slaughter age. Poult Sci doi:

10.3382/ps/pew487.

von Altrock A, Hamedy A, Merle R, Waldmann KH. 2013. Campylobacter spp.-prevalence on pig

livers and antimicrobial susceptibility. Prev Vet Med 109:152–7.

Waage AS, Vardund T, Lund V, Kapperud G. 1999. Detection of small numbers of Campylobacter

jejuni and Campylobacter coli cells in environmental water, sewage, and food samples

by a seminested PCR assay. Appl Environ Microbiol 65:1636–43.

Wagenaar JA, French NP, Havelaar AH. 2013. Preventing Campylobacter at the source: why is it

so difficult? Clin Infect Dis 57:1600–6.

151

Wang G, Clark CG, Taylor TM, Pucknell C, Barton C, Price L, Woodward DL, Rodgers FG. 2002.

Colony multiplex PCR assay for identification and differentiation of Campylobacter

jejuni, C. coli, C. lari, C. upsaliensis, and C. fetus subsp. fetus. J Clin Microbiol 40:4744–7.

Wang R-F, Slavik MF, Cao W-W. 1992. A rapid PCR method for direct detection of low numbers

of Campylobacter jejuni. J Rapid Methods Autom Microbiol 1:101–08.

Wegmüller B, Lüthy J, Candrian U. 1993. Direct polymerase chain reaction detection of

Campylobacter jejuni and Campylobacter coli in raw milk and dairy products. Appl

Environ Microbiol 59:2161–65.

Wei B, Cha SY, Kang M, Roh JH, Seo HS, Yoon RH, Jang HK. 2014. Antimicrobial susceptibility

profiles and molecular typing of Campylobacter jejuni and Campylobacter coli isolates

from ducks in South Korea. Appl Environ Microbiol 80:7604–10.

Wieczorek K, Osek J. 2013. Antimicrobial resistance mechanisms among Campylobacter. Biomed

Res Int 2013 doi: 10.1155/2013/340605.

Winters DK, Slavik MF. 1995. Evaluation of a PCR based assay for specific detection of

Campylobacter jejuni in chicken washes. Mol Cell Probes 9:307–10.

Yamazaki-Matsune W, Taguchi M, Seto K, Kawahara R, Kawatsu K, Kumeda Y, Kitazato M, Nukina

M, Misawa N, Tsukamoto T. 2007. Development of a multiplex PCR assay for

identification of Campylobacter coli, Campylobacter fetus, Campylobacter

hyointestinalis subsp. hyointestinalis, Campylobacter jejuni, Campylobacter lari and

Campylobacter upsaliensis. J Med Microbiol 56:1467–73.

152

Yao H, Liu D, Wang Y, Zhang Q, Shen Z. 2017. High prevalence and predominance of the aph(2″)-

If gene conferring aminoglycoside resistance in Campylobacter. Antimicrob Agents

Chemother doi: 10.1128/AAC.00112-17.

Zang X, Tang H, Jiao X, Huang J. 2017. Can a visual loop-mediated isothermal amplification assay

stand out in different detection methods when monitoring Campylobacter jejuni from

diverse sources of samples? Food Control 75:220–27.

Zendehbad B, Khayatzadeh J, Alipour A. 2015. Prevalence, seasonality and antibiotic

susceptibility of Campylobacter spp. isolates of retail broiler meat in Iran. Food Control

53:41–45.

Zhang X, Yin T, Du X, Yang W, Huang J, Jiao X. 2017. Occurrence and genotypes of Campylobacter

species in broilers during the rearing period. Avian Pathol 46:215–23.

153

Tables

Table 1 Primers used in previous studies for the detection (PCR or multiplex PCR) and quantification (qRT-PCR or multiplex qRT-PCR) of

Campylobacter spp. in foods of animal origin and the respective sequence amplified.

TOOLS Campylobacter Matrix Reference Matrix Primer Sequence

Amplified

Reference

Primer

Simple

PCR

Campylobacter

spp.

Pigs von Altrock and

others (2013)

GTP1.1: 5’-GCCAAATGTTGGiAARTC-3’

GTP2.1: 5’-CATCAAGCCCTCCACTATC-3’

GTP 2.2: 5’-ATCiAGiCCTSSiCTRTC-3’

GTPase gene van Doorn and

others (1998)

Poultry Lemos and others

(2015)

HIP400F: 5’-GAAGAGGGTTTGGGTGGTG-3’

HIP1134R: 5’-AGCTAGCTTCGCATAATAACTTG-3’ hip gene

Linton and

others (1997)

Campylobacter

jejuni


others (2013)

CAH16S 1a: 5’-AATACATGCAAGTCGAACGA-3’

CAH16S 1b: 5’-TTAACCCAACATCTCACGAC-3’ 16S rRNA

Marshall and

others (1999)


(2015)

CCCJ609F: 5’-AATCTAATGGCTTAACCATTA3’

CCCJ1442R: 5’-GTAACTAGTTTAGTATTCCGG3’ rrs gene

Linton and

others (1997)


(2015)

F2B: 5’-TGGAGGGTAATTTAGAATATG-3’

R1B: 5’-CTAATACCTAAAGTTGAAAC-3’

cadF virulence

gene

Ripabelli and

others (2010)

Chicken and

turkey meat

Fontanot and others

(2014a)

JejuniF: 5’-TTCAGCAGCTAACGCTACT-3’

JeiuniR: 5’-AGCGATTACACTTGTAGCA-3’ porA gene

Fontanot and

others (2014a)

154

Poultry Fontanot and others

(2014b)

CampyForw: 5’-CTGATAAGGGTGAGGTCACAAGT-3’

CampyRev: 5’-CTTGCTTGTGACTCTTAACAATG-3’ 16S-23S ITS

Fontanot and

others (2014b)

Chicken meat Raja and others

(2017)

C-F: 5’-GGCGTTCATTTGGCGAATTTGAA-3’

C-R: 5’-CCGCTGTATTGCTCATAGGGA-3’ Hyp gene

Raja and others

(2017)

Geese and

chickens

Zang and others

(2017)

cjaA-F3: 5’-TCTAAGTGTTTTAACGGC-3’

cjaA-B3: 5’-AGTTCTTTTGCTATGCGT-3’ cjaA

Zang and others

(2017)

Turkey meat Ayaz and others

(2016)

Jej 1: 5’- CCT GCT ACG GTG AAA GTT TTG C-3’

Jej 2: 5’-GAT CTT TTT GTT TTG TGC TGC-3’ ceuE

Gonzalez and

others (1997)

Turkey meat Ayaz and others

(2016)

Hip 400 F: 5’-GAA GAG GGT TTG GGT GGT-3’

Hip 1134 R: 5’-AGC TAG CTT CGC ATA ATA ACT TG-3’ hipO

Linton and

others (1997)

Campylobacter

coli


others (2013)

COL1: 5’-ATGAAAAAATATTTAGTTTTTGCA-3’

COL2: 5’-ATTTTATTATTTGTAGCAGCG-3’ ceuA gene

Gonzalez and

others (1997)


(2015)

CC18F: 5’-GGTATGATTTCTACAAAGCGAG-3’

CC519R: 5’-ATAAAAGACTATCGTCGCGTG-3’ CCCH gene

Linton and

others (1997)


(2015)

VAT2: 5’-GTTAAAATCCCTGCTATCAACCA-3’

WMI-R: 5’-GTTGGCACTTGGAATTTGCAAGGC-3’ cdtB virulence gene

Ripabelli and

others (2010)

Chicken and

turkey meat

Fontanot and others

(2014a)

ColiF: 5’-TGGTTGGGATGCAACTCTT-3’

ColiR: 5’-GCCTACACGAACTGTTTCGTTG-3’ porA gene

Fontanot and

others (2014a)

155

Poultry Fontanot and others

(2014b)

CampyForw: 5’-CTGATAAGGGTGAGGTCACAAGT-3’

CampyRev: 5’-CTTGCTTGTGACTCTTAACAATG-3’

16S-23S ITS

sequence

Fontanot and

others (2014b)

Chickens Frasao and others

(2015b)

COL1: 5’-ATGAAAAAATATTTAGTTTTTGCA-3’

COL2: 5’-ATTTTATTATTTGTAGCAGCG-3’ ceuA gene

Gonzalez and

others (1997)

Campylobacter

lari

Chicken and

turkey meat

Fontanot and others

(2014a)

LariF: 5’-CAATACTTAGGAAATAGCTTAGAC-3’

LariR: 5’-GCTTGTTTAGATTTACCACCGA-3’ porA gene

Fontanot and

others (2014a)

Campylobacter

upsaliensis

Chicken and

turkey meat

Fontanot and others

(2014a)

UpsF: 5'-TGGAATGGCTTTGACGCT-3’

UpsR: 5’-GGTATAACCAGCAGTTAGG-3’ porA gene

Fontanot and

others (2014a)

Multiplex

PCR

Campylobacter

jejuni

Campylobacter

coli

Broilers Ansari-Lari and

others (2011)

MDJEGF: 5′-CTATTTTATTTTTGAGTGCTTGTG-3′

MDJEGR: 5′-GCTTTATTTGCCATTTGTTTTATT-3′,

COLF: 5′-AATTGAAAATTGCTCCAACTATG-3′

COLR: 5′-TGATTTTATTATTTGTAGCAGCG-3′

mapA

ceuE

Denis and others

(1999)

Pigs Bratz and others

(2013)

CJF: 5’-ACTTCTTTATTGCTTGCTGC3’

CJR: 5’-GCCACAACAAGTAAAGAAGC-3’

CCF: 5’-GTAAAACCAAAGCTTATCGTG-3’

CCR: 5’-TCCAGCAATGTGTGCAATG-3’

hipO

glyA

Wang and others

(2002)

Campylobacter

spp.

Broilers Zendehbad and

others (2015)

Fa: 5’-ATCTAATGGCTTAACCATTAAAC-3’

Ra: 5’-GGACGGTAACTAGTTTAGTATT-3’

F: 5’-CTATTTTATTTTTGAGTGCTTGTG-3’

16S rRNA

mapA

Zendehbad and

others (2015)

156

Campylobacter

jejuni

Campylobacter

coli

R: 5’-GCTTTATTTGCCATTTGTTTTATTA-3’

F: 5’-AATTGAAAATTGCTCCAACTATG-3’

R: 5’-TGATTTTATTATTTGTAGCAGCG-3’

ceuA

Campylobacter

spp.

Campylobacter

jejuni

Campylobacter

coli

Broilers Han and others

(2016)

F: TCTAATGGCTTAACCATTAAAC

R: GGACGGTAACTAGTTTAGTATT

F: TGATGGCTTCTTCGGATAG

R: CTAGCTTCGCATAATAACTTG

F: ATTGAAAATTGCTCCAACTATG

R: GATTTTATTATTTGTAGCAGCG

16S rRNA

hipO

ceuE

Denis and others

(1999)

Han and others

(2016)

Denis and others

(1999)

Campylobacter

jejuni

Campylobacter

coli

Bacterial

strains of

species

Girgis and others

(2014)

C-1: 5’-CAAATAAAGTTAGAGGTAGAATGT-3’

C-3: 5’-CCATAAGCACTAGCTAGCTGAT-3’

CC18F: 5’GGTATGATTTCTACAAAGCGAG-3’

CC519R: 5’-ATAAAAGACTATCGTCGCGTG-3’

CLF: 5’-TAGAGAGATAGCAAAAGAGA-3’

cj0414§

askD

Wang and others

(1992)

Linton and

others (1997)

157

Campylobacter

lari

Campylobacter

upsaliensis

CLR: 5’-TACACATAATAATCCCACCC-3’

CU61F: 5’-CGATGATGTGCAAATTGAAGC-3’

CU146R: 5’-TTCTAGCCCCTTGCTTGATG-3’

glyA

lpxA

Wang and others

(2002)

Yamazaki-

Matsune and

others (2007)

qRT-PCR

Campylobacter

spp. Broiler flocks

de Boer and others

(2015)

16S-CampyF1: 5’-CACGTGCTACAATGGCATATACAA-3’

16S-CampyR1: 5’-CCGAACTGGGACATATTTTATAGATTT -3’

16S-CampyP1 5’-FAM-AGACGCAATACCGTGAGGT-MGB-3’

16S rDNA

Lund and others

(2004)

Campylobacter

jejuni

Chickens Toplak and others

(2012)

CJ_ccoN_F: 5’-TGGTCTAAGTCTTGAAAAAGTGGCA -3’

CJ_ccoN_R: 5-‘ACTCTTATAGCTTTTCAAATGGCATATCC-3’

CJ_ccoN_probe: 5’- FAM-CTCCTGCTAAATAATTTAA-MGB-3’

ccoN

Toplak and

others (2012)


(2012)

CJ_hipO_F: 5-‘AATGCACAAATTTGCCTTATAAAAGC -3’

CJ_hipO_R: 5-‘TNCCATTAAAATTCTGACTTGCTAAATA-3’

CJ_hipO_probe: 5-‘FAM-ACATACTACTTCTTTATTGCTTG-MGB-3’

hipO

Toplak and

others (2012)

Food Sails and others

(2003)

CJTP2_F: TTGGTATGGCTATAGGAACTCTTATAGCT

CJTP2_R: CACACCTGAAGTATGAAGTGGTCTAAGT ORF-C sequence

Sails and others

(2003)

158

CJTP2 probe :TGGCATATCCTAATTTAAATTATTTACCAGGAC.

Bacterial

strains of

species

Rantsiou and others

(2010)

Cj_rpoB1: 5′-GAGTAAGCTTGGTAAGATTAAAG-3′

Cjs_rpoB2: 5′- AAGAAGTTTTAGAGTTTCTCC-3′ rpoB

Rantsiou and

others (2010)

Broiler flocks de Boer and others

(2015)

Cj-F2: 5’- ATGAAGCTGTGGATTTTGCTAGTG-3’

Cj-R3: 5’-AAATCCAAAATCCTCACTTGCCA-3’

Cj probe 5’-FAM-TTGTGAATTTAATCATCGTCC-MGB-3’

hipO de Boer and

others (2015)

Campylobacter

coli


(2012)

CC_cadF_F: 5’-GAGAAATTTTATTTTTATGGTTTAGCTGGT-3’

CC_cadF_R: 5’-ACCTGCTCCATAATGGCCAA-3’

CC_cadF_probe YakimaYellow-5’-CCTCCACTTTTATTATCAAAAGCGCCTTTAGAAA-

BHQ1-3’

cadF

Toplak and

others (2012)

Broiler flocks de Boer and others

(2015)

Ccoli-F2: 5’-CATATTGTAAAACCAAAGCTTATC-3’

Ccoli-R: 5’-AGTCCAGCAATGTGTGCAATG-3’

Ccoli probe: 5’-VIC-TAAGCTCCAACTTCATCCGCAATCTCTCTAAATTT-TAMRA-3’

glyA

LaGier and

others (2004)

Multiplex

qRT-PCR

Campylobacter

spp.

Campylobacter

jejuni

Chickens Frasao and others

(2015b)

C412F: 5'-GGATGACACTTTTCGGAGC-3'

C1288R: 5"-CATTGTAGCACGTGTGTC-3'.

C-1: 5'-CAAATAAAGTTAGAGGTAGAATGT-3 '

C-4: 3 '-TAGTCGATCGATCACGAATAGGG-5’

16S rRNA

oxidoreductase gene

Linton and

others (1996)

Winters and

Slavik (1995)

159

Campylobacter

spp.

Salmonella spp.

Shigella spp.

Bacterial

strains of

species

Barletta and others

(2013)

F: 5’-GGATGACACTTTTCGGAGC-3’

R:5’- CATTGTAGCACGTGTGTC-3’

F: 5’-CATTTCTATGTTCGTCATTCCATTACC-3’

R: 5’-AGGAAACGTTGAAAAACTGAGGATTCT-3’

F: 5’-CGCGACGGACAACAGAATACACTCCATC -3’

R: 5’-ATGTTCAAAAGCATGCCATATCTGTG-3’

16S rRNA

invA

ipaH

Logan and others

(2001)

Pusterla and

others (2010)

Barletta and

others (2013)

Campylobacter

jejuni,

Campylobacter

coli,

Campylobacter

lari

Chickens He and others (2010)

Cj For: 5’-TCCAAAATCCTCACTTGCCATT-3’

Cj Rev: 5’-TGCACCAGTGACTATGAATAACGA-3’

Cj Probe: 5’-T TGCAACCTCACTAGCAAAATCCACAGCT-3’

Cc For: 5’-TGTCAAACAAAAAACACCAAGCTT-3’

Cc Rev : 5’-CCTTTGACGGCATTATCTCCTT -3’

Cc Probe : 5’-AAAATTTCCCGCCATACCACTTGTCCC-3’

Cl For: 5’-TTAGATTGTTGTGAAATAGGCGAGTT-3’

Cl Rev: 5’-TGAGCTGATTTGCCTATAAATTCG-3’

Cl Probe: 5’-TGAAAATTGGAACGCAGGTG-3’

hipO

cdtA

pepT

He and others

(2010)

Campylobacter

jejuni Seafood

Taminiau and others

(2014)

50S-F: 5’-GCGGGTTCAACAAGAACTAACG-3’

50S-R: 5’-GTAGTTTCTTTCATTTGTTGGACCAA-3’

50S gene

Taminiau and

others (2014)

160

Campylobacter

coli

50S-probe: 5’-[VIC]-TGGGTAGGCGGTGCGGTTGC-[NFQ-MGB]-3’

VS1-F: 5’-GTAGTTTCTTTCATTTGTTGGACCAA-3’

VS1-R: 5’-GCGGGTTCAACAAGAACTAACG-3’

VS1-probe: 5’-[FAM]-AAGAATTAGAATATCGTGGCTATG-[NFQ-MGB]-3’

VS1

Shigella boydii

Campylobacter

jejuni

Mycobacterium

bovis

Enterobacter

sakazaki

Clostridium

perfringens

Bacterial

strains of

species

Karus and others

(2017)

ipaH2_F: 5’-GATACCGTCTCTGCACGCAAT -3’

ipaH2_R: 5’-GCCATGCAGCGACCTGTT-3’

CadF_F: 5’-GTGGCAAAAAGGAAAAAGCTGTA -3’

CadF_R: 5’-CATTTTGCTTGTGGAGTTGCA-3’

Hsp_F: 5’-GGGTCAAGCTCGACGTTGA-3’

Hsp_R: 5’-CGGTGGTCCGTTTGGAACT-3’

AY748357_F: 5’-GCGCGGTGTGTCAGAGTCT -3’

AY748357_R: 5’-AACCTCACAACCCGAAGAAGTC-3’

α toxin _F: 5’-GCATGAGTCATAGTTGGGATGATT-3’

α toxin_R: 5’-TGCTGTTCCTTTTTGAGAGTTAGCT-3’

ipaH2

cadF

hsp

AY748357

α toxin gene

Karus and others

(2017)

161

3.5 ARTIGO V

O artigo intitulado “Antimicrobial activity of Caryocar brasiliense waste extract

against spoilage and pathogenic bacteria” será submetido para a revista Food

Microbiology.

Food Microbiology

Antimicrobial activity of Caryocar brasiliense waste extract against spoilage and

pathogenic bacteria

Beatriz da Silva Frasao a,*, Lucas Correia b, Regina Júlia Nascimento a, Vinicius Castro c,

Renata Valeriano Tonon d, Odir Dellagostin e, Maria Helena Cosendey de Aquino a,

Walter Lilenbaum b, Carlos Adam Conte Junior a,c,f

a Department of Food Technology, Faculty of Veterinary, Universidade Federal


b Laboratory of Veterinary Bacteriology, Biomedical Institute, Universidade Federal



21941-909, Rio de Janeiro, Brazil.

d Embrapa Food Technology, Brazilian Agricultural Research Corporation, Rio de

Janeiro, Brazil.

e Laboratory of Vaccinology (CDTec), Universidade Federal de Pelotas, Rio Grande do

Sul, Brazil.

f National Institute for Health Quality Control, Fundação Oswaldo Cruz, Avenida Brasil

4.365, 21.040-900, Rio de Janeiro, RJ, Brazil.


Beatriz da Silva Frasao, D.V.M., M.Sc.

Universidade Federal Fluminense, Brazil.


Tel: +55 21 26299545


162

ABSTRACT

The pequi peel extract may exhibit antimicrobial property. This research investigates the

effectiveness of Caryocar brasiliense waste extract against spoilage and pathogenic

bacteria. Campylobacter jeuni, Campylobacter coli, and Escherichia coli isolated from

meat matrix, and C. jejuni INCQS 00262 (ATCC 33560), C. coli INCQS 00263 (ATCC

33556), Salmonella enterica INCQS 00150 (ATCC 1408), E. coli O157:H7 INCQS

00171 (ATCC 43895), Staphylococcus aureus INCQS: 00577 (ATCC 43300),

Pseudomonas aeruginosa INCQS: 00099 (ATCC 27853) were tested. The antimicrobial

activity of the pequi waste extract against these bacteria were determined by minimum

inhibitory concentration (MIC), and minimum bactericidal concentration (MBC).

Moreover, the potential of pequi peel extract in inhibiting biofilm was verified. For E.

coli strains and Salmonella the MIC of extract was 6.25 µg.mL-1, for Pseudomonas 3.13

µg.mL-1, for S. aureus 1.56 µg.mL-1, and for Campylobacter strains 0.39 µg.mL-1.

Considering MBC, for Campylobacter strains values was same of the MIC. For E. coli II,

III and Pseudomonas was 75.00 µg.mL-1, and E. coli I and Salmonella 25.00 µg.mL-1.

Although S. aureus showed low MIC, high MBC was observed, characterizing this strain

as tolerant. Therefore, the pequi extract presented bacteriostatic and bactericidal activity,

being the Campylobacter strains the greater sensitive.

Keywords: biofilm formation, Salmonella enterica, Campylobacter spp., E. coli,

Pseudomonas aeruginosa, Staphylococcus aureus

163

1 Introduction

Synthetic antimicrobial agents are widely used for both therapeutic treatment and

as control the growth of spoilage and pathogenic microorganisms in the food industry.

However, these compounds have been shown to be inefficient, due to the presence of

bacterial resistance, which can difficult to treat some diseases, as well as the hygiene and

preservation of food products. Therefore, the replace of synthetic antimicrobials has been

of interest to a number of industries as food industry. In this sense, natural antimicrobials

derivate from plants present a different chemical structure from the synthetic ones and

can be able to regulate the intermediary metabolism of pathogens, by alteration on

membrane structure, and activation or inhibition of enzymatic reactions (Michelin et al.,

2005). The application of natural antimicrobial substances extracted from plants can be

considered an alternative for multi-drug resistant bacteria.

Caryocar brasiliense is a native fruit from Brazilian Cerrado region, commonly

used for the gastronomic and nutritional purpose, for cosmetic applications and in

traditional medicine to treat cold, edema, bronchitis, bruns and coughs (Faria-Machado

et al., 2015). Pequi is a spherical green fruit, composed by an epicarp (very thin peel), an

external pulp mesocarp, an internal mesocarp (light-yellow, pulpy, rich in oil), that

involves a layer of thin and rigid endocarp (approximately 2−5 mm large) with spines and

a white kernel (also called seed or nut) (Ascari et al., 2010; Damiani et al., 2009). This

fruit presents some biological properties, such as protection against genomic and

oxidative damage, antimicrobial activity, and anti-inflammatory activities (Faria et al.,

2014). Vitamin A and oleic, palmitic, myristic, palmitoleic, stearic, arachidic, oelic,

linoleic and linolenic acids was founded on pequi fruit, mainly in oil (Pessoa et al., 2015).

Paula-Junior et al. (2006) verified pequi leaf antimicrobial activity against strains of

pathogenic bacteria (Enterococcus faecalis, Escherichia coli, Pseudomonas aeruginosa

and Staphylococcus aureus) and leishmanicide activity against promastigotes of

Leishmania amazonenses. In addition, Amaral et al. (2014) demonstrated that pequi peel

can be considered a cost-effective natural antimicrobial source, which is considered a

residue from fruit processing.

Therefore, given the substantial potential of pequi (Caryocar brasiliense), this

study was designed to evaluate the antimicrobial activities of C. brasiliense peel extract

against spoilage and pathogenic bacteria.

164

2 Material and methods

2.1. Pequi peel sample

Pequi (Caryocar brasiliense) fruit was collected from Montes Claros-MG (16º 44'

06" S, 43º 51' 42" W), in January and February 2016. The fruit was processed and the

peel was blanching and immediately frozen at -20ºC for inactivating enzymes to maintain

the general properties. Drying was carried out on oven with forced air circulation (330

drier, FANEM®, Brazil) at 60 ºC until constant weight (9h). After were ground in a mill

(A11 Bsic, IKA® Werke, Staufen, Germany) and sieved through a 250 Mesh screen as

particle size affects the extractability of bioactive molecules (Shao et al., 2014). All

samples were stored at -20 °C until further use.

2.2. Obtaining of pequi peel ethanolic extract

In order to obtain the extract, analytical microwave DGT 100 Plus system

(Provecto Analytics Ltd., Jundiaí, SP, Brazil) was applied (Frasao et al., 2017). Aliquots

of 25 mL of aqueous ethanol solution 94% (v/v) were added to extraction vessel

containing 500 mg of pequi waste powder, and sealed. Extraction was performed using

the following parameters, 670W microwave power for 110 seconds. The vessels were

cooled to 25ºC before being opened. After, the vessel content was transferred to another

container and centrifugated at 1,400 × g for 10 min at 4 ºC. The supernatant was reserved

and the precipitate was re-extracted with an additional 25 mL of the same ethanol solution

and at the same MAE conditions, the supernatants were pooled and stored in amber vials

at -20 ºC.

2.3. Pathogenic and spoilage bacteria strains

Origen and identification of strains used were placed on table 1. Five strains tested

are standard, and 5 are high resistant bacteria isolated from meat and broiler. The

rehydration and reactivation of standard strains were carried out according to the protocol

provided by the laboratory of INCQS/FIOCRUZ, available in POP 65.3230.006, annex

165

G. Regarding reactivation of bacteria isolated from meat matrixes was performed by

adding 0.1 mL of the culture in 2 mL of broth culture medium. The suspension was

incubated at the specific temperatures of each microorganism for 24 hours, before being

transferred to plates. The suspension was scored on plates containing the specific media

for each microorganism and mueiller hinton (MH) agar (TM media, TM339) with 7% of

defibrillated sheep's blood (EBE-FARMA ltda.) and incubated at 37ºC for 48 hours.

For Campylobacter jejuni and Campylobacter coli strains were used a Brucella

broth (Himedia, M348) and MH blood as specific. After incubation at 37°C for 48 hours

under microaerophilic conditions (Frasão et al., 2015), staining was performed by the

Gram method to confirm the morphotintorial characteristics of the bacteria. For S.

enterica, E. coli, S. aureus and P. aeruginosa strains were used a brain heart infusion

(BHI) broth (KASVI, K25-61008) and MH blood agar. As a specific culture medium, the

mannitol salt (Chapman) agar (TM media, TM206) for Staphylococcus, Pseudomonas

isolation agar (PIA) (Plast Labor, PL1172) for Pseudomonas, Salmonella-Shiguella (SS)

agar (Prodimol Biotecnologia s/a, 114-1) for Salmonella and eosin methylene blue agar

(Teague) (Aleretm, 106-1) for E. coli was used to verify the purity of inoculum and

confirm the characteristic colony.

2.4. Antimicrobial activity of extract

2.4.1. Minimum inhibitory concentration (MIC) and growth behavior

A broth micro-dilution method (in octuplicate) and agar dilution method (in

triplicate) was performed to determine MIC of pequi waste extract according to CLSI

(2012) and CLSI (2010), respectively. The extract concentrations were 75, 50, 25, 12.50,

6.25, 3.13, 1.56, 0.78, 0.39 µg.mL-1 for broth micro-dilution method, and 5.0, 2.50, 1.25,

0.75, 0.50, 0.25, and 0.10 µg.mL-1 for agar dilution method. Bacterial suspension was

made with McFarland 0.5 scale (10x108 UFC.mL-1) for agar method, and diluted 20 times

(1:20) obtaining 5x106 UFC.mL-1 for broth method. After incubation at 37°C for 48 hours,

the lowest concentration of the extract required to inhibit visible growth of the tested

microorganism was designated as the MIC. The broth micro-dilution method was carried

out on 96-well PVC sterilized microplate with flat bottom (CRAL, Brazil, 655111),

sealed with 2 mil sealing film (Bio, 5100). Aliquots of 10 µL of each bacteria suspension

166

was inoculated into 90 µL of BHI broth with extract, totalizing 100 µL per well. The read

was performed on absorbance reader ELx800 (BioTek Instruments, USA) at OD 630 nm

with Gen5TM Microplate Reader and Imager Software 3.03 (BioTek Instruments, USA).

In addition, broth micro-dilution method was performed to access the growth behavior of

bacteria against pequi peel extract at 4, 8, 12, 20, 24, 28, 32, 36 and 48 hours of incubation

at 37ºC, in microaerophilic conditions for Campylobacter spp., and aerobic conditions for

others. A growth curve was obtained for each microorganism. The BHI broth was used

as negative control, and inoculum plus BHI broth as a positive control. For agar dilution

method, 2µL of bacteria suspension was placed into MH agar with 5% of blood and 10%

of each extract concentrations. For control, plate without extract was made.

2.4.2. Minimum bactericidal concentration (MBC)

MBC was determined according to (Klangpetch et al., 2016) with modifications,

in triplicate. Aliquots of 1 µL of the solution with bacterial suspension and the extract

from broth micro-dilution method were obtained from each well that showed no growth

and taken onto MH blood plates and incubated at 37ºC for 48 hours, for Campylobacter

under microaerophilic conditions, and aerobic conditions for other. The same aliquot of

positive and negatives control broth micro-dilution method was used. The concentration

of extract that presented no growth was determined as MBC.

2.4.3. Biofilm formation

Bacterial suspension was made with McFarland 0.5 scale (10x108 UFC.mL-1) and

diluted 20 times (1:20) obtaining 5x106 UFC.mL-1. Aliquots of 10 µL of each bacteria

suspension was inoculated into 90 µL of BHI broth with 1% of glucose (as the sole carbon

source) and extract at different concentrations (75, 50, 25, 12.50, 6.25, 3.13, 1.56, 0.78,

0.39 µg.mL-1) in 96-well PVC sterilized microplate with flat bottom (CRAL, Brazil,

655111), totalizing 100 µL per well. The BHI broth was used as negative control, and

inoculum plus BHI broth as a positive control. The plates were incubated at 37ºC for 48

hours, under microaerophilic conditions for Campylobacter and aerobic conditions for

other. After incubation, the well contents were removed and the plate was washed 3 times

with distilled water and air dried for 45 minutes. A solution of crystal violet 0.1% was

167

used to stained, and the plate was washed 3 times with distillate water. After, 100 µL of

95% ethanol solution was added and incubated by 30 minutes. The absorbance was

measured at OD 492 nm using absorbance reader ELx800 (BioTek Instruments, USA)

with Gen5TM Microplate Reader and Imager Software 3.03 (BioTek Instruments, USA).

The analyze was carried out on octuplicate.

2.5 Statistical analyses

Results were represented as means ± standard deviation. Analyses of variance

(ANOVA) and Turkey test were performed to determine the difference. The values were

considered significant different at p < 0.05. Software XLSTAT version 2013.2.03

(Addinsoft, Paris, France) was used.

3 Results and Discussion

3.1 Bacteria purity culture confirmation

The morphotintorial characteristics of Campylobacter spp. was confirmed by

Gram method, as small Gram-negative bacilli in the form of seagull wings without

contaminants. In addition, the characteristics colony of E. coli, S. enterica, P. aeruginosas

and S. aureus was verified and confirmed the purity of inoculum on specific agar.

3.2 Minimum inhibitory concentration (MIC)

The MIC results are presented in table 2. The results were validated comparing

the extract concentrations growth with a positive control (wothout extract) an two

negative controls (only extract and only media). No reduction of microbial growth was

observed on positive one, demostrating the viability of the strains. Moreover, no growth

was verified in the negatives one, demonstrated the extract and media were without

contamination.

The pequi waste extract showed a bacteriostatic activity against all tested bacteria.

The lowest MIC was observed against all Campylobacter tested (0.39 µg/mL), while the

highest (6.25 µg/mL) was against the three E. coli strains tested and Salmonella.

168

Amaral et al. (2014) demontrade that pequi leaves showed inhibition for E. coli

(11.25 µg.mL-1), S. aureus (11.25 µg.mL-1), and P. aeruginosa (22.50 µg.mL-1).

Evaluating the same source, Paula-Junior et al. (2006) verified that the broth MIC value

for inhibits the E. coli and S. aureus growth was 4 µg.mL-1. Considering that we obtained

MICs smaller than those presented in previous works, by broth microdilution method, for

pequi leaves, the peel of pequi fruit presented as greater potential source of antibacterial

compounds.

Evaluating the agar dilution method, the pequi waste extract showed a

bacteriostatic activity against Campylobacter strains, only. The MIC value for C. jejuni

II and C. coli I was 2.5µg.mL-1, and for C. jejuni I and C. coli II was 5.0 µg.mL-1. These

results are against the MIC found in broth, which demonstrated that Campyloabcter is the

most sensitive microorganisms. In addition, C. coli II and C. jejuni I were the most

sensitive.

The pequi waste extract antimicrobial activity can be related to some secondary

metabolites present on the peel of this fruit (Pinho et al., 2012). Some authors attribute

antimicrobial activity to the molecules of anthocyanins, flavonoids (flavones and

flavononols) and tannins (Akiyama et al., 2001; Cushine & Lamb, 2005). Pequi is a fruit

with a high content of compounds such as gallic acid, lupeol, quinic acid, quercetin,

quercetin 3-O-arabinose, hexanoic acid, carotenoids, among others (Bailão et al., 2015;

Ribeiro et al., 2014). The above compounds are classified within the mentioned groups,

being considered also antioxidant compounds (Frasão et al., 2017; Monteiro et al., 2015).

Thus, the presence of antioxidant compounds may not only be related to the antioxidant

activity of these extracts, but also to the antimicrobial activity observed.

However, future studies to identify the molecules present in the peptone shell

extract and responsible for the antimocyrobial action must be performed, as well as

mechanism of action of these molecules should be evaluated. Since the pequi peel extract

has efficient antimicrobial activity, being a potencila source of natural antimicrobials.

3.3 Bacterial behavior curve

The bacterial OD was obtained subtracting the absorption reading at analyzing

time (T4-48) from the initial reading (T0). Nine points (T4, T8, T12, T20, T24, T28, T32,

T36 and T48 ) were obtained and the growth curve of each microorganism against the

169

different concentrations of pequi peel extract was built, with the lowest concentration

being shown on the chart as the MIC (Fig. 1 and 2).

Although growth at all extracts concentrations (except after MIC) was observed.

For E coli I and E. coli III (Fig. 1A and 1C) from T8 to T48 all extract applications

presented a reduction on bacterial concentration when compared to positive control.

However, 3.13 and 6.25 µg.mL-1 was more efficient than other. For E. coli II (Fig. 1B)

from T4 to T48 all extract applications presented a reduction on bacterial growth, beeing

3.13 and 6.25 µg.mL-1 more efficient. The positive control of this microorganism show a

growth until T20 and after stabilized, on the other hand when available the positive

control (C+) was observed a stabilization of bacteria growth from T20, while 6.25 µg.mL-

1 extract showed a growth (p>0.05) when compared T4 to T24 but when compare T24 to

T48 a reduction (p<0.05) on bacterial concentration was observed and the value present

no difference (p>0.05) within T4. In view of this behavior, besides the inhibition of the

development of E. coli II, the extract can kill them after 48 hours of exposure. This point

can be classified as minimum duration for killing (MDK), which consists of a measure of

tolerance that can be extracted from the time-kill curves, given that the longer the

exposure time of the extract required to kill, more tolerant microorganisms is against the

tested material (Brauner et al., 2016). With this, after 48 hours of exposure of E. coli II to

pequi extract at 6.25 µg.mL-1 this microorganism is no longer tolerant to this solution.

Considering S. aureus growth curve (Fig. 2A) from T4 to T48, despite being

observed growth during the incubation, all extract applied presented a reduction on

bacterial concentration when compared to positive control. Also, the peak growth of the

positive control is observed first in T20, whereas for the extracts the peak is only verified

in the T48. Thus, the extract reduced the growth rate of S. aureus tested. Same behavior

observed for S. aureus was identified for P. aeruginosa (Fig. 2B), however the first peak

of control treatment for this microorganism is observed in T12. So, extract reduced the

growth rate of tested Pseudomonas too. For Salmonella (Fig. 2C) from T8 to T48 all

extract applications showed a reduction on bacterial concentration when compared to

positive control. The positive control presented a peak growth in T20 first, whereas the

extracts present a small peak at T32. Thus, the extract concentrations reduced the growth

rate of tested S. entenrica. In the concentrations of 3.13 and 6.25 µg.mL-1 after this peak

was observed a reduction on bacterial concentration read, and at T48 it is significant when

compared to T32, considering this point as minimum duration for killing (MDK)(Brauner

170

et al., 2016). With this, after 48 hours of exposure of S. enterica to pequi extract at 3.13

or 6.25 µg.mL-1 this bacteria is no longer tolerant to this solution. With respect of C. jejuni

I, C. jejuni II, C. coli I, and C. coli II (Fig. 3) from T4 to T48, despite being observed

same growth behavior when compared to control during the incubation, the MIC extract

application presented a reduction on bacterial concentration against to positive control.

Therefore, the pequi waste extract application reduced the bacterial concentration

and estabilized the microrganisms growth before the time observed in the positive control

(without extract). No articles was found avaliable the growth curve of pathogenic and

spoilage bacteria against pequi extract, so this is an inovative research.

3.4 Minimum bactericidal concentration (MBC)

MBC was used to determine the bactericidal activity of pequi peel extract. The

extract showed no bactericidal activity against S. aureus, however the bactericidal action

was observed against other microorganisms tested (Table 2). The resistance by S. aureus

can be attributed to the Gram-positive classification, once this bacterium has a thick layer

of peptideoglycan covering the bacterial membrane. Pequi peel extract probably can not

penetrate the cell membrane of these bacteria without having a bactericidal action,

although it can reduce their rate of growth. Although, future studies verifying this

mechanism of action must be carried out.

For Campylobacter MBC value corresponded to those of the MIC value (0.39

µg.mL-1), demonstrating that the same concentration of the extract has both bacteriostatic

and bactericidal activity on this microorganism. For other bacteria tested the MBC values

was higher than MIC values, thus it is necessary a higher concentration of pequi waste

extract to have a bactericidal activity against E. coli, S. entenrica and P. aeruginosa when

compared to bacteriostatic activity.

Other authors tested the bactericidal activity of natural antimicrobials from peel

extract of Kaffir lime (Citrus hystrix DC.), Lime (Citrus aurantifolia Swingle) and

Pomelo (Citrus maxima Merr.) against S. aureus, E. coli and Salmonella (Klangpetch et

al., 2016). Although, no article was found about pequi extract bactericidal activity.

Characterizing this research as innovative, due verified a bactericidal activity of pequi

peel extract against Campylobacter, E. coli, S. entenrica, and P. aeruginosa.

171

3.5 Inhibition of biofilm formation

Biofilm formation assay was performed to verify the power of the pequi residue

extract in reducing biofilm formation against E. coli, E. coli O157:H7, S. aureus, S.

enterica, P.aeruginosa, C. jejuni and C. coli. These bacteria are biofilm-forming (Belfield

et al., 2017; García-Heredia et al., 2016; Kim et al., 2017; Lamas et al., 2016;

Sadekuzzaman et al., 2017). Results of concentrations of 25, 50 and 75 µg.mL-1 extract

were discarded, since pequi has a high carotenoid content, which present orange color,

due to the interference of this staining in the reading. The results were showed on fig. 4.

Campylobacter jejuni (I and II) strains did not present (p>0.05) biofilm formation

in this research. On the other hand, C. coli strains (I and II) forming biofilm and the pequi

waste extract inhibit (p<0.05) it formation from the lowest concentration (0.39 µg.mL-1)

tested. Same behavior was observed for E. coli II and P aeruginosa. Although there is no

statistical difference (p>0.05) between the concentrations of the extracts, although

numerically is possibly observe that the higher concentrations (6.25 and 12.5 µg.mL-1)

present greater reduction on biofilm formation. When verified the biofilm formation by

S. eterica 0.39 µg.mL-1 pequi extract present a reduction (p<0.05) on biofilm

development, however the greater reduction (p<0.05) was observed when 3.13, 6.25 and

12.5 µg.mL-1 was applied. S. aureus formed biofilm, applied of 0.39 µg.mL-1 extract

inhibit (p<0.05) the biofilm formation, but the higher concentration showed greater

reduction. With respect to E. coli I and E. coli III (O157:H7), biofilm development was

observed, nevertheless different of the other strains, these present a reduction in the

formation of biofilm only from 6.25 µg.mL-1.

Other authors verified the inhibition of biofilm formation E. coli (García-Heredia,

2016), E. coli O157:H7 (García-Heredia, 2016), S. aureus (Cui et al., 2016), biofilm

formation with application of others natural substances, as cinnamon oil, extracts of

Lippia graveolens and Haematoxylon brassiletto. Although, no research was found about

pequi extraction against biofilm formation. Therefore, pequi peel extract is a potential

biofilm formation inhibitor for E. coli, E. coli O157:H7, S. aureus, S. enterica, P.

aeruginosa, and C. coli.

4 Conclusions

172

In conclusion, C. brasiliense peel extract presented antimicrobial activities against

spoilage and pathogenic bacteria tested. Considering MIC and MDK values C. jejuni and

C. coli strains showed as the more sensitive and less tolerant bacteria available. S. aureus

presented tolerance. E. coli O157:H7 and other E. coli strains are less sensitive. With

respect a biofilm formation, the extract was more efficient against P. aeruginosa and less

against E. coli I, however also presented biofilm inhibition activity.

Therefore, pequi waste extract was highly effective to inhibit the growth and

biofilm formation of spoilage and patogenic bacteria, and pequi peel can be used as a

source of natural antimicrobial. We suggest studies to elucidate the mechanism of action

of the antimicrobial effect, as well as which compounds have this action. In addition the

applicability of pequi extract as a technological alternative to improve the self-life of

food, principle food of animal origen, although future experiments must be done.

Acknowledgements: Coleção de Microrganismos de Referência em Vigilância Sanitária-

CMRVS, FIOCRUZ-INCQS, Rio de Janeiro, RJ, for supplying the standard

(ATCC/INCQS) strains

Funding: This work was supported by the The support by Coordination of Enhancement

of People of a Superior Level [process nº. 125, CAPES/Embrapa 15/2014, CAPES,

Brazil], Research Foundation of the State of Rio de Janeiro [process nº. E-

26/201.185/2014, FAPERJ, Brazil], the National Council of Technological and Scientific

Development [processes nº. 311361/2013-7, 311422/2016-0 and 150200/2017-0, CNPq,

Brazil].

Conflicts of interest: none

References

Amaral, L.F., Moriel, P., Foglio, M.A., Mazzola, P.G., 2014. C aryocar brasiliense

supercritical CO 2 extract possesses antimicrobial and antioxidant properties useful for

personal care products. BMC Complement. Altern. Med. 14, 1.

Ascari, J., Takahashi, J.A., Boaventura, M.A.D., others, 2010. Phytochemical and

biological investigations of Caryocar brasiliense Camb. Boletin Latinoam. Caribe

Plantas Med. Aromat. 9, 20–28.

173

Belfield, K., Bayston, R., Hajduk, N., Levell, G., Birchall, J.P., Daniel, M., 2017.

Evaluation of combinations of putative anti-biofilm agents and antibiotics to eradicate

biofilms of Staphylococcus aureus and Pseudomonas aeruginosa. J. Antimicrob.

Chemother. doi:10.1093/jac/dkx192

Brauner, A., Fridman, O., Gefen, O., Balaban, N.Q., 2016. Distinguishing between

resistance, tolerance and persistence to antibiotic treatment. Nat. Rev. Microbiol. 14,

320–330.

CLSI. Clinical and Laboratory Standards Institute. Methods for Antimicrobial Dilution

and Disk Susceptibility Testing of Infrequently Isolated or Fastidious Bacteria:

Approved guideline. 2nd ed. CLSI document M45-A2. Clinical and Laboratory

Standards Institute, Wayne, PA, 2010.

CLSI. Clinical and Laboratory Standards Institute. Methods for Dilution Antimicrobial

Susceptibility Tests for Bacteria That Grow Aerobically; ninth Edition - Approved

Standard M07-A09. CLSI, Wayne, PA, USA, 2012

Damiani, C., Boas, V., de Barros, E.V., Ferri, P.H., Pinto, D.M., Rodrigues, L.J., 2009.

Volatile compounds profile of fresh-cut peki fruit stored under different temperatures.

Food Sci. Technol. Camp. 29, 435–439.

Faria, W.C.S., Damasceno, G.A. de B., Ferrari, M., 2014. Moisturizing effect of a

cosmetic formulation containing pequi oil (Caryocar brasiliense) from the Brazilian

cerrado biome. Braz. J. Pharm. Sci. 50, 131–136. doi:10.1590/S1984-

82502011000100013

Faria-Machado, A.F., Tres, A., van Ruth, S.M., Antoniassi, R., Junqueira, N.T.V.,

Lopes, P.S.N., Bizzo, H.R., 2015. Discrimination of Pulp Oil and Kernel Oil from Pequi

( Caryocar brasiliense ) by Fatty Acid Methyl Esters Fingerprinting, Using GC-FID and

Multivariate Analysis. J. Agric. Food Chem. 63, 10064–10069.

doi:10.1021/acs.jafc.5b03699

Frasao, B.D.S., Costa, M.P. da, Rodrigues, B.L., Lima, B.R.C., Conte-Junior, C.A.,

2017. Natural Antioxidant Activity and Compounds Content from Wastes of Euterpe

edulis Berries. J. Agric. Sci. 9, 178. doi:10.5539/jas.v9n3p178

Frasão, B.S., Côrtes, L.R., Nascimento, E.R., Cunha, N.C., Almeida, V.L., Aquino,

M.H.C., 2015. Detecção de resistência às fluoroquinolonas em Campylobacter isolados

de frangos de criação orgânica. Pesqui. Veterinária Bras. 35, 613–619.

doi:10.1590/S0100-736X2015000700003

García-Heredia, A., García, S., Merino-Mascorro, J.Á., Feng, P., Heredia, N., 2016.

Natural plant products inhibits growth and alters the swarming motility, biofilm

formation, and expression of virulence genes in enteroaggregative and

enterohemorrhagic Escherichia coli. Food Microbiol. 59, 124–132.

doi:10.1016/j.fm.2016.06.001

Kim, S.-H., Park, C., Lee, E.-J., Bang, W.-S., Kim, Y.-J., Kim, J.-S., 2017. Biofilm

formation of Campylobacter strains isolated from raw chickens and its reduction with

DNase I treatment. Food Control 71, 94–100. doi:10.1016/j.foodcont.2016.06.038

174

Klangpetch, W., Phromsurin, K., Hannarong, K., Wichaphon, J., Rungchang, S., 2016.

Antibacterial and antioxidant effects of tropical citrus peel extracts to improve the shelf

life of raw chicken drumettes. Int. Food Res. J. 23.

Lamas, A., Miranda, J.M., Vázquez, B., Cepeda, A., Franco, C.M., 2016. Biofilm

formation, phenotypic production of cellulose and gene expression in Salmonella

enterica decrease under anaerobic conditions. Int. J. Food Microbiol. 238, 63–67.

doi:10.1016/j.ijfoodmicro.2016.08.043

Michelin, D.C., Moreschi, P.E., Lima, A.C., Nascimento, G.G.F., Paganelli, M.O.,

Chaud, M.V., 2005. Evaluation of the antimicrobial activity of vegetal extracts. Rev.

Bras. Farmacogn. 15, 316–320.

Paula-Ju, W. de, Rocha, F.H., Donatti, L., Fadel-Picheth, C.M., Weffort-Santos, A.M.,

2006. Leishmanicidal, antibacterial, and antioxidant activities of Caryocar brasiliense

Cambess leaves hydroethanolic extract. Rev. Bras. Farmacogn. 16, 625–630.

Pessoa, A.S., Podest?, R., Block, J.M., Franceschi, E., Dariva, C., Lanza, M., 2015.

Extraction of pequi (Caryocar coriaceum) pulp oil using subcritical propane:

Determination of process yield and fatty acid profile. J. Supercrit. Fluids 101, 95–103.

doi:10.1016/j.supflu.2015.03.006

Sadekuzzaman, M., Yang, S., Kim, H.-S., Mizan, M.F.R., Ha, S.-D., 2017. Evaluation

of a novel antimicrobial (lauric arginate ester) substance against biofilm of Escherichia

coli O157:H7, Listeria monocytogenes , and Salmonella spp. Int. J. Food Sci. Technol.

doi:10.1111/ijfs.13484

Shao, Y., Wu, Q., Duan, J., Yue, W., Gu, W., Wang, X., 2014. Optimisation of the

solvent extraction of bioactive compounds from Lophatherum gracile Brongn. using

response surface methodology and HPLC-PAD coupled with pre-column antioxidant

assay. Anal Methods 6, 170–177. doi:10.1039/C3AY41279B

Tiwari, B.K., Valdramidis, V.P., O? Donnell, C.P., Muthukumarappan, K., Bourke, P.,

Cullen, P.J., 2009. Application of Natural Antimicrobials for Food Preservation. J.

Agric. Food Chem. 57, 5987–6000. doi:10.1021/jf900668n

175

Table 1 Identification, source and supplier of the bacterial strains studied

Bacteria Manuscript

Identification

Origen

Identification Source Supplier

Campylobacter jejuni C. jejuni I INCQS 00262

(ATCC 33560) bovine feces INCQS/FIOCRUZ

Campylobacter jejuni C. jejuni II T23 broiler LDI

Campylobacter coli C. coli I C10 broiler LDI

Campylobacter coli C. coli II C. coli 36 poultry CDTec

Salmonella enterica Salmonella INCQS 00150

(ATCC 14028) chicken INCQS/FIOCRUZ

Escherichia. coli E. coli I 1145 meat LABMMA

Escherichia. coli E. coli II 2571 meat LABMMA

Escherichia. coli O157:H7 E. coli III INCQS 00171

(ATCC 43895)

hamburger

meat INCQS/FIOCRUZ

Staphylococcus aureus S. aureus INCQS: 00577

(ATCC 43300) clinical isolate INCQS/FIOCRUZ

Pseudomonas aeruginosa Pseudomonas INCQS: 00099

(ATCC 27853) blood culture INCQS/FIOCRUZ

INCQS: National Institute of Health Quality Control; LDI: Laboratory of Infectious Diseases; LABMMA: Laboratory of Molecular Microbiology of Foods; CDTec: Laboratory

of Vaccinology

176

Table 2 Values of minimum inhibitory concentration (MIC) and minimum bactericidal

concentration (MBC) of pequi waste extract

Pequi peel extract concentration

Bacterial strain broth MIC agar MIC MBC

E. coli I 6.25 >5.0 25.00

E. coli II 6.25 >5.0 75.00

E. coli III 6.25 >5.0 75.00

S. enterica 6.25 >5.0 25.00

S. aureus 1.56 >5.0 >75.00

P. aeruginosa 3.13 >5.0 75.00

C. jejuni I 0.39 2.5 0.39

C. jejuni II 0.39 5.0 0.39

C. coli I 0.39 2.5 0.39

C. coli II 0.39 5.0 0.39

Results are expressed in µg.mL-1.

177

FIGURES

Fig.1. E. coli I (A), E. coli II (B), and E. coli III (C) growth curve. All results are the means with standard deviation (n = 8). Extraction concentration (0.39-6.25)

was expressed in µg.mL-1. C+ is a positive control

a-f Same letters prescribe that there was no difference between the times of incubation; different letters determine the difference.

A-D Same letters prescribe that there was no difference between the extract concentrations results within the analysis; different letters determine the difference.

178

Fig.2. S. aureus (A), P. aeruginosa (B), and S. entenrica (C) growth curve. All results are the means with standard deviation (n = 8). Extraction concentration

(0.39-6.25) was expressed in µg.mL-1. C+ is a positive control a-g Same letters prescribe that there was no difference between the times of incubation; different letters determine the difference.

A-E Same letters prescribe that there was no difference between the extract concentrations results within the analysis; different letters determine the difference

179

Fig.3. C. jejuni I (A), C. jejuni II (B), C. coli I (C), and C. coli II (D) growth curve. All results are the means with standard deviation (n = 8). Extraction

concentration (0.39) was expressed in µg.mL-1. C+ is a positive control a-g Same letters prescribe that there was no difference between the times of incubation; different letters determine the difference.

A-B Same letters prescribe that there was no difference between the extract concentrations results within the analysis; different letters determine the difference

180

Fig.4. Biofilm formation of spoilage and pathogenic bacteria at different concentrations of pequi peel extract. All results are the means with standard deviation (n = 8). Extraction concentration (0.39-12.5) was expressed in µg.mL-1. C+ is a positive control

A-E Same letters prescribe that there was no difference between the concentration of extract; different letters determine the difference.

181

4 CONSIDERAÇÕES FINAIS

Os parâmetros para obter a melhor extração de compostos antioxidantes do

resíduo da juçara foram 668,18W / 110,45 sec. / 93,64%, enquanto que para um extrato

com melhor atividade antioxidante foram 668,18W / 110,45 sec. / 64,41%. A aplicação

desses extratos em carne de frango mostrou que o extrato obtido com maior teor de

compostos antioxidantes teve melhor ação na estabilização dos processos oxidativos.

Sendo assim, o resíduo da juçara pode ser considerado uma potencial matéria prima para

obtenção desses compostos. Quando comparada a aplicação do extrato do resíduo da

juçara e do pequi, este último apresenta-se como um melhor antioxidante em carne de

frango, quando aplicados os mesmos parâmetros de extração. Outrossim, a casca do pequi

apresenta-se como potencial fonte de compostos antimicrobianos que agem contra

bactérias deteriorantes e patogênicas como por exemplo, E. coli, S. enterica, C. jejuni, C.

coli, S. aureus, e P. aeruginosa.

Portanto, o extrato do resíduo da juçara e do pequi apresentam potencial aplicação

na indústria de alimentos, uma vez que foi observada atividade antioxidante destes frutos

nativos contra a oxidação em carne de frango. Outrossim, a casca do pequi apresentou-se

como potencial fonte de compostos antimicrobianos. Além da manutenção da qualidade

química de produtos cárneos, a utilização de frutas nativas pode aumentar a segurança e

a validade dos mesmos.

Ademais, trabalhos futuros deverão ser realizados avaliando o potencial

antioxidante desses extratos em produtos, tendo em vista que o processamento pode

interferir na sua capacidade antioxidante. Uma futura avaliação sensorial frente aos

produtos elaborados com esses extratos visando a percepção e aceitação dos

consumidores deverá ser conduzida. E também a identificação dos compostos

responsáveis pela atividade antimicrobiana da casca do pequi e a avaliação do mecanismo

de ação dos antimicrobianos naturais frente aos microrganismos deverão ser estudados

futuramente.

182

5 REFERÊNCIAS BIBLIOGRÁFICAS

ABPA. Associação Brasileira de Proteína Animal. Relatório Anual 2016. 2017.

Dispoível em <http://abpa-

br.com.br/storage/files/versao_final_para_envio_digital_1925a_final_abpa_relatorio_an

ual_2016_portugues_web1.pdf>. Acesso em 20 de junho de 2017.

AGUILAR, E. C.; JASCOLKA, T. L.; TEIXEIRA, L. G.; LAGES, P. C.; RIBEIRO, A.

C. C.; VIEIRA, E. L. M.; PELUZIO, M. C. G.; ALVAREZ-LEITE, J. I. Paradoxical

effect of a pequi oil-rich diet on the development of atherosclerosis: balance between

antioxidant and hyperlipidemic properties. Brazilian Journal of Medical and

Biological Research, v. 45, n. 7, p. 601–609, jul. 2012.

AHMED, A. M.; SHIMAMOTO, T.; SHIMAMOTO, T. Characterization of integrons

and resistance genes in multidrug-resistant Salmonella enterica isolated from meat and

dairy products in Egypt. International Journal of Food Microbiology, v. 189, p. 39–

44, out. 2014.

AMARAL, L. F.; MORIEL, P.; FOGLIO, M. A.; MAZZOLA, P. G. C aryocar

brasiliense supercritical CO 2 extract possesses antimicrobial and antioxidant properties

useful for personal care products. BMC complementary and alternative medicine, v.

14, n. 1, p. 1, 2014.

ASCARI, J.; TAKAHASHI, J. A.; BOAVENTURA, M. A. D.; OTHERS.

Phytochemical and biological investigations of Caryocar brasiliense Camb. Boletin

Latinoamericano y del Caribe de plantas medicinales y Aromaticas, v. 9, n. 1, p.

20–28, 2010.

AviSite. IBGE: carne de frango inspecionada aumentou 0,77% em 2016. 2017.

Diponível em <http://www.avisite.com.br/index.php?page=estatisticaseprecos>. Acesso

em 20 de junho de 2017.

AviSite. Produção mundial de carne de frango deve crescer 1% em 2017, diz

USDA. 2016. Disponível em <http://www.cnabrasil.org.br/noticias/producao-mundial-

de-carne-de-frango-deve-crescer-1-em-2017-diz-usda>. Acessado em 20 de junho de

2017, disponível

AZCONA, J. O.; GARCIA, P. T.; COSSU, M. E.; IGLESIAS, B. F.; PICALLO, A.;

PEREZ, C.; GALLINGER, C. I.; SCHANG, M. J.; CANET, Z. E. Meat Quality of

Argentinean “Camperos” Chicken Enhanced in Omega-3 and Omega-9 Fatty Acids.

Meat Science, v. 79, n. 3, p. 437–443, jul. 2008.

BALLARD, T. S.; MALLIKARJUNAN, P.; ZHOU, K.; O’KEEFE, S. Microwave-

Assisted Extraction of Phenolic Antioxidant Compounds from Peanut Skins. Food

Chemistry, v. 120, n. 4, p. 1185–1192, jun. 2010.

BEZERRA, M. A.; SANTELLI, R. E.; OLIVEIRA, E. P.; VILLAR, L. S.;

ESCALEIRA, L. A. Response Surface Methodology (RSM) as a Tool for Optimization

in Analytical Chemistry. Talanta, v. 76, n. 5, p. 965–977, 15 set. 2008.

183

BICUDO, M. O. P.; RIBANI, R. H.; BETA, T. Anthocyanins, Phenolic Acids and

Antioxidant Properties of Juçara Fruits (Euterpe Edulis M.) Along the On-Tree

Ripening Process. Plant Foods for Human Nutrition, v. 69, n. 2, p. 142–147, jun.

2014.

BORGES, G. D. S. C.; GONZAGA, L. V.; JARDINI, F. A.; MANCINI FILHO, J.;

HELLER, M.; MICKE, G.; COSTA, A. C. O.; FETT, R. Protective Effect of Euterpe

Edulis M. on Vero Cell Culture and Antioxidant Evaluation Based on Phenolic

Composition Using HPLC−ESI-MS/MS. Food Research International, v. 51, n. 1, p.

363–369, abr. 2013.

BORGES, G. S. C.; GRACIELI KUNRADI VIEIRA, F.; COPETTI, C.; VALDEMIRO

GONZAGA, L.; ZAMBIAZI, R. C.; MANCINI FILHO, J.; FETT, R. Chemical

Characterization, Bioactive Compounds, and Antioxidant Capacity of Jussara (Euterpe

Edulis) Fruit from the Atlantic Forest in Southern Brazil. Food Research

International, v. 44, n. 7, p. 2128–2133, ago. 2011.

CARVALHO, R. H.; IDA, E. I.; MADRUGA, M. S.; MARTÍNEZ, S. L.;

SHIMOKOMAKI, M.; ESTÉVEZ, M. Underlying Connections between the Redox

System Imbalance, Protein Oxidation and Impaired Quality Traits in Pale, Soft and

Exudative (PSE) Poultry Meat. Food Chemistry, v. 215, p. 129–137, jan. 2017.

CASTRO, W. F.; MARIUTTI, L. R. B.; BRAGAGNOLO, N. The Effects of Colorifico

on Lipid Oxidation, Colour and Vitamin E in Raw and Grilled Chicken Patties during

Frozen Storage. Food Chemistry, v. 124, n. 1, p. 126–131, jan. 2011.

CHANDRASEKARAN, S.; RAMANATHAN, S.; BASAK, T. Microwave Food

processing—A Review. Food Research International, v. 52, n. 1, p. 243–261, jun.

2013.

CHEN, H.; KIM, H. U.; WENG, H.; BROWSE, J. Malonyl-CoA Synthetase, Encoded

by ACYL ACTIVATING ENZYME13, Is Essential for Growth and Development of

Arabidopsis. The Plant Cell, v. 23, n. 6, p. 2247–2262, 1 jun. 2011.

CHUN, H. H.; KIM, J. Y.; LEE, B. D.; YU, D. J.; SONG, K. B. Effect of UV-C

Irradiation on the Inactivation of Inoculated Pathogens and Quality of Chicken Breasts

during Storage. Food Control, v. 21, n. 3, p. 276–280, mar. 2010.

CICHOSKI, A. J.; MOURA, H. C.; SILVA, M. S.; RAMPELOTTO, C.; WAGNER, R.;

BARIN, J. S.; VENDRUSCOLO, R. G.; DUGATTO, J. S.; ATHAYDE, D. R.; DALLA

COSTA, M. A. Oxidative and Microbiological Profiles of Chicken Drumsticks Treated

with Ultraviolet-C Radiation: UV-C Effect on Oxidative and Microbiological Profiles

of Chicken. Journal of Food Processing and Preservation, v. 39, n. 6, p. 2780–2791,

dez. 2015.

CONTINI, C.; ÁLVAREZ, R.; O’SULLIVAN, M.; DOWLING, D. P.; GARGAN, S.

Ó.; MONAHAN, F. J. Effect of an Active Packaging with Citrus Extract on Lipid

Oxidation and Sensory Quality of Cooked Turkey Meat. Meat Science, v. 96, n. 3, p.

1171–1176, mar. 2014.

184

CONTINI, C.; KATSIKOGIANNI, M. G.; O’NEILL, F. T.; O’SULLIVAN, M.;

DOWLING, D. P.; MONAHAN, F. J. PET Trays Coated with Citrus Extract Exhibit

Antioxidant Activity with Cooked Turkey Meat. LWT - Food Science and

Technology, v. 47, n. 2, p. 471–477, jul. 2012.

CORREIO BRAZILIENSE. Brasil é o segundo maior produtor mundial de frango.

2017. Disponível em <http://www.cnabrasil.org.br/noticias/brasil-e-o-segundo-maior-

produtor-mundial-de-frango>. Acesso em 20 de junho de 2017.

CUSHINE, T. P.; LAMB, A. J. Antimicrobial activity of flavonoids. International

Journal of Antimicrobial Agents, v. 26, n. 5, p. 343-356, 2006.

DA SILVA, C. L.; SAES, M. S. Estruturas e Características da Cadeia de Valor a partir

do tipo de governança: uma avaliação preliminar da avicultura de corte paranaense.

Informe GEPEC, v. 9, n. 1, 2005. Disponível em: <http://e-

revista.unioeste.br/index.php/gepec/article/view/224>. Acesso em: 1 jul. 2017.

DAHMOUNE, F.; NAYAK, B.; MOUSSI, K.; REMINI, H.; MADANI, K.

Optimization of Microwave-Assisted Extraction of Polyphenols from Myrtus

Communis L. Leaves. Food Chemistry, v. 166, p. 585–595, jan. 2015.

DAHMOUNE, F.; SPIGNO, G.; MOUSSI, K.; REMINI, H.; CHERBAL, A.;

MADANI, K. Pistacia Lentiscus Leaves as a Source of Phenolic Compounds:

Microwave-Assisted Extraction Optimized and Compared with Ultrasound-Assisted and

Conventional Solvent Extraction. Industrial Crops and Products, v. 61, p. 31–40,

nov. 2014.

DAIRI, S.; GALEANO-DÍAZ, T.; ACEDO-VALENZUELA, M. I.; GODOY-

CABALLERO, M. P.; DAHMOUNE, F.; REMINI, H.; MADANI, K. Monitoring

Oxidative Stability and Phenolic Compounds Composition of Myrtle-Enriched Extra

Virgin Olive during Heating Treatment by Flame, Oven and Microwave Using

Reversed Phase Dispersive Liquid–liquid Microextraction (RP-DLLME)-HPLC-DAD-

FLD Method. Industrial Crops and Products, v. 65, p. 303–314, mar. 2015.

DAMIANI, C.; BOAS, V.; DE BARROS, E. V.; FERRI, P. H.; PINTO, D. M.;

RODRIGUES, L. J. Volatile compounds profile of fresh-cut peki fruit stored under

different temperatures. Food Science and Technology (Campinas), v. 29, n. 2, p. 435–

439, 2009.

DE BRITO, E. S.; DE ARAÚJO, M. C. P.; ALVES, R. E.; CARKEET, C.;

CLEVIDENCE, B. A.; NOVOTNY, J. A. Anthocyanins Present in Selected Tropical

Fruits: Acerola, Jambolão, Jussara, and Guajiru. Journal of Agricultural and Food

Chemistry, v. 55, n. 23, p. 9389–9394, nov. 2007.

DEVATKAL, S. K.; NAVEENA, B. M. Effect of Salt, Kinnow and Pomegranate Fruit

by-Product Powders on Color and Oxidative Stability of Raw Ground Goat Meat during

Refrigerated Storage. Meat Science, v. 85, n. 2, p. 306–311, jun. 2010.

EMBRAPA. Sistemas de produção de frangos de corte. 2008. Embrapa Suínos e

Aves. Disponível em < https://www.aviculturaindustrial.com.br/imprensa/sistemas-de-

185

producao-de-frangos-de-corte/20081029-101008-3301 >. Acesso em 20 de junho de

2017.

ERICKSON, M. C. Lipid Oxidation of Muscle Foods. Capítulo 12. In: AKON, C.C. ;

MIN, D. B. Food Lipids: chemistry, nutrition and biotechnology. 3rd Edição. CRC

Press. 2008. p.321-364.

FARIA, W. C. S.; DAMASCENO, G. A. de B.; FERRARI, M. Moisturizing Effect of a

Cosmetic Formulation Containing Pequi Oil (Caryocar Brasiliense) from the Brazilian

Cerrado Biome. Brazilian Journal of Pharmaceutical Sciences, v. 50, n. 1, p. 131–

136, mar. 2014.

FARIA-MACHADO, A. F.; TRES, A.; VAN RUTH, S. M.; ANTONIASSI, R.;

JUNQUEIRA, N. T. V.; LOPES, P. S. N.; BIZZO, H. R. Discrimination of Pulp Oil and

Kernel Oil from Pequi ( Caryocar Brasiliense ) by Fatty Acid Methyl Esters

Fingerprinting, Using GC-FID and Multivariate Analysis. Journal of Agricultural and

Food Chemistry, v. 63, n. 45, p. 10064–10069, 18 nov. 2015.

FELZENSZWALB, I.; DA COSTA MARQUES, M. R.; MAZZEI, J. L.; AIUB, C. A.

F. Toxicological Evaluation of Euterpe Edulis: A Potential Superfruit to Be Considered.

Food and Chemical Toxicology, v. 58, p. 536–544, ago. 2013.

FENG, L.; SHI, C.; BEI, Z.; LI, Y.; YUAN, D.; GONG, Y.; HAN, J. Rosemary Extract

in Combination with Ɛ-Polylysine Enhance the Quality of Chicken Breast Muscle

during Refrigerated Storage. International Journal of Food Properties, v. 19, n. 10, p.

2338–2348, 2 out. 2016.

FERREIRA, V. C. S.; MORCUENDE, D.; HÉRNANDEZ-LÓPEZ, S. H.; MADRUGA,

M. S.; SILVA, F. A. P.; ESTÉVEZ, M. Antioxidant Extracts from Acorns ( Quercus

Ilex L.) Effectively Protect Ready-to-Eat (RTE) Chicken Patties Irrespective of

Packaging Atmosphere: Acorn as Antioxidant in Convenience Food. Journal of Food

Science, v. 82, n. 3, p. 622–631, mar. 2017.

FRASAO, B. D. S.; COSTA, M. P. da; RODRIGUES, B. L.; LIMA, B. R. C.; CONTE-

JUNIOR, C. A. Natural Antioxidant Activity and Compounds Content from Wastes of

Euterpe edulis Berries. Journal of Agricultural Science, v. 9, n. 3, p. 178, 13 fev.

2017.

GALLO, M.; FERRACANE, R.; NAVIGLIO, D. Antioxidant Addition to Prevent Lipid

and Protein Oxidation in Chicken Meat Mixed with Supercritical Extracts of Echinacea

Angustifolia. The Journal of Supercritical Fluids, v. 72, p. 198–204, dez. 2012.

HAN, X.; SHEN, T.; LOU, H. Dietary polyphenols and their biological significance.

International Journal of Molecular Sciences, v. 8, n. 9, p. 950–988, 2007.

HILGEMANN, M.; COSTA BASSETTO, V.; TATSUO KUBOTA, L. Electrochemical

approaches employed for sensing the antioxidant capacity exhibited by vegetal extracts:

a review. Combinatorial chemistry & high throughput screening, v. 16, n. 2, p. 98–

108, 2013.

186

HWANG, K.-E.; KIM, H.-W.; SONG, D.-H.; KIM, Y.-J.; HAM, Y.-K.; LEE, J.-W.;

CHOI, Y.-S.; KIM, C.-J. Effects of Antioxidant Combinations on Shelf Stability of

Irradiated Chicken Sausage during Storage. Radiation Physics and Chemistry, v. 106,

p. 315–319, jan. 2015.

JAYASENA, D. D.; JO, C. Essential Oils as Potential Antimicrobial Agents in Meat

and Meat Products: A Review. Trends in Food Science & Technology, v. 34, n. 2, p.

96–108, dez. 2013.

JAYAWARDANA, B. C.; LIYANAGE, R.; LALANTHA, N.; IDDAMALGODA, S.;

WETHTHASINGHE, P. Antioxidant and Antimicrobial Activity of Drumstick

(Moringa Oleifera) Leaves in Herbal Chicken Sausages. LWT - Food Science and

Technology, v. 64, n. 2, p. 1204–1208, dez. 2015.

JONGBERG, S.; TØRNGREN, M. A.; GUNVIG, A.; SKIBSTED, L. H.; LUND, M. N.

Effect of Green Tea or Rosemary Extract on Protein Oxidation in Bologna Type

Sausages Prepared from Oxidatively Stressed Pork. Meat Science, v. 93, n. 3, p. 538–

546, mar. 2013.

KARRE, L.; LOPEZ, K.; GETTY, K. J. K. Natural Antioxidants in Meat and Poultry

Products. Meat Science, v. 94, n. 2, p. 220–227, jun. 2013.

KORIN. Livre de Antibióticos. 2017. Disponível em

<http://www.korin.com.br/produtos/frango/frango-livre-de-antibioticos/>. Acesso

em 20 de junho de 2017.

LI, H.; DENG, Z.; WU, T.; LIU, R.; LOEWEN, S.; TSAO, R. Microwave-Assisted

Extraction of Phenolics with Maximal Antioxidant Activities in Tomatoes. Food

Chemistry, v. 130, n. 4, p. 928–936, fev. 2012.

LI, M.; NGADI, M. O.; MA, Y. Optimisation of Pulsed Ultrasonic and Microwave-

Assisted Extraction for Curcuminoids by Response Surface Methodology and Kinetic

Study. Food Chemistry, v. 165, p. 29–34, dez. 2014.

LIAZID, A.; GUERRERO, R. F.; CANTOS, E.; PALMA, M.; BARROSO, C. G.

Microwave Assisted Extraction of Anthocyanins from Grape Skins. Food Chemistry,

v. 124, n. 3, p. 1238–1243, fev. 2011.

LUND, M. N.; HEINONEN, M.; BARON, C. P.; ESTÉVEZ, M. Protein Oxidation in

Muscle Foods: A Review. Molecular Nutrition & Food Research, v. 55, n. 1, p. 83–

95, jan. 2011.

MACHADO, M. T. C.; MELLO, B. C. B. S.; HUBINGER, M. D. Study of Alcoholic

and Aqueous Extraction of Pequi (Caryocar Brasiliense Camb.) Natural Antioxidants

and Extracts Concentration by Nanofiltration. Journal of Food Engineering, v. 117, n.

4, p. 450–457, ago. 2013.

MARIUTTI, L. R. B.; ORLIEN, V.; BRAGAGNOLO, N.; SKIBSTED, L. H. Effect of

Sage and Garlic on Lipid Oxidation in High-Pressure Processed Chicken Meat.

European Food Research and Technology, v. 227, n. 2, p. 337–344, jun. 2008.

187

MARSILI, R. T.; LASKONIS, C. R. Odorant Synergy Effects as the Cause of Fishy

Malodors in Algal Marine Oils. Journal of Agricultural and Food Chemistry, v. 62,

n. 40, p. 9676–9682, 8 out. 2014.

MAZUMDER, J.; KUMRIA, K.; PATHAK, D. Evaluation of synergistic antimicrobial

activity and antioxidant activity of blend of essential oil contains fennel, coriander,

ajowan and caraway. IOSR J. Pharm. Biol. Sci, v. 9, p. 87–94, 2014.

MICHELIN, D. C.; MORESCHI, P. E.; LIMA, A. C.; NASCIMENTO, G. G. F.;

PAGANELLI, M. O.; CHAUD, M. V. Evaluation of the antimicrobial activity of

vegetal extracts. Revista Brasileira de Farmacognosia, v. 15, n. 4, p. 316–320, 2005.

MIELNIK, M. B.; OLSEN, E.; VOGT, G.; ADELINE, D.; SKREDE, G. Grape Seed

Extract as Antioxidant in Cooked, Cold Stored Turkey Meat. LWT - Food Science and

Technology, v. 39, n. 3, p. 191–198, abr. 2006.

MIRANDA-VILELA, A. L. Avaliação dos efeitos antigenotóxicos, antioxidantes e

farmacológicos de extratos da polpa do fruto do pequi (Caryocar brasiliense

CAMB). 2009. 188 f., il. Tese (Doutorado em Biologia Animal)-Universidade de

Brasília, Brasília, 2009.

MONTGOMERY, D. C. Design and analysis of experiments. John Wiley. Diponível

em http://bcs.wiley.com/he-bcs/

Books?action=index&itemId=047148735X&itemTypeId=BKS&bcsId=2172. Acesso

em 15 de Agosto de 2016.

NKUKWANA, T. T.; MUCHENJE, V.; MASIKA, P. J.; HOFFMAN, L. C.; DZAMA,

K.; DESCALZO, A. M. Fatty Acid Composition and Oxidative Stability of Breast Meat

from Broiler Chickens Supplemented with Moringa Oleifera Leaf Meal over a Period of

Refrigeration. Food Chemistry, v. 142, p. 255–261, jan. 2014.

OLIVEIRA, L.M.D., RODRIGUES, A.G.; SILVA, E.F.D.; SILVA, E.F.;

CERQUEIRA, L.B.; CASTRO, C.H.; PEDRINHO, G.R.; CARVALHO, M.H.C.;

PONTAROLO, R.; COSTA, E.A.; CAMPOS, F.R.; FILGUEIRA, F.P.; GHEDINI, P.C.

Endothelium-dependent vasorelaxant effect of butanolic fraction from Caryocar

brasiliense Camb. leaves in rat thoracic aorta. Journal of Evidence-Based

Complementary & Alternative Medicine,v.2012, n.9, p.1-9, 2012.

PAREDES-LÓPEZ, O.; CERVANTES-CEJA, M. L.; VIGNA-PÉREZ, M.;

HERNÁNDEZ-PÉREZ, T. Berries: Improving Human Health and Healthy Aging, and

Promoting Quality Life—A Review. Plant Foods for Human Nutrition, v. 65, n. 3, p.

299–308, set. 2010.

PAULA-JUNIOR, W.; ROCHA, F. H.; DONATTI, L.; FADEL-PICHETH, C. M.;

WEFFORT-SANTOS, A. M. Leishmanicidal, antibacterial, and antioxidant activities of

Caryocar brasiliense Cambess leaves hydroethanolic extract. Revista Brasileira de

Farmacognosia, v. 16, p. 625–630, 2006.

PENKO, A.; POLAK, T.; LUŠNIC POLAK, M.; POŽRL, T.; KAKOVIČ, D.;

ŽLENDER, B.; DEMŠAR, L. Oxidative Stability of N-3-Enriched Chicken Patties

188

under Different Package-Atmosphere Conditions. Food Chemistry, v. 168, p. 372–382,

fev. 2015.

PÉREZ-SERRADILLA, J. A.; LUQUE DE CASTRO, M. D. Microwave-Assisted

Extraction of Phenolic Compounds from Wine Lees and Spray-Drying of the Extract.

Food Chemistry, v. 124, n. 4, p. 1652–1659, fev. 2011.

RADHA KRISHNAN, K.; BABUSKIN, S.; AZHAGU SARAVANA BABU, P.;

SASIKALA, M.; SABINA, K.; ARCHANA, G.; SIVARAJAN, M.; SUKUMAR, M.

Antimicrobial and Antioxidant Effects of Spice Extracts on the Shelf Life Extension of

Raw Chicken Meat. International Journal of Food Microbiology, v. 171, p. 32–40,

2014.

RATTER, J.A., BRIDGEWATER, S. & RIBEIRO, J.F. Analysis of the floristic

composition of the Brazilian cerrado vegetation III: comparison of the woody

vegetation of 376 areas. Edinburgh Journal of Botany, v.60, p. 57-109, 2003

RIBEIRO, D. M.; FERNANDES, D. C.; ALVES, A. M.; NAVES, M. M. V.

Carotenoids Are Related to the Colour and Lipid Content of the Pequi (Caryocar

Brasiliense Camb.) Pulp from the Brazilian Savanna. Food Science and Technology

(Campinas), v. 34, n. 3, p. 507–512, set. 2014.

ROESLER, R.; CATHARINO, R. R.; MALTA, L. G.; EBERLIN, M. N.; PASTORE,

G. Antioxidant Activity of Caryocar Brasiliense (Pequi) and Characterization of

Components by Electrospray Ionization Mass Spectrometry. Food Chemistry, v. 110,

n. 3, p. 711–717, out. 2008.

ROESLER, R.; MALTA, L. G.; CARRASCO, L. C.; HOLANDA, R. B.; SOUSA, C.

A. S.; PASTORE, G. M. Atividade antioxidante de frutas do cerrado. Ciência e

Tecnologia de Alimentos, v. 27, n. 1, p. 53–60, 2007.

ROUTRAY, W.; ORSAT, V. Microwave-Assisted Extraction of Flavonoids: A Review.

Food and Bioprocess Technology, v. 5, n. 2, p. 409–424, fev. 2012.

RUFINO, M. do S. M.; ALVES, R. E.; DE BRITO, E. S.; P?REZ-JIM?NEZ, J.;

SAURA-CALIXTO, F.; MANCINI-FILHO, J. Bioactive Compounds and Antioxidant

Capacities of 18 Non-Traditional Tropical Fruits from Brazil. Food Chemistry, v. 121,

n. 4, p. 996–1002, ago. 2010.

SEBRANEK, J. G.; SEWALT, V. J. H.; ROBBINS, K. L.; HOUSER, T. A.

Comparison of a Natural Rosemary Extract and BHA/BHT for Relative Antioxidant

Effectiveness in Pork Sausage. Meat Science, v. 69, n. 2, p. 289–296, fev. 2005.

SEERAM, N. P. Berry Fruits: Compositional Elements, Biochemical Activities, and the

Impact of Their Intake on Human Health, Performance, and Disease. Journal of

Agricultural and Food Chemistry, v. 56, n. 3, p. 627–629, fev. 2008.

SEOL, K.-H.; SEOL, H.-C.; PRAYAD, T.; KIM, H.-W.; JANG, A.-R.; HAM, J.-S.;

OH, M.-H.; KIM, D.-H.; LEE, M.-H. The Effect of the Water Extracts of Digestive

Medicinal Plants on the Shelf-life of Pork Patties. Korean Journal for Food Science of

Animal Resources, v. 31, n. 1, p. 54–60, 2011.

189

SHAH, M. A.; BOSCO, S. J. D.; MIR, S. A. Plant Extracts as Natural Antioxidants in

Meat and Meat Products. Meat Science, v. 98, n. 1, p. 21–33, set. 2014.

SILVA, P. P. M.; CARMO, L. F.; SIVLEIRA-DINIZ, M. F.; CASEMIRO, R. C.;

SPOTO, M. H. F. Physical, chemical and lipid composition of juçara (Euterpe edulis

Mart.) pulp. Brazilian Journal of Food and Nutrition, v.24, n.1, p. 7-13, jan/mar.

2013.

SMET, K.; RAES, K.; HUYGHEBAERT, G.; HAAK, L.; ARNOUTS, S.; DE SMET,

S. Lipid and Protein Oxidation of Broiler Meat as Influenced by Dietary Natural

Antioxidant Supplementation. Poultry Science, v. 87, n. 8, p. 1682–1688, 1 ago. 2008.

SOLADOYE, O. P.; JUÁREZ, M. L.; AALHUS, J. L.; SHAND, P.; ESTÉVEZ, M.

Protein Oxidation in Processed Meat: Mechanisms and Potential Implications on

Human Health: Protein Oxidation, Nutrition, and Health…. Comprehensive Reviews

in Food Science and Food Safety, v. 14, n. 2, p. 106–122, mar. 2015.

STALIKAS, C. D. Extraction, Separation, and Detection Methods for Phenolic Acids

and Flavonoids. Journal of Separation Science, v. 30, n. 18, p. 3268–3295, dez. 2007.

TIWARI, B. K.; VALDRAMIDIS, V. P.; O? DONNELL, C. P.;

MUTHUKUMARAPPAN, K.; BOURKE, P.; CULLEN, P. J. Application of Natural

Antimicrobials for Food Preservation. Journal of Agricultural and Food Chemistry,

v. 57, n. 14, p. 5987–6000, 22 jul. 2009.

VIEIRA, G. S.; CAVALCANTI, R. N.; MEIRELES, M. A. A.; HUBINGER, M. D.

Chemical and Economic Evaluation of Natural Antioxidant Extracts Obtained by

Ultrasound-Assisted and Agitated Bed Extraction from Jussara Pulp (Euterpe Edulis).

Journal of Food Engineering, v. 119, n. 2, p. 196–204, nov. 2013.

VOGADO, G. M. S.; VOGADO, K. T. S.; FONSECA, W. J. L.; FONSECA, W. L.;

OLIVEIRA, A. M.; VOGADO, W. F.; LUZ, C. S. M. EVOLUÇÃO DA

AVICULTURA BRASILEIRA. Nucleus Animalium, v. 8, n. 1, p. 49–58, 30 maio

2016.

WANG, Y.; CHEN, H.; YU, O. A Plant Malonyl-CoA Synthetase Enhances Lipid

Content and Polyketide Yield in Yeast Cells. Applied Microbiology and

Biotechnology, v. 98, n. 12, p. 5435–5447, jun. 2014.

XIAO, S.; ZHANG, W. G.; LEE, E. J.; MA, C. W.; AHN, D. U. Lipid and Protein

Oxidation of Chicken Breast Rolls as Affected by Dietary Oxidation Levels and

Packaging. Journal of Food Science, v. 76, n. 4, p. C612–C617, maio 2011.

YANG, Y.; LIN, Y.; LI, L.; LINHARDT, R. J.; YAN, Y. Regulating Malonyl-CoA

Metabolism via Synthetic Antisense RNAs for Enhanced Biosynthesis of Natural

Products. Metabolic Engineering, v. 29, p. 217–226, maio 2015.

190

6 ANEXOS

6.1 COMPROVANTE DE PUBLICAÇÃO DO ARTIGO I

205

6.2 COMPROVANTE DE SUBMISSÃO DO ARTIGO II

206

6.3 COMPROVANTE DE SUBMISSÃO DO ARTIGO III

207

6.4 COMPROVANTE DE PUBLICAÇÃO DO ARTIGO IV

UNIVERSIDADE FEDERAL FLUMINENSE ÁREA DE...

Documents

Transcript of UNIVERSIDADE FEDERAL FLUMINENSE ÁREA DE...